ID: 928106427

View in Genome Browser
Species Human (GRCh38)
Location 2:28473053-28473075
Sequence GGCCCCAGTGCAGGATCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1291
Summary {0: 12, 1: 71, 2: 238, 3: 374, 4: 596}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928106427 Original CRISPR GGCCCCAGTGCAGGATCCAC TGG Intronic
900113197 1:1018251-1018273 AGCCCCAGTGCGGGATCCACTGG - Intergenic
900405346 1:2490496-2490518 GGCCCCAGAGCAGTGTCCAGAGG - Intronic
901045909 1:6395713-6395735 AGCCCCAGTGCGGGACCCACTGG - Intergenic
901884959 1:12216289-12216311 GGCCTCTGTGCAGGAAACACAGG - Intergenic
902032543 1:13433786-13433808 GGCCCCGGTGTGGGATCCACTGG - Intergenic
902033520 1:13439668-13439690 GGCCCCGGTAGGGGATCCACTGG + Intergenic
902100353 1:13983102-13983124 AGCCCCCGTGCGAGATCCACTGG - Intergenic
902280248 1:15369151-15369173 AGCCCCCGTGCAGGAACCAAGGG + Intronic
903624678 1:24721903-24721925 GGCCCTGGTACAGGATCCACTGG + Intergenic
904238816 1:29131083-29131105 GGCCCCGGTGTGGGATCCACTGG - Intergenic
905235040 1:36540373-36540395 GCCCACAGTGCAGGTTCGACCGG - Intergenic
905590426 1:39158630-39158652 GACCCCAGCCCAGGCTCCACTGG - Intronic
905742971 1:40388273-40388295 AGCCCCAGTGCGAGATCCACTGG + Intronic
906083061 1:43107302-43107324 GGCCCTGGTGCGAGATCCACTGG - Intergenic
906563431 1:46778448-46778470 AACCCCGGTGCAGAATCCACTGG - Intronic
907102159 1:51847317-51847339 TGGCCCGGTGCTGGATCCACTGG - Intronic
907759433 1:57343389-57343411 GGCCCTGGTGCAGGATCCACTGG - Intronic
907980128 1:59472506-59472528 AGCCCCGGTGCGGGATCCACTGG + Intronic
908888662 1:68818129-68818151 AGCCCCAGTGCGAGATCCACTGG + Intergenic
909318469 1:74253276-74253298 GGCCCCTGTGCGGGATCCACTGG - Intronic
909608660 1:77531703-77531725 TGGCCCAGTGCAGGATCCACTGG - Intronic
909759313 1:79269541-79269563 AGCCCCGGTGCAGGATCCACTGG + Intergenic
910034692 1:82776721-82776743 AGCCCTGGTGCGGGATCCACTGG - Intergenic
910693071 1:89984599-89984621 CCCCCCACTGCAGGATCCACTGG - Intergenic
911001521 1:93170650-93170672 GGCCCAGGTGCGGGATCCACTGG + Intronic
912316003 1:108667897-108667919 AGCTCTGGTGCAGGATCCACTGG + Intergenic
912538679 1:110396270-110396292 GGCCCCAGTGCGAGATCCACTGG - Intergenic
913160991 1:116146493-116146515 AGCCCCAGTGCGGGATCCACTGG - Intergenic
913469075 1:119171926-119171948 GGCCCCGGTGCGGGATCCACTGG + Intergenic
913470258 1:119179445-119179467 GGCCCTGGTGCAGGATCCACTGG + Intergenic
913486181 1:119334126-119334148 GGCACCGGTACCGGATCCACTGG + Intergenic
913987169 1:143575476-143575498 GGCCCTGGTGCGAGATCCACTGG + Intergenic
914438360 1:147680705-147680727 AGCCCTGGTGCGGGATCCACTGG - Intergenic
914928133 1:151906558-151906580 AGCCCCAGTGCGAGATCCACTGG + Intronic
915104198 1:153522198-153522220 AGCCCTGGTGCAGGATCCACTGG + Intergenic
915242253 1:154532028-154532050 GGCCCCGGTGCGAGATCCACTGG - Intronic
915363605 1:155301045-155301067 GGCCAGAGTCCAGGAACCACGGG + Intronic
915865474 1:159494547-159494569 AGCCCTGGTGCGGGATCCACTGG - Intergenic
916219942 1:162433573-162433595 AGCCCCAGTGCAGGATCCACTGG + Intergenic
916605875 1:166342799-166342821 GGCCCTGGTGCAGGATCCACTGG - Intergenic
916910035 1:169337013-169337035 AGCCCCGGTGCGGGATCCACTGG - Intronic
916960360 1:169882532-169882554 AGCCCCAGTGCGGGATCCACTGG + Intronic
917348792 1:174056348-174056370 AGCCCCAGTGCGGGATCCACTGG - Intergenic
917445337 1:175102239-175102261 AGCCCCAGTGCGGGATCCACTGG - Intronic
917720181 1:177779715-177779737 GGGCCCGGGGCTGGATCCACAGG - Intergenic
918059087 1:181046250-181046272 AGCCCCAGTGGGGGATCCACTGG + Intronic
918511943 1:185321655-185321677 TGCCCCTGTGCAGGATCCACTGG - Intergenic
918709019 1:187704041-187704063 AGCCCCGGTGCGGGATCCACTGG + Intergenic
918720909 1:187850623-187850645 AGCCCCTGTGCGGGATCCACTGG + Intergenic
918790045 1:188813440-188813462 GGCCCCAGTGCGGGATCCACTGG + Intergenic
918791964 1:188841114-188841136 AGCCTCAGTGCAGGATCCACTGG - Intergenic
918853136 1:189718238-189718260 AGCCCTCGTGCGGGATCCACTGG - Intergenic
918952070 1:191151803-191151825 AGCCCCGGTGCGGGATACACTGG + Intergenic
919049710 1:192499016-192499038 GGCCCCAGTGCAGGATCCACTGG - Intergenic
919237093 1:194859421-194859443 AGCACCGGTGCGGGATCCACTGG + Intergenic
919250905 1:195054699-195054721 AGCCCCAGTAAGGGATCCACTGG + Intergenic
919297701 1:195722853-195722875 AGCCCCCGTGCTGGATCCACTGG - Intergenic
919631020 1:199960041-199960063 GGCCCCAGTGCGGGAACCACTGG + Intergenic
920731295 1:208488377-208488399 AGCCCCAGTGTGGGATCCACTGG - Intergenic
920756760 1:208740099-208740121 AGCCCCGGTGCGGGATCCACTGG + Intergenic
920881950 1:209888887-209888909 AGCCCGGGTGCGGGATCCACTGG - Intergenic
921094329 1:211874203-211874225 GGCCCCTGTGCGGGATCCACTGG - Intergenic
921096336 1:211889831-211889853 GGCTCTGGTGCAAGATCCACTGG + Intergenic
921396302 1:214673086-214673108 AGCCCGGGTGCGGGATCCACTGG - Intergenic
921454407 1:215350464-215350486 GGCCCGTGTCCAGGCTCCACAGG - Intergenic
921903757 1:220475607-220475629 AGCCCCCGTGCTGGATCCACTGG - Intergenic
922056901 1:222050167-222050189 AGCCCCTGTGCGGGATCCATTGG + Intergenic
922485501 1:225970187-225970209 AGCACCAGTGCGGGATCCACTGG + Intergenic
922855869 1:228774125-228774147 AGCCCCGGTGCGGGATCCACTGG + Intergenic
922985954 1:229865877-229865899 AGCCCTGGTGCGGGATCCACTGG + Intergenic
923172530 1:231430758-231430780 GGCCCCAGTGCGGGATCCACTGG - Intergenic
923193381 1:231641888-231641910 AGCCCCGGTGCGGGATCCACTGG - Intronic
923324737 1:232871383-232871405 AGCCCCGGTGCGGGATCCACTGG - Intergenic
923353260 1:233129541-233129563 GGCCTCAGTGTGGGATCCACTGG + Intronic
923437319 1:233979704-233979726 GGCCCCAGTGCATTAACCCCAGG - Intronic
923573895 1:235140715-235140737 AGCCCCGGTGCAGGATCCACTGG + Intronic
923930003 1:238684571-238684593 AGCCCCTGTGGGGGATCCACTGG - Intergenic
924117600 1:240762909-240762931 AGCCCCGGTGCGGGATCCACTGG + Intergenic
924199631 1:241645572-241645594 GGGCCCAGAGCAGCATCTACAGG - Intronic
924359217 1:243218370-243218392 GGCCCCAGTGGAGGAGGCAGGGG + Intronic
924625708 1:245695194-245695216 GGCCCCAGACCAGGACCCTCGGG + Intronic
924835083 1:247639553-247639575 GGCCCAAGGGCGGGATCCTCAGG - Intergenic
1063300313 10:4844854-4844876 CGGCCCCGTGCGGGATCCACTGG - Intronic
1063318647 10:5032458-5032480 AGCCCCGGTGCGGGATCCACTGG - Intronic
1063769775 10:9183771-9183793 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1065441414 10:25756419-25756441 AGCCCCGGTACGGGATCCACTGG + Intergenic
1065743203 10:28815613-28815635 AGCCCCTGTGCGGGATCCACTGG - Intergenic
1065752100 10:28896759-28896781 AGCTCCGGTGCGGGATCCACTGG - Intergenic
1065895960 10:30163233-30163255 AGCCCCTGTGCGGGATCCACTGG + Intergenic
1065995585 10:31056241-31056263 GGCCCTGGTGCAGGATCCACTGG + Intergenic
1066235379 10:33480407-33480429 AGCCCCGGTGTGGGATCCACCGG - Intergenic
1066296172 10:34055936-34055958 AGCCCCCGTGCGGGATCCACTGG + Intergenic
1066339539 10:34517092-34517114 GGCACCAGTGCCAGTTCCACGGG - Exonic
1066544169 10:36481937-36481959 AGGCCCGGTGCAGGATCCACTGG - Intergenic
1066598271 10:37076384-37076406 GGCCCCAGTGCAGGATCCACTGG + Intergenic
1066660954 10:37737750-37737772 GGCCCCCGTGCGGGATCCACTGG + Intergenic
1067469810 10:46528197-46528219 GCCACCAGGGCAGGAACCACAGG + Intergenic
1067750601 10:48968832-48968854 GGCCCCGGGGCAGGAGTCACAGG - Intronic
1067812919 10:49444318-49444340 GGAGGCAGTGTAGGATCCACAGG + Intergenic
1068374100 10:56155545-56155567 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1068455606 10:57250261-57250283 AGCCCCAGGGCGGCATCCACTGG + Intergenic
1068460437 10:57321897-57321919 AGCCCCTGGGCGGGATCCACTGG + Intergenic
1068792348 10:61041035-61041057 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1068978217 10:63034010-63034032 AGCCCCGGTGCGGGATCCACCGG + Intergenic
1069215278 10:65812032-65812054 GGCCCTAGTGCCGGATTCACTGG - Intergenic
1069766223 10:70862082-70862104 AGCCCCGGTGCGGGATCCACTGG + Intronic
1069988757 10:72301024-72301046 GGCCCTGGTGCGGGATCCACTGG + Intergenic
1070564016 10:77590220-77590242 GGCCCCGGTGCGGGATCCACTGG - Intronic
1070937959 10:80315822-80315844 GGCCCCAGTGCGGGATCCACTGG + Intergenic
1070968382 10:80543635-80543657 AGCCCCAGTGCGGGATCCACTGG + Intronic
1070973456 10:80586295-80586317 GGCCCTGGTGCGCGATCCACTGG + Intronic
1071041011 10:81309014-81309036 AGTCCCGGTGCGGGATCCACTGG - Intergenic
1071055762 10:81506194-81506216 AGCCCTGGTGCAGGATCCACTGG + Intergenic
1071085279 10:81862624-81862646 GGCCCCAGTGCAGGATCCACTGG - Intergenic
1071388078 10:85141821-85141843 AGCCCTTGTGCGGGATCCACTGG + Intergenic
1071797010 10:89018593-89018615 AGCCCCGGTGCAGGATCCACGGG - Intergenic
1071900932 10:90119769-90119791 AGCCCCGGTGTGGGATCCACTGG - Intergenic
1071963709 10:90832114-90832136 AGCCCCAGTGCCAGATCCACTGG - Intronic
1073532591 10:104245593-104245615 CAGCCCTGTGCAGGATCCACTGG + Intronic
1073789696 10:106928044-106928066 AGCGCCGGTGCGGGATCCACTGG - Intronic
1074098212 10:110331887-110331909 GGCCCCAGTGCGGGATCCACTGG + Intergenic
1074317234 10:112370746-112370768 TGACCCAGTGCTGGATCCACTGG + Intergenic
1074317361 10:112371637-112371659 GGCCACGGTGCGGGATCGACTGG + Intergenic
1074663331 10:115689560-115689582 GGCCCCAGAACAGCATACACTGG + Intronic
1074732538 10:116393773-116393795 GGCCCCGGTGCAAGATCCACTGG + Intergenic
1075255701 10:120924246-120924268 AGCCCCTTTGCGGGATCCACTGG + Intergenic
1075305784 10:121365951-121365973 AGCCCCAGTGCGGGATCCACTGG + Intergenic
1075307694 10:121382540-121382562 AGCCCCAGTGCGGGATCCACTGG + Intergenic
1075504929 10:123013441-123013463 GGCACTGGTGCAAGATCCACTGG - Intronic
1075537443 10:123283293-123283315 AGCCCCTTTGCGGGATCCACTGG - Intergenic
1076140103 10:128071561-128071583 GGCCCCAAAGCAGACTCCACAGG + Intronic
1076261578 10:129071291-129071313 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1076484758 10:130808821-130808843 GGAACCAGTGCAGGAGCCCCCGG - Intergenic
1077046813 11:550322-550344 GGCCCCGGGGCTGGAGCCACAGG - Intronic
1077219313 11:1408390-1408412 AGCCCCAGGGCAGCAGCCACGGG + Intronic
1077583724 11:3434924-3434946 GGCCCTGGTGTGGGATCCACTGG - Intergenic
1077764671 11:5144817-5144839 AGCCCCGGTGTGGGATCCACTGG + Intergenic
1077778140 11:5294382-5294404 AGCCCAGGTGCGGGATCCACTGG - Intronic
1078795899 11:14591486-14591508 AGCCCCAGTGTGGGATTCACTGG + Intronic
1078891419 11:15561344-15561366 GGCCCCGGTGCGGTATCCACTGG + Intergenic
1079190908 11:18276075-18276097 GGCCCCGGTGCGGGATCCACTGG - Intergenic
1079555348 11:21753081-21753103 AGCCCCCGTGCGGGATCCATTGG - Intergenic
1079767695 11:24415940-24415962 AGCCCCAGTGTGGGATCCACTGG - Intergenic
1080107425 11:28525736-28525758 GGCCCCGGTGCGGGATCCACTGG - Intergenic
1080138906 11:28891038-28891060 GGCCCCAGTGCGGGATCCAGGGG + Intergenic
1080204500 11:29713075-29713097 GGCCCCAGTGCAGGATCCACTGG + Intergenic
1080557617 11:33431682-33431704 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1081115274 11:39192571-39192593 AGCCCCAGTGCAAGATCCACTGG - Intergenic
1081126860 11:39333008-39333030 GGCCCCGGTGCAGGATCCACTGG - Intergenic
1081315270 11:41623258-41623280 AGCCCCAGTGCGGAATCCACTGG + Intergenic
1081329634 11:41788165-41788187 CGGCCCAGTGTGGGATCCACTGG - Intergenic
1081420975 11:42874334-42874356 AGCCCTGGTGCAGGATCCACTGG + Intergenic
1081422144 11:42881804-42881826 AGCCCCAGTGCGGGATCCACTGG + Intergenic
1081428462 11:42950307-42950329 AGCCCTCGTGCGGGATCCACTGG + Intergenic
1082270372 11:50163986-50164008 AGCCCCAGTACGGGATCCACTGG - Intergenic
1082272195 11:50183695-50183717 AGCCCCAGGGCGGGATCCACTGG + Intergenic
1082698683 11:56401859-56401881 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1083546186 11:63550625-63550647 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1084210542 11:67619458-67619480 AGCACCGGTGCAGGATCCACTGG + Intergenic
1084259200 11:67963644-67963666 AGCTCCTGTGCAGAATCCACTGG + Intergenic
1084813572 11:71631535-71631557 AGCTCCTGTGCGGGATCCACTGG - Intergenic
1085234828 11:75006282-75006304 GCCCACAGTGCAAGATCCAGGGG - Exonic
1085245680 11:75098629-75098651 AGCCCCGGTGCGGGACCCACTGG + Intergenic
1085375964 11:76060986-76061008 GGCCCTGGTGCGGGATCTACTGG + Intronic
1085671017 11:78464909-78464931 AGCCCCAGTGTGGGATCCACTGG - Intronic
1085941200 11:81208036-81208058 GGCCCAGGTGCCAGATCCACTGG + Intergenic
1086034983 11:82404311-82404333 CTCCCCGGTGCGGGATCCACTGG + Intergenic
1086210043 11:84308489-84308511 GGCCCCCGTGCGGGATCCACTGG - Intronic
1086397672 11:86433462-86433484 GGCCCCGGTGCGGGATCCACTGG - Intergenic
1086808096 11:91269177-91269199 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1087486311 11:98763347-98763369 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1087966490 11:104422369-104422391 AGCCCCAGTGCGAGATCCACTGG - Intergenic
1089062047 11:115633832-115633854 AGCCCCAGTGCGAGATCCACTGG - Intergenic
1089523029 11:119078313-119078335 GGCCCACGAGAAGGATCCACAGG + Exonic
1089800321 11:121022081-121022103 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1090776647 11:129971771-129971793 AGCCCCGGTGCGGGATCCACTGG - Intronic
1090782789 11:130022026-130022048 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1090820451 11:130337334-130337356 CGCCCCTGTGGGGGATCCACTGG - Intergenic
1091201281 11:133782720-133782742 GGCCCCGGTTTGGGATCCACTGG + Intergenic
1091233372 11:134002827-134002849 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1091388478 12:110495-110517 GGCCCCAGTGCAGGACCCAAGGG - Intronic
1091402173 12:188056-188078 GGCCCCAGTGAGGGATCCACTGG - Intergenic
1091668160 12:2434069-2434091 CTCCCCAGTGCAGCATCCCCCGG - Intronic
1092045565 12:5430189-5430211 GGCCCCAGTTTCAGATCCACTGG - Intergenic
1092101627 12:5888834-5888856 GGCCCCAGTGTGGGATCCACTGG - Intronic
1092133998 12:6132902-6132924 GGCCCCAGTGCGGGACCCACTGG + Intergenic
1092137505 12:6159896-6159918 AGCCCAGGTGCGGGATCCACTGG + Intergenic
1092336753 12:7640243-7640265 AGCGCCGGTGCGGGATCCACTGG + Intergenic
1092430514 12:8404649-8404671 GGCTCCTGTGCGGGATCCACTGG + Intergenic
1092471848 12:8787687-8787709 AGCCCCGGTGCGGGATTCACCGG + Intergenic
1092473043 12:8795146-8795168 AGCCCCGGTGCGGGATTCACCGG + Intergenic
1092572345 12:9739509-9739531 AGCCCCGGTGTGGGATCCACCGG - Intergenic
1092583759 12:9876110-9876132 AGCCCAGGTGCGGGATCCACTGG - Intergenic
1092617071 12:10225552-10225574 AGCCCCGGTGTGGGATCCACTGG - Intergenic
1092732533 12:11547669-11547691 AGCCCCGGTGGGGGATCCACTGG + Intergenic
1092834147 12:12472373-12472395 AGCTCTGGTGCAGGATCCACTGG - Intergenic
1093034580 12:14320515-14320537 AGCCCCATTGCGGGATCCACTGG + Intergenic
1093189481 12:16057796-16057818 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1093266352 12:17008045-17008067 AGCCCCAGTGCGGGATCCACTGG + Intergenic
1093381638 12:18500566-18500588 AGCCCCAATGCGAGATCCACTGG + Intronic
1093413794 12:18896583-18896605 GTTGCCAGTGCAGGATTCACAGG + Intergenic
1093524719 12:20093260-20093282 GGCCCTGGTGCGAGATCCACTGG - Intergenic
1093580099 12:20777350-20777372 AGCCCCGGTGCAAGATCCACTGG - Intergenic
1093580958 12:20783719-20783741 AACCCCAGTGCAAGATCCACTGG - Intergenic
1093653830 12:21673946-21673968 TGCCCAGGTGCGGGATCCACTGG - Intronic
1093793798 12:23286349-23286371 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1093970283 12:25369787-25369809 AGCCCCTGTGCGGGATCCACTGG + Intergenic
1093973032 12:25391850-25391872 AGCCCTGGTGCAGGATTCACTGG + Intergenic
1094327637 12:29257064-29257086 AGACCGAGTGCGGGATCCACTGG + Intronic
1094405285 12:30110421-30110443 GGCCCCAGTGCGGGATCCACTGG - Intergenic
1094409914 12:30157281-30157303 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1094718119 12:33033870-33033892 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1095304213 12:40621033-40621055 AGCCCCGGTGAGGGATCCACTGG + Intergenic
1095444885 12:42273647-42273669 GGCCCTGGTGCAAGATCCACTGG - Intronic
1095478572 12:42610886-42610908 GGCCCTGGTGCAGGATCCACTGG - Intergenic
1095534037 12:43224701-43224723 AGCCCCAGTGTGGCATCCACTGG + Intergenic
1095587484 12:43864321-43864343 AGCCCCAGTGCGAGATCCACTGG + Intronic
1095854334 12:46843787-46843809 GGACCCAGGGCAGGAACCAGAGG + Intergenic
1095998623 12:48110877-48110899 TGCCCCAGTGTAGGATCAAGTGG - Intronic
1097017844 12:56000084-56000106 AGCACCAGTGCGGGATCCACTGG - Intronic
1097213003 12:57386690-57386712 AGCCCCAGTGCAGGATCCACTGG + Intronic
1097664124 12:62461214-62461236 GGCCCTGGTGCGAGATCCACTGG - Intergenic
1097863988 12:64543675-64543697 GCCCCTAGTGCGCGATCCACTGG + Intergenic
1097982079 12:65744735-65744757 TGGCCCTGTGCGGGATCCACTGG + Intergenic
1098168140 12:67719171-67719193 AGCCCCTGTGCGGGATCCACTGG - Intergenic
1098498679 12:71166139-71166161 GGCTCCGGTGTGGGATCCACTGG - Intronic
1099139093 12:78947390-78947412 GCCCCCAGTTCAGTAGCCACTGG - Intronic
1099191472 12:79565375-79565397 GGCCCCGGTGTGGGATCCACTGG + Intergenic
1099192503 12:79574293-79574315 GGCCCCAGTGCGAGATCCATTGG + Intergenic
1099228080 12:79993161-79993183 GACCCCTGTGCAGGATCCACTGG - Intergenic
1099443896 12:82729144-82729166 GGCCCCAGTGCGGGATCCACTGG + Intronic
1099450513 12:82801976-82801998 TGCCCCCGTGCAGGATCCACTGG - Intronic
1099537034 12:83857700-83857722 GGCCCCAGAGCAGCATACATTGG + Intergenic
1100142423 12:91634372-91634394 GCCCCAGGTGCGGGATCCACTGG + Intergenic
1100211810 12:92406478-92406500 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1100734557 12:97512724-97512746 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1101009070 12:100430723-100430745 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1101603927 12:106233451-106233473 GCCCCTGGTGCGGGATCCACTGG + Intergenic
1101727013 12:107396082-107396104 TGGCCAAGTGCAGGACCCACAGG + Intronic
1102005536 12:109587119-109587141 CGCCCCAGTGCAGCATCATCGGG - Intronic
1102309838 12:111836074-111836096 GGCCCGGGTGCAGGATCCACTGG + Intergenic
1102387177 12:112519871-112519893 AGCCCTGGTGCAGGATCTACTGG - Intergenic
1102761637 12:115390969-115390991 GGCCCACTTCCAGGATCCACAGG - Intergenic
1102904088 12:116661102-116661124 CGGCCCAGTACGGGATCCACTGG + Intergenic
1103146070 12:118597115-118597137 AGCCCTGGTGCGGGATCCACCGG - Intergenic
1103439143 12:120950265-120950287 AGCCCCAGTGGGAGATCCACTGG - Intergenic
1103459590 12:121093474-121093496 GGCCCTCGTGCGGAATCCACTGG - Intergenic
1103497630 12:121374860-121374882 AGCTCCTGTGCGGGATCCACTGG + Intronic
1103678641 12:122676576-122676598 GGCTCCAGGGCAGGATCCACTGG - Intergenic
1103783315 12:123414052-123414074 AGCCCCGGTGCGGGATCCACTGG - Exonic
1103853364 12:123947382-123947404 AGCCCCGGTGTGGGATCCACTGG + Intronic
1104096769 12:125565368-125565390 GGCCCCACAGCAGCATCCAGGGG + Intronic
1104344574 12:127983806-127983828 GGCCCTGGTGCGGGATCCACTGG + Intergenic
1104749319 12:131228233-131228255 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1104822670 12:131687313-131687335 GCCCCCAGGGCATGCTCCACTGG - Intergenic
1104858163 12:131911524-131911546 GGCCTCAGAGCAGGGCCCACCGG + Intronic
1105605093 13:21920641-21920663 TGCCCCAGTGCGGTATCCACTGG - Intergenic
1105697154 13:22900388-22900410 GGCCCTGTTGCGGGATCCACTGG - Intergenic
1105722246 13:23127992-23128014 AGCCCCAGTGCGGGATCCACTGG + Intergenic
1105876609 13:24560645-24560667 AGCCCTGGTGCAGGATCCACTGG - Intergenic
1106643356 13:31608768-31608790 AGCCCTGGTGCGGGATCCACTGG - Intergenic
1106801287 13:33259044-33259066 GGCATTAGTGCAGGATCCAAGGG - Intronic
1107590387 13:41898518-41898540 AGCCCTGGTGCGGGATCCACTGG - Intronic
1107836193 13:44413996-44414018 AGCCTCGGTGCGGGATCCACTGG + Intergenic
1108417046 13:50208705-50208727 GGCCCCTCTGCAGGATGCCCCGG - Intronic
1108435421 13:50397010-50397032 AGCCCCAGTGCAGGATCCACTGG + Intronic
1108469382 13:50753246-50753268 AGCCCTGGTGCGGGATCCACTGG - Intronic
1108643900 13:52408014-52408036 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1108858883 13:54829439-54829461 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1108868987 13:54958949-54958971 GGCCCCTGGGCAGCATCTACGGG - Intergenic
1108996077 13:56735984-56736006 AGCCCCTGTGCGGGATCCACTGG + Intergenic
1109007834 13:56901151-56901173 AGCCCCAGTGCCAGAACCACTGG + Intergenic
1109159798 13:58958121-58958143 AGCCCCGGTACGGGATCCACTGG - Intergenic
1109364708 13:61339581-61339603 AGCCCCAGTGAGGGATCCACTGG + Intergenic
1109563093 13:64077474-64077496 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1109699729 13:66009649-66009671 GGCTCCAGTGCAGAATCCACTGG + Intergenic
1109741599 13:66561445-66561467 GGCCCTGGTGTGGGATCCACTGG + Intronic
1109745892 13:66622370-66622392 AGCCCCGGTGCAGGAGCCACTGG + Intronic
1109854220 13:68107658-68107680 GGCCCCAGTGCAGGATCCACTGG - Intergenic
1110368949 13:74718809-74718831 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1110609750 13:77475435-77475457 GGCCCCTGTGCGGGATCCACTGG - Intergenic
1110751324 13:79119576-79119598 GGCCCCGGTGGAGGATCCACTGG - Intergenic
1110792328 13:79600097-79600119 AGCCCCAGTGCGGGATCTACTGG - Intergenic
1110874286 13:80490496-80490518 AGCCCCAGTGCGGGATCCACCGG - Intergenic
1110940216 13:81340710-81340732 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1110999767 13:82164886-82164908 AGCCCCAGTGTGAGATCCACTGG - Intergenic
1111006719 13:82258380-82258402 GGCCCCGGTGCGAGATCCGCTGG + Intergenic
1111441979 13:88292241-88292263 AGCCCCAGTGCAGGATCCACTGG + Intergenic
1111747748 13:92291266-92291288 CCGCCCTGTGCAGGATCCACTGG + Intronic
1111841335 13:93454725-93454747 AGCCCGGGTGCGGGATCCACTGG - Intronic
1112226585 13:97545706-97545728 GGCCCCCATGTGGGATCCACTGG + Intergenic
1112282624 13:98076274-98076296 GGCCCGGGTGCAGGATCCACTGG - Intergenic
1112533092 13:100223988-100224010 AGCCCCGGTGCGGGATCCACTGG - Intronic
1112613177 13:100976117-100976139 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1112842762 13:103600360-103600382 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1113455192 13:110443761-110443783 GGACCCAGTGGAGGCTCCGCCGG - Intronic
1113482609 13:110632968-110632990 AGCCCTGGTGCGGGATCCACTGG - Intronic
1115980016 14:39040794-39040816 AGCCCCAGTGGATGATGCACAGG - Exonic
1116223117 14:42113432-42113454 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1116224324 14:42129286-42129308 TGCCCCAGTAAAGGATTCACTGG - Intergenic
1116250957 14:42482324-42482346 AGCCCCGGTGCCGGATCCACTGG - Intergenic
1116452438 14:45080857-45080879 AGCCCCAGAGCGGGATCCACTGG + Intergenic
1116653839 14:47626926-47626948 CACCCCGGTGCGGGATCCACTGG + Intronic
1116657057 14:47665982-47666004 GGCCCTGGTGCGAGATCCACTGG + Intronic
1117077944 14:52122666-52122688 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1117297637 14:54393861-54393883 AGCCCCGGTGCGGGATCCGCTGG + Intergenic
1118306386 14:64658549-64658571 AGCCCCTGTGCGGTATCCACTGG + Intergenic
1119027847 14:71167914-71167936 GGCCCCAGTGCGGGATCCACTGG + Intergenic
1119038920 14:71254718-71254740 AGCCCCGGTGTGGGATCCACTGG + Intergenic
1119300247 14:73566272-73566294 AGCCCCAGTGCACGATCCACTGG - Intergenic
1119673368 14:76536689-76536711 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1119983001 14:79103183-79103205 GGCCCAGGTGGAGGATTCACTGG + Intronic
1120331054 14:83092802-83092824 AGCACCGGTGCGGGATCCACTGG + Intergenic
1120439031 14:84512847-84512869 AGCCCCGGTGTGGGATCCACTGG - Intergenic
1120704680 14:87734669-87734691 GGCCCTGGTGCGAGATCCACTGG - Intergenic
1120844234 14:89112069-89112091 AGCCCCCGTGCAGAATCCACTGG + Intergenic
1121159708 14:91726297-91726319 GGCTCCATGGCAGCATCCACGGG - Intronic
1122216451 14:100208105-100208127 AGCCCCAGTGCAGGAGCCACTGG - Intergenic
1123205500 14:106708875-106708897 GGCCCCAGCCCAGGTTCCACTGG - Intergenic
1123210547 14:106756142-106756164 GGCCCCAGCCCAGGTTCCACTGG - Intergenic
1123478528 15:20610584-20610606 GGCCCCAGTGCACCCTCCTCTGG + Intergenic
1123478533 15:20610588-20610610 GGCCCCAGAGGAGGGTGCACTGG - Intergenic
1123639480 15:22389797-22389819 GGCCCCAGAGGAGGGTGCACTGG + Intergenic
1123639485 15:22389801-22389823 GGCCCCAGTGCACCCTCCTCTGG - Intergenic
1123949056 15:25253132-25253154 AGCCCCAGTGCGGGATCCACTGG - Intergenic
1124036431 15:26057294-26057316 GGCCCCAGTGCAGGATCCACTGG + Intergenic
1124110542 15:26781608-26781630 CACCCCCGTGCGGGATCCACTGG - Intronic
1124114775 15:26831118-26831140 AGCCCTGGTGCGGGATCCACTGG - Intronic
1124387780 15:29224733-29224755 CGGCCCGGTGCCGGATCCACTGG - Intronic
1124414831 15:29466466-29466488 GGCCCCAGGGGAGGGTCCAGGGG + Intronic
1124818401 15:33019425-33019447 GGCCCCGGTGCAGGATCCACTGG - Intronic
1125112292 15:36047374-36047396 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1125885476 15:43226527-43226549 GGCCCCAGTGCGGGATCCACTGG - Intergenic
1125914481 15:43473811-43473833 AGCCCCCGTGCGAGATCCACTGG - Intronic
1126089067 15:45035256-45035278 AGCCCCAGTGCGAGATCCACTGG + Intronic
1126128160 15:45314519-45314541 AGCCCCCATGCGGGATCCACTGG + Intergenic
1126480315 15:49111261-49111283 GGCCCCAGGACAGCATGCACTGG - Intronic
1126639748 15:50812390-50812412 GGCCCCGATGCGGGATCCAGTGG + Intergenic
1127765991 15:62186503-62186525 AGCCCTGGTGCAGGATCCACTGG - Intergenic
1127984859 15:64061307-64061329 GGCCCTGGTGGGGGATCCACTGG + Intronic
1128140978 15:65301005-65301027 GGCCCCAGTGGAGGATCCACTGG - Intergenic
1128598494 15:68975608-68975630 AGCCCCGGTGCGGGGTCCACTGG - Intronic
1128669909 15:69567297-69567319 AGCCCTGGTGCGGGATCCACTGG - Intergenic
1128813232 15:70587113-70587135 AGCCCTGGTGCGGGATCCACTGG - Intergenic
1129196997 15:73974130-73974152 AGCCCCCGTGTGGGATCCACTGG + Intergenic
1129208707 15:74052921-74052943 GGCCCCCGTGCGGGATCCACTGG + Intergenic
1129249876 15:74302959-74302981 AGCCACAGTGCAGGAGCCTCAGG - Intronic
1129270511 15:74417078-74417100 AGACCCAGTGCAGGGTCCCCAGG - Intronic
1129373939 15:75115935-75115957 AGCCCCGGTGCAGGATCCACTGG - Intronic
1129675541 15:77631139-77631161 GGCACCAGTGCTGAAGCCACTGG + Intronic
1129676289 15:77633727-77633749 GGCCCCAGCCGAGGATCCCCGGG - Intronic
1129777427 15:78246076-78246098 AGCCCGGGTGCGGGATCCACTGG - Intergenic
1129986966 15:79926496-79926518 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1129997218 15:80016899-80016921 AGCCCCAGTGCGGGATCCACTGG + Intergenic
1130132942 15:81159043-81159065 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1130256360 15:82327802-82327824 GGCCACAGTTCACTATCCACAGG - Intergenic
1130552004 15:84895245-84895267 CGCCCCAGGGCAGGAGCCAGTGG + Intronic
1130598592 15:85262186-85262208 GGCCACAGTTCACTATCCACAGG + Intergenic
1131012629 15:89031638-89031660 GGCCCCGGTGCGGGATCCACTGG - Intergenic
1131097629 15:89666293-89666315 GGCCCGAGCGCAGGATGAACAGG + Intronic
1131846035 15:96491771-96491793 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1131992312 15:98104204-98104226 CGCCCCGGTGCAGGATCCACTGG - Intergenic
1132044278 15:98550134-98550156 GGCCTCCGTGCAGGATCCACTGG + Intergenic
1132097773 15:99000425-99000447 GGCCCCAGTGCGGGATCCACAGG + Intronic
1132098802 15:99008215-99008237 GGCCCTGGTGCGGGATCCACTGG - Intergenic
1132511091 16:341665-341687 AACCCCGGTGCGGGATCCACTGG + Intronic
1132836740 16:1958139-1958161 AGCCCCCGTGCGGGATCCACCGG - Intergenic
1133362582 16:5186303-5186325 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1133367459 16:5221949-5221971 GGCCCCGGTGCAGAATCCACTGG - Intergenic
1135280934 16:21153019-21153041 AGCCCCGGTGCAGGAGCCACTGG + Intronic
1135470145 16:22722931-22722953 GGCCCTGGTGCGGGATCCACTGG - Intergenic
1135633810 16:24056936-24056958 GGCCCCTGTGCATGCACCACGGG - Intronic
1135942625 16:26836038-26836060 GGCCCTGGTGCAGGATCCACTGG - Intergenic
1136163372 16:28435790-28435812 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1136199591 16:28679197-28679219 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1136215937 16:28793370-28793392 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1137236665 16:46623593-46623615 GGCTTCAGTCCAGGATCCAGGGG + Intergenic
1137442587 16:48509109-48509131 GGCCCCGGTGCGGGATCCACTGG + Intergenic
1137851682 16:51752076-51752098 GGCCCCAGTGCCGGGGCCAGAGG - Intergenic
1138350162 16:56342127-56342149 GTCACTAGGGCAGGATCCACAGG - Intronic
1138688864 16:58749278-58749300 GGCCGTGGTGCGGGATCCACTGG + Intergenic
1138693527 16:58790708-58790730 AGCCCCGGTGTGGGATCCACTGG - Intergenic
1139125465 16:64072267-64072289 AGCCCTGGTGCGGGATCCACTGG - Intergenic
1139147813 16:64344314-64344336 AGCCCCAATGCGAGATCCACGGG + Intergenic
1139442380 16:66974650-66974672 TGCCCCAGTGCTGGATCCACTGG + Exonic
1139600358 16:67982644-67982666 GGCCCCGGTGCAGCATCCACTGG + Intergenic
1139676484 16:68527122-68527144 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1141636531 16:85316911-85316933 GGCCACAGAGCAGGAGCCCCGGG + Intergenic
1141837758 16:86553776-86553798 AGCCCCAGTGCGGGATCTGCTGG + Intronic
1142201691 16:88764087-88764109 GGCACCAGAGCAGGACCCAGTGG + Intronic
1143135201 17:4709035-4709057 GGCCCCCAAGCGGGATCCACTGG - Intergenic
1143203448 17:5127592-5127614 GGGCCCAGTTCAGGACACACAGG - Exonic
1143283440 17:5771638-5771660 GGCCCCGGTGCGGGATCCACTGG + Intergenic
1143460441 17:7100531-7100553 GGCCCCAGTGCAGGATCCATGGG - Intergenic
1143664201 17:8347057-8347079 AGCCCCGGTGTGGGATCCACTGG - Intergenic
1143708577 17:8718016-8718038 GGCCCCAGTGCGGGATCCACTGG - Intergenic
1144516024 17:15917934-15917956 GGGCCCAGTGCAGGCTCGAGAGG - Intergenic
1145006881 17:19343307-19343329 TCCCCCAGTGAAGGCTCCACAGG - Exonic
1146654170 17:34625662-34625684 GAGCGCAGTGCAGGATACACAGG + Intronic
1146857445 17:36265721-36265743 GGTCCCAGTTCAGGACACACAGG + Intronic
1146863174 17:36322654-36322676 GGTCCCAGTTCAGGACACACAGG - Intronic
1147076237 17:37990257-37990279 GGTCCCAGTTCAGGACACACAGG + Intronic
1147077566 17:38002802-38002824 GGTCCCAGTTCAGGACACACAGG - Intronic
1147087762 17:38069802-38069824 GGTCCCAGTTCAGGACACACAGG + Intergenic
1147093501 17:38126737-38126759 GGTCCCAGTTCAGGACACACAGG - Intergenic
1147103706 17:38193751-38193773 GGTCCCAGTTCAGGACACACAGG + Intergenic
1147124196 17:38354373-38354395 GTTCCCAGTTCAGGATCAACTGG - Intronic
1147431889 17:40376251-40376273 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1147455719 17:40536863-40536885 GGCCCCATTGCTCCATCCACAGG + Intergenic
1147673936 17:42192382-42192404 GGCCCTAGAGCAGGGGCCACGGG - Exonic
1147922303 17:43925434-43925456 GGCCCCAGTTCAGCCTCCAGAGG - Intergenic
1147997608 17:44369225-44369247 AGCCCCTGTGCGGGATCCACTGG + Intergenic
1148016950 17:44528395-44528417 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1148023445 17:44568606-44568628 GGCCCCGATGCGGGATCCACTGG + Intergenic
1148366104 17:47057223-47057245 CGCCCCAGTGCGGGATCCACTGG - Intergenic
1149099186 17:52883914-52883936 GGCCCTGGTGCGGCATCCACTGG - Intronic
1149848281 17:60020287-60020309 GGGCCCAGTTCAGGACACACAGG + Intergenic
1149861888 17:60126237-60126259 GGGCCCAGTTCAGGACACACAGG - Intergenic
1150086633 17:62276854-62276876 GGGCCCAGTTCAGGACACACAGG + Intronic
1150682582 17:67295132-67295154 GGCCTTGGTGCAGGATCCACTGG + Intergenic
1150775888 17:68081036-68081058 GGCCCCCATGTGGGATCCACTGG + Intergenic
1150778355 17:68099702-68099724 AGCCCCGGTGGGGGATCCACTGG + Intergenic
1150788351 17:68180274-68180296 GGCCCCCGTGCGAGACCCACTGG + Intergenic
1150792308 17:68208235-68208257 GGCCCCAGTGCGGGATCCACTGG + Intergenic
1150804534 17:68308851-68308873 AGCGCCGGTGCGGGATCCACTGG - Intronic
1151672780 17:75580921-75580943 GGCCCTGGTACTGGATCCACTGG + Intergenic
1151782597 17:76257586-76257608 AGCCCCAGTGCGGGATCCACTGG - Intergenic
1151866507 17:76806536-76806558 CGGCCCAGTGTGGGATCCACTGG + Intergenic
1152618969 17:81351972-81351994 AGCCCCAGTGCGAGATCCACTGG - Intergenic
1152825072 17:82459339-82459361 AGCCACAGAGCAGCATCCACAGG - Intronic
1152914088 17:83023959-83023981 GGAACCAGCGCAGAATCCACAGG - Intronic
1152937638 17:83149804-83149826 GGCCCTGGTGGAGGATGCACTGG - Intergenic
1153070461 18:1098653-1098675 GGCCCCTGTGCGGGATCCACTGG + Intergenic
1153364338 18:4237227-4237249 GTTTCCAGTGCAGGATCTACAGG - Intronic
1153643979 18:7178605-7178627 GGCCCCGGTGGGGGATCCACTGG - Intergenic
1154057162 18:11023588-11023610 CGCCCCGGTGCGGGATCCACTGG - Intronic
1154128686 18:11716885-11716907 AGCCCCCGTGCGGGATCCACTGG - Intronic
1154255234 18:12776785-12776807 GGCCCTGATGCGGGATCCACTGG - Intergenic
1154942897 18:21132476-21132498 CGGCCCAGTGCGGGATCCACTGG - Intergenic
1155271882 18:24149490-24149512 GTCCCCAGTGCAGGATCCACTGG - Intronic
1155294959 18:24376518-24376540 AGCCCCAGTGCGGGATCCACTGG - Intronic
1156038746 18:32794995-32795017 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1156079568 18:33316579-33316601 CGCCCCAGTGGGAGATCCACTGG + Intronic
1156943243 18:42795651-42795673 AGCCCGGGTGCGGGATCCACTGG + Intronic
1156969749 18:43139941-43139963 GGCCCCAGTGCGGGATCCACTGG + Intergenic
1157856832 18:51111782-51111804 GGCCCCGGTGCGGGATCCACTGG - Intergenic
1157979725 18:52366842-52366864 AGCCCTGGTGCGGGATCCACTGG - Intronic
1158332396 18:56376807-56376829 GCCCCCAGGGCAGGAGCCCCAGG - Intergenic
1158460663 18:57643598-57643620 GGCCCTGGTGCAGGATCCACTGG - Intergenic
1158553957 18:58459796-58459818 AGCACCGGTGCGGGATCCACTGG + Intergenic
1159167880 18:64725578-64725600 AGCCCCAGTGCGGGATCCACTGG - Intergenic
1159230880 18:65605675-65605697 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1159472870 18:68879934-68879956 AGCCCTGGTGCGGGATCCACTGG - Intronic
1159744033 18:72209549-72209571 TGCCCCGGTGCAGGATCCACTGG + Intergenic
1161006943 19:1941629-1941651 GTCCCGAGTGCAGGGTCAACGGG - Intronic
1161578496 19:5067753-5067775 GGCTCCTGTGCAGGGGCCACTGG - Intronic
1161755534 19:6130875-6130897 GGCACCAGTGGAGGACGCACAGG + Intronic
1161804031 19:6432001-6432023 GGACCCAGCGCTGGAGCCACTGG - Intronic
1162107073 19:8376186-8376208 AGCCCCGGTGCAGGATCCACTGG + Intronic
1162164141 19:8740815-8740837 GGCTTCAGTGCAGGAGGCACAGG - Intergenic
1162165212 19:8748284-8748306 GGCTTCAGTGCAGGAGGCACAGG - Intergenic
1162166277 19:8755738-8755760 GGCTTCAGTGCAGGAGGCACAGG - Intergenic
1162167343 19:8763194-8763216 GGCTTCAGTGCAGGAGGCACAGG - Intergenic
1162168284 19:8769494-8769516 GGCTTCAGTGCAGGAGGCACAGG - Intergenic
1162169351 19:8776947-8776969 GGCTTCAGTGCAGGAGGCACAGG - Intergenic
1162170031 19:8782259-8782281 GGCTTCAGTGCAGGAGGCACAGG - Intergenic
1162171116 19:8789912-8789934 GGCTTCAGTGCAGGAGGCACAGG - Intergenic
1162178135 19:8847013-8847035 GGCCCCATGGCAGCATCCACAGG + Intergenic
1162230220 19:9259935-9259957 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1162233032 19:9283391-9283413 AGCCCCAGTGCGGGATCCACTGG - Intergenic
1162237823 19:9322018-9322040 AGCCCCAGTGCAAGATCCACTGG + Intergenic
1162261984 19:9541265-9541287 AGCCCCAGTGCGGGATCCACTGG - Intergenic
1162632628 19:11941234-11941256 AGCCCTGGTGCAGGATCCACTGG - Intronic
1162814650 19:13186642-13186664 AGCCCCGGTGCAGGATACACTGG - Intergenic
1163218925 19:15900105-15900127 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1163391861 19:17036053-17036075 GGACACAGTGCAGGATTCACAGG - Intergenic
1163556058 19:17993427-17993449 GCCCCCACTGCAGCCTCCACGGG + Intronic
1163737670 19:18991369-18991391 TGCCCCAGCGCTGAATCCACAGG + Intronic
1164134811 19:22405363-22405385 GGTGCAAGTGCAGGATTCACAGG - Intronic
1164143959 19:22498927-22498949 AGCCCCGGTGCGGGATCCACTGG - Intronic
1164163975 19:22651270-22651292 GGTGCCAGTGCAGGATTCACAGG + Intronic
1164270518 19:23668466-23668488 AGCCCCGGTGCGGGATCCACTGG - Intronic
1164975868 19:32572006-32572028 AGCCCCGGTGAGGGATCCACTGG + Intergenic
1165036456 19:33037023-33037045 GGCCCTGGTGTGGGATCCACTGG + Intronic
1165266996 19:34668567-34668589 GGCCCCGGTGCGGGATCCACTGG + Intronic
1165415460 19:35691035-35691057 AGCCCCAGTGCGGGATCCACTGG - Intergenic
1165846655 19:38821889-38821911 GGCCCTGGTGCAGGATCCACTGG + Intronic
1166036143 19:40170079-40170101 AGCCCCAGTGCGGGATCCACTGG - Intergenic
1166486939 19:43221860-43221882 AGCCCCAGTGTGGGATCCACTGG - Intronic
1166907187 19:46119484-46119506 GGCCCCAGAGCAGCATACCCTGG - Intergenic
1167577414 19:50324423-50324445 GGCCCCCCAGCAGGGTCCACGGG + Intronic
1168659963 19:58157728-58157750 CGGCCCTGTGCGGGATCCACTGG + Intergenic
1168687799 19:58358830-58358852 GGCCCCAGTGCTGGCTCAGCTGG + Intronic
925088618 2:1134664-1134686 AGCCCCGGTGGGGGATCCACTGG - Intronic
925098902 2:1229537-1229559 AGCCCCGGTGCCGGATCCACTGG - Intronic
925165267 2:1711706-1711728 GGGCCACCTGCAGGATCCACTGG + Intronic
925537735 2:4935253-4935275 AGCCCCGGTGCGGGATCCACTGG - Intergenic
925539535 2:4951995-4952017 GTCCCAAATGCAGGATACACTGG + Intergenic
926616556 2:15002473-15002495 AGTCCCGGTGCGGGATCCACTGG - Intergenic
926685768 2:15696713-15696735 GACCCCAGTGCAGGATCCACTGG - Intronic
926850721 2:17193933-17193955 AGCCCCTGTGCCGGATCCACTGG + Intergenic
927357150 2:22186720-22186742 GGCCCCAGTGCGGGATCCACTGG + Intergenic
927777867 2:25915883-25915905 AGCCCCCGTGGGGGATCCACTGG + Intergenic
927900479 2:26814781-26814803 AGCCCTGGTGCGGGATCCACTGG + Intergenic
927942120 2:27111452-27111474 GGCCCCGGTGCAGGATCCACTGG - Intronic
928101015 2:28437420-28437442 GCCCCTTCTGCAGGATCCACAGG + Intergenic
928106427 2:28473053-28473075 GGCCCCAGTGCAGGATCCACTGG + Intronic
928617870 2:33057365-33057387 GGCCCCAGTGGGAGACCCACTGG - Intronic
928936975 2:36688682-36688704 AGCCCCGGTGCGGGATCCACTGG + Intergenic
929233784 2:39585777-39585799 AGCCCCGGTGCGGGATCCACTGG + Intergenic
929379763 2:41336012-41336034 AGCCCTGGTGCGGGATCCACTGG + Intergenic
929890792 2:45917609-45917631 AGCCCCAGTGCGGGATCCACTGG - Intronic
930039289 2:47107701-47107723 AGCCCTGGTGCGGGATCCACTGG + Intronic
930468156 2:51780274-51780296 AGCCCCGGTGCAGGATCCACTGG - Intergenic
931708765 2:64969426-64969448 AGCCCCAGAGTGGGATCCACTGG + Intergenic
932178352 2:69622462-69622484 GGCCCTGGTGCAAGATCCACTGG + Intronic
932240003 2:70148727-70148749 AGCCCCAGTGTGGGATCCACTGG + Intergenic
932359450 2:71092426-71092448 AGCCCCCATGCAGGATCCAGTGG - Intergenic
932794308 2:74681396-74681418 GGCCTCAGTGCAGTAACCTCAGG - Exonic
933060768 2:77734718-77734740 GGCCCCGGTGCCGGATCCACTGG - Intergenic
933442024 2:82326222-82326244 AGCCCCGGTGCGGGACCCACTGG - Intergenic
933506387 2:83181421-83181443 GGCCCCGGTGCGGGATCCACTGG + Intergenic
933511394 2:83245905-83245927 AGCCCCCATGCGGGATCCACTGG - Intergenic
933712085 2:85334352-85334374 GGCCCTAGTGCGGGATCCACTGG - Intergenic
933832659 2:86223330-86223352 GGGCCCACTGCAGGCTACACAGG - Intronic
934898567 2:98139424-98139446 AGCCCCTGTGTGGGATCCACTGG + Intronic
935896770 2:107747279-107747301 AGCCCCGGTGCGGGATCCACTGG - Intergenic
936074542 2:109393438-109393460 GGCCTCTGTGAAGGATCCCCAGG + Intronic
936346964 2:111682272-111682294 AGCCCCGGTGCAGGATCCACTGG + Intergenic
936581447 2:113704361-113704383 GGCCCCTGTGCGGGATCCGCTGG - Intergenic
937333168 2:121044649-121044671 GGCCCCGGTGAAGGAGGCACTGG + Intergenic
937423997 2:121782215-121782237 GGCCACAGTGCACGCTCCTCAGG - Intergenic
937711773 2:124987349-124987371 ATCCCCGGTGCAGGATCCACTGG - Intergenic
938126005 2:128672061-128672083 AGCCCCGGTGCAGGATCCACTGG - Intergenic
938401098 2:130991866-130991888 AGCCCCGGTGCGGGATCCACTGG + Intronic
938549916 2:132370583-132370605 GGCCCCACAGCAGCATCCAGGGG + Intergenic
938568531 2:132541704-132541726 GCCCCCTGTGCAGGATACAGAGG + Intronic
938725955 2:134109285-134109307 CGCCCCGCTGCAGGATCCACTGG - Intergenic
938931138 2:136088007-136088029 GTCCCCCGTGGGGGATCCACTGG - Intergenic
939003201 2:136758842-136758864 GGCCCCTGTGCGGGATCCACTGG + Intergenic
939053144 2:137331546-137331568 AGCCCCAGTGCTGGATCCACTGG - Intronic
939229838 2:139410763-139410785 AGCCCCGGTGCGGGATCCACTGG + Intergenic
939509551 2:143089536-143089558 GACCCCAGTGCAGGATCCACTGG - Intergenic
939738697 2:145880842-145880864 AGCCCCAGTGCGGGATCCACTGG - Intergenic
939898990 2:147827281-147827303 GGCCGCAGCGCAGGATCAACTGG + Intergenic
939972475 2:148678339-148678361 AGCCCTGGTGCGGGATCCACTGG - Intronic
940004170 2:148996453-148996475 GGCCCCACTGCAGGAACCACCGG - Intronic
940112587 2:150171040-150171062 GGCCCCAGTTCGGGATCCACTGG - Intergenic
940366305 2:152852329-152852351 GTCCTGAGTGCAGGAGCCACAGG - Intergenic
940666631 2:156617973-156617995 AGCCCCAGTGCGGGATCCACTGG - Intergenic
940879581 2:158933350-158933372 TGCCCCAGAGCAGAATCCAGTGG + Intergenic
941178997 2:162235336-162235358 GGCTCCGGTGCGAGATCCACTGG + Intronic
941240162 2:163026698-163026720 AGCCCCGGTGCGGGATCCACTGG + Intergenic
941309322 2:163909946-163909968 GGCCCCAGTGCGGGATCCAATGG + Intergenic
941309859 2:163914039-163914061 AGCCCTGGTGCGGGATCCACTGG + Intergenic
941397855 2:164994693-164994715 AGCCCCCGTGCGGGATCCACTGG - Intergenic
942299529 2:174548530-174548552 GGCCTGGGTGCATGATCCACTGG - Intergenic
942317519 2:174709508-174709530 GGCCCCGGTGCGAGATTCACTGG - Intergenic
942540264 2:177008272-177008294 GGCCCTGGTGTGGGATCCACTGG + Intergenic
942867361 2:180691809-180691831 AGCCCCCGTGCAGGATCCACTGG + Intergenic
943106088 2:183546617-183546639 TGCCCCAGTGCAGGATCCACTGG - Intergenic
943646293 2:190409930-190409952 GAGCCCAGTGCAGGATGCTCTGG + Intronic
943790105 2:191922009-191922031 GGCCCCGGTGCGGGATCCACTGG + Intergenic
943906049 2:193502400-193502422 TGCCCGGGTGCAGGATCCACTGG - Intergenic
943941380 2:194002696-194002718 GGCCCCAAAGCGGGATCCACTGG - Intergenic
943942797 2:194020582-194020604 GGCCCCAGTGTGGGATCCACAGG + Intergenic
944058418 2:195547290-195547312 GGCCCCAGTGTGAGATCCACTGG - Intergenic
944252415 2:197591493-197591515 CGCCCCAGTGCAGTATCCACTGG - Intronic
944482867 2:200175161-200175183 GACCCTGGTGCGGGATCCACTGG + Intergenic
944857857 2:203785512-203785534 AGCCCCGGTGCGGGATCCACTGG - Intergenic
945069704 2:205977606-205977628 GGCCCCTGTGCGGGATCCACTGG + Intergenic
945401458 2:209387756-209387778 AGCCCCAGTGCGAGATCCACTGG + Intergenic
945451422 2:210000555-210000577 CGCCCCAGTATGGGATCCACTGG - Intergenic
945575400 2:211524316-211524338 AGCCCCCGTGAGGGATCCACTGG - Intronic
945870290 2:215219484-215219506 AGCCCCAGTGTGAGATCCACTGG + Intergenic
945872757 2:215245679-215245701 AGCCCCGGTGCGGGATCCACTGG - Intergenic
946054066 2:216885645-216885667 AGCCCCAGTGTGGTATCCACTGG + Intergenic
946376572 2:219313198-219313220 GGCCCCGGTGTGGGATCCACTGG + Intergenic
946982091 2:225229387-225229409 AGCCCCGATGCGGGATCCACTGG - Intergenic
947026708 2:225744555-225744577 AGCCCTGGTGCGGGATCCACTGG + Intergenic
947248979 2:228079791-228079813 GGCCAGAGGCCAGGATCCACTGG - Intronic
947412063 2:229851138-229851160 AGCCCCGGTGCAGGATCCACTGG + Intronic
947931983 2:233972407-233972429 AGCCGCGGTGCGGGATCCACTGG - Intronic
948449038 2:238057792-238057814 AGCCGCAGTGGGGGATCCACTGG - Intronic
948654534 2:239468636-239468658 GGCCCCTCTGCAGCCTCCACTGG - Intergenic
1170230812 20:14044767-14044789 AGCCCCAGTGCGGGATCCACTGG - Intronic
1170246543 20:14226928-14226950 AGCCCCAGTGCAGGATCCACTGG + Intronic
1170649574 20:18227186-18227208 TGCCCTGGTGCTGGATCCACTGG + Intergenic
1170806774 20:19639567-19639589 AGCCCCAGTGCGGGATCCACTGG - Intronic
1170989966 20:21292301-21292323 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1171973344 20:31578507-31578529 AGCCCCTGTGCGGGATCCACAGG - Intergenic
1172431778 20:34898740-34898762 AGCCCCAGTGCGGGATCCACTGG - Intronic
1172691531 20:36793683-36793705 TGCCCTGGTGCAGGTTCCACAGG + Exonic
1173369971 20:42426653-42426675 GGCCCCACAGCAGCATCCAGGGG - Intronic
1173580502 20:44143476-44143498 GGCTCCAGTGCCGCATTCACTGG - Intronic
1173601672 20:44299556-44299578 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1173778844 20:45736313-45736335 GGCCCCAGAGCGGGACCCACTGG + Intergenic
1174162819 20:48564048-48564070 GGCCCCAGTATGGGATCCACTGG - Intergenic
1175100522 20:56575768-56575790 GGCACCAGTGCCGGCTCCAAGGG - Intergenic
1175210145 20:57348819-57348841 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1175254224 20:57629210-57629232 AGCCCCGGGGCAGGATCCACTGG + Intergenic
1176344763 21:5733447-5733469 GGCCCTGGTGCGGGATCCACTGG - Intergenic
1176351577 21:5854031-5854053 GGCCCTGGTGCGGGATCCACTGG - Intergenic
1176500064 21:7591008-7591030 GGCCCTGGTGCGGGATCCACTGG + Intergenic
1176539084 21:8131517-8131539 GGCCCTGGTGCGGGATCCACTGG - Intergenic
1176558035 21:8314562-8314584 GGCCCTGGTGCGGGATCCACTGG - Intergenic
1176663293 21:9660423-9660445 GGCCCTGGTGCAGGATCCACTGG + Intergenic
1176671112 21:9735958-9735980 GGCCCCAGTGCGGGATCCACTGG + Intergenic
1176872177 21:14092904-14092926 GGCCCCTGTGCGAGATCCACTGG - Intergenic
1177182318 21:17757526-17757548 GACCCCAGTGCCAGATCCACTGG - Intergenic
1177565757 21:22818797-22818819 AGCCCCGGTGTGGGATCCACTGG - Intergenic
1177637691 21:23807437-23807459 AGCCCCAGTGTGGGATCCACTGG + Intergenic
1178082165 21:29077134-29077156 AGCCCTAGTGCGTGATCCACTGG - Intergenic
1178327066 21:31654607-31654629 AGCCCAGGTGCGGGATCCACTGG + Intergenic
1178585574 21:33868256-33868278 AGCCCCGGTGTGGGATCCACTGG - Intronic
1178983281 21:37283124-37283146 AGCCCCGGTGTGGGATCCACTGG - Intergenic
1180740968 22:18053308-18053330 AGCCCCTGTGCGGGATCCACTGG - Intergenic
1180755163 22:18155909-18155931 GGCCCAGGTGTGGGATCCACTGG + Intronic
1181077600 22:20392349-20392371 GGCCCCGGTGCGGGATCCACTGG - Intergenic
1181365042 22:22369855-22369877 AGCTCCAGTGCTGGAGCCACAGG - Intergenic
1181442201 22:22942354-22942376 GGCCCCAGTGCAGTTCACACAGG + Intergenic
1181450469 22:23016991-23017013 AGCCCCGGCGCGGGATCCACTGG - Intergenic
1181800890 22:25347140-25347162 GGACCCAGTGCACCCTCCACAGG + Intergenic
1182062405 22:27407562-27407584 GGGGCCAGTTCAGGGTCCACGGG - Intergenic
1182337965 22:29598004-29598026 GGCCACGGTGCAGAATCCACTGG - Intergenic
1183457992 22:37933134-37933156 GGCCCCAGGGCAGGTGCCAGGGG - Intronic
1184176650 22:42792909-42792931 GGCCCCAGAGCTGGGCCCACTGG - Intergenic
1184584329 22:45437150-45437172 AGCCCCGGTGCGGAATCCACTGG + Intergenic
1184889925 22:47373418-47373440 AGCCCCAGTTCTGGTTCCACTGG + Intergenic
1184906173 22:47488245-47488267 AGCCCCGGTGCGGAATCCACTGG - Intergenic
1185055937 22:48578340-48578362 TGCCCCAGTGCAGGTGCCTCCGG + Intronic
1185229043 22:49670145-49670167 AGCCTCGGTGCAGGATCCACTGG - Intergenic
1185236886 22:49719021-49719043 GGCCCCAGAGCTGCATCCCCTGG + Intergenic
1203244034 22_KI270733v1_random:47872-47894 GGCCCTGGTGCGGGATCCACTGG - Intergenic
949259054 3:2084049-2084071 AGCCCCGGTGCGGGATCCACTGG + Intergenic
949770074 3:7569014-7569036 CGCCCCTGTGTGGGATCCACTGG + Intronic
950068885 3:10136375-10136397 CGCCCCGGTGCAGGATCCACTGG - Intergenic
950203673 3:11061794-11061816 AGCCCCTGTGCGGGATCTACTGG + Intergenic
950207958 3:11094421-11094443 GGCCCCTGTGTGGGATCCACTGG + Intergenic
950256890 3:11513184-11513206 AGCCCCGGTGCGGGATCCACTGG - Intronic
950400895 3:12768731-12768753 GCCCCCGGTGCGGGATCCACTGG - Intronic
950418624 3:12883271-12883293 GGCCCCGGTGCGGGATCCACTGG + Intergenic
950632712 3:14293593-14293615 GGCCCCCGTGCGGGATCCACTGG + Intergenic
950929469 3:16774138-16774160 AGCCCCAGTGCGGCATCCACTGG + Intergenic
951024779 3:17817611-17817633 GGCCCCTGTGCAGGATCCACTGG - Intronic
951734855 3:25852131-25852153 GGCCCCGGTGTGAGATCCACTGG + Intergenic
952058015 3:29473443-29473465 GGCCTCCGTGCGGGATCCACTGG - Intronic
952275324 3:31870537-31870559 AGCCCCGGTGCGGGATCCACTGG + Intronic
952355453 3:32579136-32579158 GGCCCCAGTGGGGGATCCACTGG + Intergenic
952360547 3:32626056-32626078 CGCCCCTGTGAGGGATCCACTGG + Intergenic
952398304 3:32940104-32940126 AGCCCCAGTGCGGGATCCACTGG + Intergenic
952571241 3:34720079-34720101 GGCTCCAGTACAAGCTCCACGGG - Intergenic
952593716 3:34988799-34988821 AGCCCCAGTGGGGGATCCACTGG + Intergenic
952713387 3:36453724-36453746 AGCCCCGGTGCGGGATCCACTGG + Intronic
952730723 3:36634329-36634351 AGCCCCGGTGCGGGATCCACTGG + Intergenic
952795324 3:37233440-37233462 AGCCCCAGTGCGGGACCCACTGG + Intergenic
952885003 3:38006753-38006775 GAGCCCAAGGCAGGATCCACTGG + Intronic
953002964 3:38951573-38951595 GGCCCCGGTGCGGGATCCACTGG + Intergenic
953124429 3:40077847-40077869 AGCCCCGGTGCGGGATCCACTGG - Intronic
953220637 3:40968993-40969015 GGCCCTAGGGCAGCATACACTGG + Intergenic
953307529 3:41844107-41844129 GGCCCCGGTGGGGGATCCACTGG - Intronic
953375051 3:42421478-42421500 GGCCCCAGGGCCTGAACCACAGG - Intergenic
953423097 3:42770086-42770108 GGCCCTGGTGCAGGATCCACTGG + Intronic
953522422 3:43656365-43656387 AGCCCCTGTGCGGGATCCACTGG - Intronic
953673995 3:44986055-44986077 GGCCCCAGTGCAGGATCCACTGG - Intronic
953714693 3:45307109-45307131 GGCCCCAGTGTGGGATCCACTGG + Intergenic
953927089 3:46988045-46988067 GGCCCCAGAGCTGGTTCCATGGG - Intronic
954226130 3:49182603-49182625 AGCCCCAGTGCGGGATCCACTGG - Intronic
954354950 3:50077026-50077048 GGCCCCAGTGTTGGAGCCTCAGG + Exonic
954620212 3:51990994-51991016 AGCCCCGGTGCGGGATCCACTGG + Intergenic
955175837 3:56612437-56612459 GGCCCCAGGGCTGTATACACTGG + Intronic
955183430 3:56692302-56692324 AGCCCCAGTGCGGGATCCACTGG + Intergenic
955234367 3:57126502-57126524 GGCAGCGGAGCAGGATCCACAGG + Intronic
955425019 3:58778688-58778710 GGCCCCAGGGCAGCATACACTGG - Intronic
956195814 3:66651949-66651971 AGCCCCGGTGCAGGATCCACTGG + Intergenic
956392128 3:68785251-68785273 AGCCCCAGTGCGAGATCCACTGG - Intronic
956541480 3:70344657-70344679 GGCCCCATGGCAGCATCCAGAGG - Intergenic
956563701 3:70612235-70612257 AGCCCTGGTGCAAGATCCACTGG + Intergenic
956632673 3:71331519-71331541 GGCCCCGGTGCGGGATCCACTGG + Intronic
956721404 3:72121009-72121031 GGCCACAGTGCAGGAACCCTGGG - Intergenic
957009110 3:74985064-74985086 AGCCCCGGTGTGGGATCCACTGG - Intergenic
957074154 3:75588176-75588198 GGCTCCTGTGTGGGATCCACTGG + Intergenic
957277543 3:78108810-78108832 AGCCCCCGAGCGGGATCCACTGG + Intergenic
957362158 3:79173744-79173766 GGCCCCAGTGCGGGATCCACTGG + Intronic
957388934 3:79536356-79536378 GGCGACAGTGCATGATACACTGG - Intronic
957419587 3:79951309-79951331 AGCCCCCATGCGGGATCCACTGG - Intergenic
957446192 3:80314870-80314892 AGCCCCAGTGTGGGATCCACTGG + Intergenic
957556222 3:81767315-81767337 GGCCCCAGTGCGGGATCCACTGG - Intergenic
957560090 3:81811947-81811969 AGCCCCGGTGCGGGATCCACTGG - Intergenic
957631014 3:82715752-82715774 AGCCCCCATGCGGGATCCACGGG + Intergenic
957804828 3:85133799-85133821 AGCCCCGGTGAGGGATCCACTGG - Intronic
957885565 3:86282647-86282669 GGCCCCACTGCCGGATCCACTGG + Intergenic
957919605 3:86731449-86731471 AGCCCTGGTGCGGGATCCACTGG - Intergenic
957921897 3:86758021-86758043 AGCCCCAGTGCGGGATCCACTGG + Intergenic
958022715 3:88016110-88016132 AGCCCCGGTGGGGGATCCACTGG + Intergenic
958419946 3:93918006-93918028 AGCCCCAGTGCAGGATCCACTGG + Intronic
958810689 3:98857911-98857933 AGCCCCGGTGCGGGATCCACTGG - Intronic
958973345 3:100638000-100638022 GGCCCCACAGCAGCATCCAGAGG + Intronic
959422810 3:106149055-106149077 AGCCCCTGTGCGAGATCCACTGG + Intergenic
959996908 3:112690244-112690266 GGCCCCAGTGCAGGTTGCACAGG + Intergenic
960149724 3:114238228-114238250 AGCCCCGGTGCGGGATCCACTGG - Intergenic
960161148 3:114351453-114351475 GGCCCGAGTCCTGGATCCCCGGG + Exonic
960199334 3:114812635-114812657 AGCCCGGGTGCGGGATCCACTGG - Intronic
960685561 3:120290091-120290113 GGCCCCAGTGTGGGATCCACTGG + Intergenic
960761592 3:121078470-121078492 GGCCCTGGTGCAGGATCCACTGG - Intronic
960868514 3:122227153-122227175 GGTCCCGGTGCGGGATCCACTGG - Intronic
961279938 3:125758564-125758586 AGCTCCTGTGCGGGATCCACTGG - Intergenic
961461929 3:127056209-127056231 AGCCCCTGTGCGGGATCCACTGG - Intergenic
961464979 3:127076223-127076245 GGCCCCGGTGTGGGATCCACTGG - Intergenic
961688886 3:128653820-128653842 CGCCCGGGTGCAGGATTCACTGG + Intronic
961746646 3:129068246-129068268 GGCCCCCGTGCGGGATCCACTGG - Intergenic
961749785 3:129088291-129088313 GGCTTCAGTCCAGGATCCAGGGG + Exonic
961874457 3:130011015-130011037 GGCTCCTGTGTGGGATCCACTGG + Intergenic
961956962 3:130814780-130814802 GGCCCTGGTGCGGGATCCACTGG - Intergenic
962290975 3:134136098-134136120 GGACCCACTGCAGGCTCCTCAGG - Intronic
962383690 3:134916294-134916316 GGCCCTCGTGTGGGATCCACTGG - Intronic
962590998 3:136889939-136889961 AACCCCTGTGCGGGATCCACTGG - Intronic
962600424 3:136987526-136987548 AGCCCTGGTGCGGGATCCACTGG - Intronic
962998207 3:140651813-140651835 GGCCCTGGTGTGGGATCCACTGG + Intergenic
963397290 3:144750230-144750252 AGCCCTGGTGCGGGATCCACTGG + Intergenic
963440484 3:145333799-145333821 AGCCCCGGTGCGGGATCCACTGG + Intergenic
963589917 3:147245543-147245565 AGCCCCGGTGCAGGATCCACTGG - Intergenic
963673436 3:148280504-148280526 GGCCCCAGTGCGGGATCCACTGG - Intergenic
963742847 3:149097659-149097681 AGCCCAGGTGCAGGATCCACTGG - Intergenic
963744229 3:149109778-149109800 AGCCCGGGTGCAGGATCCACTGG + Intergenic
963760666 3:149284408-149284430 GGCCCTGGTGCGGGATCCACCGG + Intergenic
963862253 3:150323392-150323414 AACCCCGGTGCTGGATCCACTGG + Intergenic
963967001 3:151383225-151383247 GGCCCAAGTGCAGGCCCCTCTGG + Intronic
964014460 3:151928578-151928600 AGCTCCGGTGCGGGATCCACTGG + Intergenic
964037610 3:152217723-152217745 GGCCCTGGTGCGTGATCCACTGG + Intergenic
964117899 3:153155687-153155709 AGCCCCATTGCGCGATCCACTGG - Intergenic
964198213 3:154088393-154088415 GGCCCCGGTGTGAGATCCACTGG + Intergenic
964393710 3:156223850-156223872 TGCCCCAGTGCGGGATACACTGG - Intronic
964444077 3:156740999-156741021 ATCCCCTGTGCGGGATCCACTGG + Intergenic
964452075 3:156822615-156822637 AGCCCCAGTGCGAGACCCACTGG - Intergenic
964751934 3:160060950-160060972 AGCCCCTGTGCAGGGTCCACTGG + Intergenic
964974249 3:162600125-162600147 AACCCCAGTGCGAGATCCACTGG + Intergenic
964983080 3:162710446-162710468 GGCCCTGGCGCGGGATCCACTGG - Intergenic
965003596 3:162987741-162987763 CGGCCAGGTGCAGGATCCACTGG + Intergenic
965040372 3:163499446-163499468 AGCCCCAGTGTGAGATCCACTGG + Intergenic
965044062 3:163552261-163552283 CACCCCTGTGCGGGATCCACTGG - Intergenic
965078071 3:164003390-164003412 AGCCCCAGTGCGGGATCCACTGG + Intergenic
965109344 3:164401827-164401849 AGCCCCGGTGCGGGATCCACTGG - Intergenic
965200271 3:165649255-165649277 AGCCGCAGTGCGGGATCCACTGG - Intergenic
965220137 3:165918384-165918406 AGCACCGGTGCAGGATCCACTGG - Intergenic
965220823 3:165924275-165924297 CGCCCAGGTGCGGGATCCACTGG - Intergenic
965298202 3:166976255-166976277 AGCCCCGGTGCGGGATCCACTGG + Intergenic
965446539 3:168780530-168780552 AGCCCTGGTGCTGGATCCACTGG + Intergenic
965943406 3:174211910-174211932 AGCCCCAGTGCGGGATCTACTGG - Intronic
966076133 3:175937794-175937816 AGCCCCAGTGCACGATCCACTGG + Intergenic
966096710 3:176213354-176213376 AGCCCCAGTGCGGGATCCACTGG - Intergenic
966190938 3:177271666-177271688 AGCCCCGGTGCAGGATCCACTGG - Intergenic
966246003 3:177808888-177808910 AGCCCCGGTGCAAGATCCACTGG - Intergenic
966372355 3:179262992-179263014 GGCCCCGGTGCGGGATCCACTGG - Intronic
966548902 3:181182957-181182979 AGCCCCTGTGAGGGATCCACTGG - Intergenic
966725355 3:183103685-183103707 AGCCCCAGTGCCGGACCCACTGG - Intronic
967234028 3:187367514-187367536 GCCCCCGGGGCGGGATCCACTGG - Intergenic
967499077 3:190176987-190177009 AGCCCCGGTGCAGGATCCACTGG - Intergenic
968181518 3:196598976-196598998 AGCCCCAGTGCGGGATCCACTGG - Intergenic
968412737 4:403938-403960 AGCCCCGGCGCGGGATCCACTGG - Intergenic
968469744 4:773950-773972 AGCCCCAGCGCAGGATCCACTGG + Intergenic
968532416 4:1099840-1099862 TACCCCTGTGCGGGATCCACGGG + Intronic
968575088 4:1362312-1362334 GTCCACAGTGCAGGAGCTACAGG - Intronic
969017773 4:4115776-4115798 GGCTCCTGTGTGGGATCCACTGG + Intergenic
969294258 4:6260177-6260199 TGCCCCAGTGCAGGGACTACAGG - Intergenic
969440815 4:7215551-7215573 AGCCCCGGTGCGGGATCCACTGG + Intronic
969459702 4:7322419-7322441 GGCCCCAGTGCATGAGGCCCCGG - Intronic
969566823 4:7983683-7983705 GGCCTCAGTGCAGGCTGCTCGGG - Intronic
969795417 4:9524399-9524421 AGCTCCTGTGCGGGATCCACTGG - Intergenic
970051314 4:11918056-11918078 AGTCCCAGTGCAGGATCCACTGG + Intergenic
970182663 4:13415805-13415827 AGCCCCAGTGCAGGATCCACTGG + Intronic
970272184 4:14359035-14359057 GGCCCCATTGCAGGATCCACTGG + Intergenic
970649248 4:18159208-18159230 AGCCCCGGTGCGGGATCCACTGG - Intergenic
970673089 4:18418275-18418297 AGCCCCGGTGCGGGATCCACTGG - Intergenic
970803607 4:20004437-20004459 AGCCCCGGTGCGGGATCCACTGG + Intergenic
970817809 4:20178949-20178971 AGCCCTAGTACGGGATCCACTGG - Intergenic
971280457 4:25239180-25239202 GGCCCCAGTGTGGGATCCACTGG - Intronic
971281607 4:25246562-25246584 GGCCCCAGTGTGGGATCCACTGG - Intronic
971377035 4:26063908-26063930 AGCCCCAGTGCGGGATCCACTGG - Intergenic
971639897 4:29117776-29117798 AGCCCCAGTGCGGGATCCACTGG + Intergenic
971709534 4:30093129-30093151 AGCCCCAGAGCGGGATCCACTGG + Intergenic
971905116 4:32716163-32716185 AGCCCCGGTGCAGGAGCCACTGG - Intergenic
972034726 4:34506558-34506580 AGCCCCCGTGCCGGATCCACTGG - Intergenic
972053061 4:34764730-34764752 GGCCCCAGAGCAGCATCTAGGGG - Intergenic
972505714 4:39718452-39718474 GGCCCCGGTGCGAGATCCACTGG - Intronic
973037178 4:45420573-45420595 AGCACCTGTGCGGGATCCACTGG + Intergenic
973041731 4:45477289-45477311 GGCCCCGGTGCAGGATCCACTGG - Intergenic
973048653 4:45567475-45567497 GGCCCAAGTGCAGGATCCACTGG + Intergenic
973146399 4:46831470-46831492 GGCCCCAGTGCGGGATCCACTGG + Intronic
973190239 4:47377981-47378003 AGCCCCAGTGCGAGATCCACTGG - Intronic
973587686 4:52409683-52409705 AGCCCTGGTGCGGGATCCACTGG - Intergenic
973765020 4:54155063-54155085 CGGCCTGGTGCAGGATCCACTGG - Intronic
973817660 4:54632958-54632980 AGCCCCAGTGCGGGATCCACTGG + Intergenic
973854179 4:54993892-54993914 GGCCCCGGTGCAGGATCCACTGG + Intergenic
973878189 4:55241877-55241899 CGGCCCAGTGTGGGATCCACTGG + Intergenic
974128887 4:57729710-57729732 GGCCCAGGTGTGGGATCCACTGG - Intergenic
974147494 4:57965847-57965869 AGCCCCAGTGCGGGATCCACTGG + Intergenic
974281785 4:59804686-59804708 GGCACATGTGCAGGATGCACAGG + Intergenic
974484710 4:62491835-62491857 AGCCCAGGTGCAGGATCCACTGG - Intergenic
974590513 4:63942820-63942842 AGCCCAGGTGCGGGATCCACTGG - Intergenic
974792693 4:66712356-66712378 CGCCCCAGTGCGGGATCCACTGG - Intergenic
974804463 4:66860591-66860613 AGCCCCGGTGCGGGATCCACTGG + Intergenic
974827834 4:67152302-67152324 AGCCCCTGTGCGGGATCCACTGG + Intergenic
974987167 4:69042249-69042271 GGCCCCATGGCAGCATCCAGGGG - Intronic
974992798 4:69115178-69115200 GACCCCAGTGTGGGATCCACTGG - Intronic
975055474 4:69924313-69924335 AGCCCCAGTGTGGGATCCACTGG + Intergenic
975308622 4:72877501-72877523 GGCCCCAGTATGGGATCCACTGG + Intergenic
975745014 4:77466765-77466787 TGGCCCCGGGCAGGATCCACTGG + Intergenic
975755941 4:77571085-77571107 AGCCCCGGTGTGGGATCCACTGG + Intronic
975995001 4:80303216-80303238 TGCCCCAGTGCGGGAGCCACTGG + Intronic
976406455 4:84665121-84665143 AGCCCCCGTGCAGGATCCACTGG + Intergenic
976736230 4:88313141-88313163 GGCCCCAGTGCGGGATCCACTGG - Intergenic
977470624 4:97438020-97438042 GGCCCCGGTGCGGGATCCACTGG - Intronic
977507766 4:97923443-97923465 GGCCCCAGTGCTGGATCCACTGG + Intronic
977606844 4:98993419-98993441 GGCCCCAGTGCGGGAACCACTGG - Intergenic
977875616 4:102146486-102146508 GACCTCAGTGAAGGGTCCACAGG - Intergenic
977885694 4:102250235-102250257 CGCCCCGGTGCAGGATCCACTGG - Intergenic
978080326 4:104582403-104582425 AGCCCCGGTGCGGGATTCACTGG + Intergenic
978207121 4:106092337-106092359 GGCCCCAGTGTGGGATCCACTGG - Intronic
978241810 4:106525282-106525304 AGCCCCAGTGAGGGATCCACTGG - Intergenic
978463548 4:108984329-108984351 AGCCCCTGTGCGGGATCCACTGG - Intronic
978917905 4:114148518-114148540 GGCCCCAGTGCAGGATCCACTGG - Intergenic
978999504 4:115200132-115200154 AGCCCCAGTGCGGGATCCACTGG - Intergenic
979224269 4:118265976-118265998 GGTCCAGGTACAGGATCCACTGG + Intergenic
979445611 4:120808549-120808571 GACCCCAGTGTAGGATCCACTGG - Intronic
979609093 4:122670637-122670659 GGCCCCAGTGCCGGATCCACTGG + Intergenic
979688669 4:123538339-123538361 AGCCCAGGTGCGGGATCCACTGG + Intergenic
979755941 4:124339434-124339456 AGCCCTGGTGCGGGATCCACTGG + Intergenic
979825630 4:125229520-125229542 AGCCCCAGTGCGGGATCCACTGG - Intergenic
979899630 4:126201229-126201251 AGCCCCGGTGCGGGATCCACTGG - Intergenic
980043303 4:127964175-127964197 AGCCCCGGTGCGGGATCCACTGG - Intronic
980051855 4:128047497-128047519 AGCCCCGCTGCGGGATCCACTGG - Intergenic
980115281 4:128673041-128673063 GGCCTCTGTGCGGGATCCACTGG + Intergenic
980230182 4:130038484-130038506 AGCCCCACTGCCGGATCCACTGG - Intergenic
980628668 4:135407041-135407063 AGCCCCGGTGCGGGATCTACTGG + Intergenic
980698822 4:136395739-136395761 GGCCCCAGTGGACGATCCAGTGG + Intergenic
980739334 4:136929417-136929439 GGCCCCGGTGTGGGATCCACTGG + Intergenic
980815632 4:137942493-137942515 AGCCCCGGTGCGGGATCCACTGG + Intergenic
981146648 4:141332956-141332978 AGCCCCGCTGCGGGATCCACTGG - Intergenic
981169490 4:141605371-141605393 GGCCCAGGTGTGGGATCCACTGG - Intergenic
981176515 4:141689796-141689818 AGCCCCAGTGTGGGATCCACTGG - Intronic
982139002 4:152299592-152299614 GGTCCCAGAGCAGGAGCCATAGG + Intergenic
982814505 4:159868970-159868992 AGCCCCGGTGCGGGATCCACTGG - Intergenic
982863466 4:160482190-160482212 TGCCCCGGTGCAGGATCCACTGG + Intergenic
982868727 4:160550046-160550068 AGCCCCGGTGCAGGATCCACTGG - Intergenic
983135013 4:164068776-164068798 GGCCCTGGTGAGGGATCCACTGG + Intronic
983230587 4:165125878-165125900 AGCCGCCGTGCGGGATCCACTGG - Intronic
983425787 4:167581978-167582000 GGCCCTGGCACAGGATCCACTGG + Intergenic
983656815 4:170091653-170091675 GGCCCCAGTGCCGGCTCCACTGG + Intronic
983752921 4:171298703-171298725 AACCCCGGTGCGGGATCCACTGG + Intergenic
984238742 4:177193134-177193156 AGCCCAGGTGCGGGATCCACCGG - Intergenic
984241767 4:177227503-177227525 AGCCCCGGTGCAGGATCCACTGG - Intergenic
984265738 4:177496014-177496036 AGCCCCTGTGCGGGATCCACTGG + Intergenic
984662324 4:182386972-182386994 AGCCCCTGTGCGGGATCCACTGG + Intronic
984770640 4:183433567-183433589 AGCCCCGGTGCAGGATCCACTGG + Intergenic
984776032 4:183482626-183482648 AGCCCCGGTGGGGGATCCACTGG - Intergenic
984901822 4:184592289-184592311 GGCCCTGGTGCGGGATCCACTGG + Intergenic
985145499 4:186890537-186890559 GGCCCCGGTGTGAGATCCACTGG + Intergenic
985203326 4:187506053-187506075 AGCCCCTGTGCGGGATCCACTGG + Intergenic
985403527 4:189615144-189615166 CTCCCCAGTGCAGGATCCACTGG - Intergenic
985403793 4:189616584-189616606 AGCCCCTGTGCGGGATCCACTGG - Intergenic
985412033 4:189695627-189695649 GGCCCTGGTGCAGGATCCACTGG - Intergenic
985904416 5:2822618-2822640 GGCACAAGTGAAGGATGCACTGG + Intergenic
986121218 5:4837956-4837978 GGCCCCGGTGTGGGATCCACTGG + Intergenic
986626252 5:9725750-9725772 AGCTCCAGTGCGGGATCCACTGG + Intergenic
986661831 5:10065926-10065948 GGCCCGGGTGCGGGATCCAGTGG + Intergenic
987146175 5:14993742-14993764 AGCCCCGGTGTGGGATCCACTGG - Intergenic
987156686 5:15096453-15096475 AGCCCTGGTGCGGGATCCACTGG - Intergenic
987283808 5:16436603-16436625 GGCCCTGGTGCGGGATCCACTGG + Intergenic
987347367 5:16990919-16990941 GGCCCCAGTGCGGGATCCACTGG - Intergenic
987352225 5:17032413-17032435 CGCCCCGGTGCAGGATCCACTGG - Intergenic
987383935 5:17311711-17311733 AGCCCCGGTGCAGGATCCACTGG - Intergenic
987896368 5:23951719-23951741 AGCCCCGGTGAGGGATCCACTGG + Exonic
988073582 5:26324883-26324905 AGCCCCGGTGCGGGATCCACTGG + Intergenic
988086912 5:26485218-26485240 AGCCCCCATGCGGGATCCACTGG - Intergenic
988201702 5:28077606-28077628 GGCCACCGTGTGGGATCCACTGG - Intergenic
988279487 5:29127561-29127583 AGCCCCAATGCGGAATCCACTGG - Intergenic
988291691 5:29296430-29296452 GGCCCCAGTGGGGGATCCAATGG - Intergenic
988369340 5:30346174-30346196 AGCCCCTGTGCGGGATCCACTGG + Intergenic
988684662 5:33515326-33515348 AGCCCCTGTGTGGGATCCACTGG - Intergenic
988883670 5:35532050-35532072 AGCCCCAGTGCAGGATCCACTGG + Intergenic
989003278 5:36783003-36783025 AGCCCCGGTGTGGGATCCACTGG + Intergenic
989956924 5:50369860-50369882 AGCCCCGGTGTGGGATCCACAGG + Intergenic
990243313 5:53837350-53837372 CGCCCCCCTGCGGGATCCACTGG + Intergenic
990490140 5:56295747-56295769 AGCCCCTGTGAGGGATCCACTGG + Intergenic
990880295 5:60530720-60530742 GGCCCCCGTGCGGGATCCACTGG + Intergenic
991330162 5:65485416-65485438 AGCCCCGGTGCGGGATCCACTGG - Intergenic
991657864 5:68921289-68921311 GCCCCCGGTGTGGGATCCACTGG + Intergenic
992296811 5:75334108-75334130 AGCCCTGGTGCAGGATCCACTGG + Intergenic
992947523 5:81824136-81824158 AGCCCTGGTGCGGGATCCACTGG + Intergenic
993031949 5:82715112-82715134 AGCCCCAGTGCGGGATCCACTGG + Intergenic
993529112 5:89003562-89003584 GACCCCGGTGCGGGATCCACTGG - Intergenic
993678531 5:90847455-90847477 AGCCCTGGTGCGGGATCCACTGG - Intronic
993803465 5:92374831-92374853 AGCCCCAGTGTGGAATCCACTGG - Intergenic
993822116 5:92631754-92631776 AGCCCCAGTGTGGGATCCACTGG + Intergenic
994096419 5:95851589-95851611 AGCCCAGGTGCGGGATCCACTGG + Intergenic
994230038 5:97301571-97301593 AGCCCCAGTGCAGGATCCACTGG + Intergenic
994251436 5:97541814-97541836 GGCCCTGGTGCAGGATCCACTGG - Intergenic
994254719 5:97579932-97579954 AGCCCCGGTGCGGGATCCACTGG - Intergenic
994507191 5:100657185-100657207 AGCCCCCCTGCAGGATCCACTGG + Intergenic
994509765 5:100688805-100688827 AGCCCCCGTGCGGGATCCACTGG - Intergenic
994620426 5:102155363-102155385 GGCCCCTGTGGGAGATCCACTGG + Intergenic
994647688 5:102491329-102491351 GGCCCCGGTAGGGGATCCACTGG - Intronic
994701627 5:103141972-103141994 AGCCCTGGTGCGGGATCCACTGG - Intronic
994769714 5:103966264-103966286 AGCCCCAGTGCGAGATCCACTGG - Intergenic
994841468 5:104929424-104929446 GGCCCCGGTGCGGGATCCACTGG + Intergenic
994928879 5:106154680-106154702 AGCCCCTGTGCGGGATCCACTGG + Intergenic
994932369 5:106206027-106206049 GGCCCCAGTGCAGGATCCACTGG - Intergenic
995112308 5:108442019-108442041 GGCCCCGGTATGGGATCCACTGG - Intergenic
995326345 5:110893965-110893987 AGCCCCCGTGCGGGATCCACTGG - Intergenic
995568745 5:113457566-113457588 AGCCCAGGTGCAGGATCCACTGG + Intronic
995656580 5:114433103-114433125 AGCCCCTGTGCAGGATCCACTGG + Intronic
995975905 5:118034248-118034270 GGTCCCAGTGTGGGATCCACTGG + Intergenic
996234296 5:121107599-121107621 AGCCCCGCTGCGGGATCCACTGG + Intergenic
996435774 5:123430977-123430999 AGCCCCGGTGCGGGATCCACTGG + Intergenic
996530475 5:124522045-124522067 CGCCCCCGTGCGGGATCCACTGG + Intergenic
997352286 5:133239382-133239404 AGACCTGGTGCAGGATCCACTGG + Intronic
997505288 5:134412040-134412062 AGACCCAGGGCAGGAGCCACGGG - Intergenic
997760638 5:136444637-136444659 AGCCCCGGTGCGGGATCCACTGG + Intergenic
998752766 5:145340827-145340849 GGCCCCAGAGCAGCTTACACTGG - Intergenic
999348616 5:150845848-150845870 CGGCCTGGTGCAGGATCCACTGG + Intergenic
999855207 5:155586690-155586712 AGCCCCCGTGCGGGATCCACTGG - Intergenic
1000066110 5:157694261-157694283 AGCCCCAGTGTGGCATCCACTGG + Intergenic
1000547687 5:162622267-162622289 GGCCCCAGTGCGGGATCCACTGG + Intergenic
1000609210 5:163356236-163356258 AGCCCCCATGCAGGATCCACTGG + Intergenic
1000891740 5:166810133-166810155 AGCCCCTGTGCGAGATCCACTGG - Intergenic
1000928940 5:167229295-167229317 GGCCACAGGGCAGCATACACTGG + Intergenic
1001667385 5:173444661-173444683 GGCCCCAGAGCTGGGACCACAGG + Intergenic
1001843637 5:174901940-174901962 AGCCTCAGTGCAGGATCCACTGG + Intergenic
1002004560 5:176221963-176221985 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1002221815 5:177688657-177688679 AGCCCCAGTGCGGGATCCACTGG + Intergenic
1002662227 5:180799260-180799282 GGCCAGAGTGCAGGGTCCATGGG - Intronic
1002789303 6:426138-426160 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1002793274 6:450391-450413 GGCCCCAGTGTGAGATCCACTGG + Intergenic
1003070287 6:2940016-2940038 AGCCCCAGTACAGGATCCACTGG + Intergenic
1003100269 6:3171187-3171209 AGCCCCGGTACAGGATCCACTGG + Intergenic
1003178553 6:3772014-3772036 CGCCCCGGTGCGAGATCCACTGG + Intergenic
1003213812 6:4090513-4090535 GGCCCCGGTATGGGATCCACTGG + Intronic
1003489155 6:6606410-6606432 CGCCCAGGTGCAGGATCCAGTGG - Intronic
1003489970 6:6613215-6613237 GGCCCTAGTGCCGGATCCACTGG - Intronic
1003508766 6:6762418-6762440 AGCCCCAGTGCGAGATCCACTGG - Intergenic
1003531448 6:6940512-6940534 GGCCCCAGTACAGAATCCACTGG + Intergenic
1003578103 6:7315598-7315620 AGCCCCAGTACGGGTTCCACGGG + Intronic
1003578247 6:7316761-7316783 AGCCCCGGTGTGGGATCCACTGG - Intronic
1003581514 6:7344638-7344660 AGCCCCGGTGCCGGATCCACTGG + Intronic
1003589670 6:7426160-7426182 GGCCCCAGTGCGGGATCCACTGG + Intergenic
1003631771 6:7793989-7794011 TTCCCCAGCACAGGATCCACAGG + Intronic
1003671614 6:8164756-8164778 AGCCCCGGTGCCAGATCCACTGG + Intergenic
1003717778 6:8666391-8666413 AGCCCCGGTGTGGGATCCACTGG + Intergenic
1003748088 6:9024689-9024711 AGCCCCCGTGCGGGACCCACTGG + Intergenic
1003770075 6:9290381-9290403 AGCCCCTGTGCGGAATCCACTGG - Intergenic
1003836138 6:10074648-10074670 GGCTCTGGTGCGGGATCCACTGG - Intronic
1003839528 6:10105756-10105778 GGTGCCAGTGCAGCATCCCCTGG + Intronic
1003845809 6:10172177-10172199 AGCCCAGGTGCGGGATCCACTGG + Intronic
1003882003 6:10487725-10487747 GGCCCTAGTGCAGGATCCACTGG - Intergenic
1003896948 6:10616997-10617019 GGCCCTGGTGCGGGATCCACTGG - Intronic
1003901668 6:10660312-10660334 GGCCCCAGTGCGGGATCCACTGG + Intergenic
1003956753 6:11171486-11171508 CGGCCCCGTGCGGGATCCACTGG + Intergenic
1004037046 6:11933504-11933526 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1004045292 6:12017869-12017891 GGCCCCAGTGCGGGATCCACTGG - Intronic
1004200343 6:13541963-13541985 GGCCAGGGTGCAGGATCCACTGG + Intergenic
1004234343 6:13860566-13860588 GGCCCCAGTGGGAGATCCACTGG + Intergenic
1004338147 6:14783541-14783563 GGCCCAGGTGTGGGATCCACTGG - Intergenic
1004425203 6:15502386-15502408 GGTCCCAGTTCTGGATTCACTGG + Intronic
1004499595 6:16198037-16198059 GGCCCCGGTGCGAGATCCACTGG - Intergenic
1004501965 6:16217251-16217273 AGCCCCAGTGCAGGACCCACTGG + Intergenic
1004503114 6:16226806-16226828 AGCCCCAGTGCGGGATGCTCTGG - Intergenic
1004647982 6:17581042-17581064 GCCCCCGGTGCAGGATCCACTGG + Intergenic
1004665459 6:17745245-17745267 AGCTCCGGTGCGGGATCCACTGG - Intergenic
1004689019 6:17976132-17976154 AGCCCCGGTGCGGGATCCACTGG - Intronic
1004861313 6:19806948-19806970 GGCCCCAGTGCGGGATCCACTGG - Intergenic
1004865977 6:19854371-19854393 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1004906281 6:20239436-20239458 GGCCCCGGTGCCGGATCCACTGG + Intergenic
1004912696 6:20301675-20301697 AGCCCCAGTGCAGGATCCACTGG + Intergenic
1004914504 6:20319304-20319326 GGCCCCAATGCCAGATCCACTGG + Intergenic
1005059367 6:21761584-21761606 TGGCCCGGTGCGGGATCCACTGG + Intergenic
1005117643 6:22356336-22356358 GGCCCTGGTGCAGGATCCACTGG - Intergenic
1005561505 6:27045656-27045678 GGCCCCAGTGCGGGATCCACTGG + Intergenic
1005596134 6:27381005-27381027 AGCCCTGGTGCGGGATCCACTGG - Intronic
1005600791 6:27424765-27424787 AGCCCCAGCGCGGGGTCCACTGG - Intergenic
1005707375 6:28469291-28469313 AGCCCCAGTGCGGGATCCACTGG - Intergenic
1005758818 6:28949731-28949753 AACCCCGGTGCGGGATCCACTGG - Intergenic
1005798166 6:29390628-29390650 GGCCCCAGGGCAGCATACACTGG + Intronic
1005978156 6:30816235-30816257 AGCCCCGGTGCTGGATCCACTGG - Intergenic
1006005850 6:31000888-31000910 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1006008387 6:31021143-31021165 GGCCCCGGGGCGGGATCCACTGG + Intronic
1006128027 6:31852438-31852460 GGCCCCAGTGCGGGATCCACTGG + Intergenic
1006352718 6:33532813-33532835 AGCCCCAGTGCGGGATCCACTGG + Intergenic
1006379476 6:33689169-33689191 GGCCCCAGAGCAGGTCCAACAGG - Intronic
1006696084 6:35931693-35931715 AGCCCCAGTGCGGGATCCACTGG + Intergenic
1006748823 6:36364169-36364191 AGCCCCAGTGCAGGATCCACTGG - Intronic
1006978288 6:38124266-38124288 GGCTCCAGTGCGGTATCCACTGG - Intronic
1007223994 6:40300127-40300149 AGCTCCACTGCAGGATCCCCTGG - Intergenic
1007738801 6:43998479-43998501 AGCCCTGGTGCAGGATCCACTGG + Intergenic
1008230966 6:48984326-48984348 CGGCCCTGTGCGGGATCCACTGG + Intergenic
1008254143 6:49275866-49275888 AGCCCCGGTGTGGGATCCACTGG + Intergenic
1008270111 6:49481764-49481786 AGCCCCAGTGTGGGCTCCACTGG - Intronic
1008270420 6:49483359-49483381 AGCCCCAGTGTGGGATCCACTGG - Intronic
1008363674 6:50650599-50650621 GGCCCGAGTGAAGGGTCTACAGG - Intergenic
1008567900 6:52786907-52786929 AGCCCCGGTGTGGGATCCACTGG + Intergenic
1008587450 6:52962569-52962591 GGCCTCAGTGCAGGATCCACTGG - Intergenic
1008631041 6:53363387-53363409 GGCCCTGGCACAGGATCCACTGG - Intergenic
1009407037 6:63326388-63326410 AGCCCTGGTGCAGAATCCACTGG - Intergenic
1009470343 6:64024157-64024179 AGCCCTGGTGCGGGATCCACTGG + Intronic
1009471480 6:64031545-64031567 CGGCCCGGTGCAAGATCCACTGG + Intronic
1009510736 6:64547663-64547685 AGCCCCAGTATGGGATCCACTGG - Intronic
1009800786 6:68533813-68533835 AGCCCCAGTGCCAGATCCACTGG + Intergenic
1009872344 6:69467633-69467655 GGCCCTGGTGTGGGATCCACTGG + Intergenic
1010235567 6:73572469-73572491 CCCCCCAGTGCGGGATCCACTGG - Intergenic
1011178186 6:84587814-84587836 AGCCCCAATGCGGGATCCACTGG + Intergenic
1011246595 6:85326391-85326413 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1011601661 6:89065336-89065358 AGCCCCGGTGCGGGATCCATTGG + Intergenic
1011620027 6:89234426-89234448 AGCCCTGGTGCAGGATCCACTGG - Intergenic
1011974835 6:93283028-93283050 GGCCCCGGTGCGGGATCCATTGG + Intronic
1012189266 6:96260883-96260905 GGCCCCTGTGTGGGATCCACTGG - Intergenic
1012578155 6:100829169-100829191 AGCCCAGGTGCGGGATCCACTGG - Intronic
1012733485 6:102910657-102910679 GGCCCCAGTGTGGGATCCACTGG - Intergenic
1012760426 6:103294341-103294363 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1012851062 6:104446708-104446730 CGGCCCACTGCAGGATCCACTGG + Intergenic
1013080302 6:106806179-106806201 AGCCCCGGTGCGGGACCCACTGG + Intergenic
1013410710 6:109881083-109881105 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1013422700 6:109980129-109980151 AGCCACAGAGCAGGAGCCACAGG - Exonic
1013694734 6:112689304-112689326 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1013853302 6:114541787-114541809 GGCCCTGGTGCAGGATCCACTGG - Intergenic
1014055961 6:117015176-117015198 AGCCCCAGTGCGAGATCCACTGG + Intergenic
1014280880 6:119441427-119441449 AGCCCCAGTGCGAGATCCACTGG + Intergenic
1014460193 6:121686392-121686414 AGCCCCAGTGCGGGATCCACTGG - Intergenic
1014499205 6:122165065-122165087 GGCCCCGGTGTGGGATCCACTGG - Intergenic
1014507837 6:122281003-122281025 AGCCCAGGTGCGGGATCCACTGG + Intergenic
1014718634 6:124892396-124892418 AGCCCTAGTGCGGGATCCACTGG + Intergenic
1014739079 6:125126277-125126299 AGCCCCAGTGCGGGATCCACTGG + Intronic
1014788549 6:125644876-125644898 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1014920997 6:127214527-127214549 AGCCCCGGTGCCGGATCCACTGG - Intergenic
1015572173 6:134633481-134633503 GGCCCCGGTGCGGGATCCACTGG - Intergenic
1015600423 6:134905153-134905175 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1016067294 6:139697861-139697883 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1016092752 6:139999521-139999543 AGCTCCAGTGCGGGATCCACTGG - Intergenic
1016217278 6:141618637-141618659 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1016482238 6:144495087-144495109 AGCCCGGGTGCGGGATCCACTGG - Intronic
1016858723 6:148697130-148697152 GGCCCCGGTGGGGGATCTACTGG - Intergenic
1017325169 6:153134045-153134067 AGCCCCAGTACGGGATCCACTGG + Intergenic
1017581139 6:155866692-155866714 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1017818685 6:158033299-158033321 AGCCCAAGTGCAGAGTCCACTGG + Intronic
1018064160 6:160114454-160114476 AGCCCCGGTGTGGGATCCACTGG - Intergenic
1018195255 6:161350162-161350184 AGCCCCAGTGCAGGCTCGAGTGG - Exonic
1018459289 6:163982205-163982227 GGCACCAGGGAAAGATCCACCGG - Intergenic
1018624571 6:165765224-165765246 AGCCCCCGTGCGGGATCCACTGG - Intronic
1019316735 7:390438-390460 GGCCTCAAGGCAGGGTCCACTGG + Intergenic
1019612923 7:1945989-1946011 GGCCCCAGTGCAGAACCCACTGG - Intronic
1019944188 7:4313874-4313896 AGCCCCTGTGCGGGATCCACTGG - Intergenic
1019965677 7:4496867-4496889 AGCCCCTGTGCGGGATCCACTGG - Intergenic
1020008346 7:4793911-4793933 AGCCCCTGTGCAGGATCCACTGG + Intronic
1020163989 7:5793916-5793938 GGCCCCAGTGCGGGATCCACTGG + Intergenic
1020495799 7:8852115-8852137 GGCTCCAGAGCAGGAGGCACAGG - Intergenic
1020662125 7:10995491-10995513 GGCCCTGGTGCGGGATCCACTGG - Intronic
1020784357 7:12556099-12556121 AGCCCCAGTGTGGGATCCACTGG - Intergenic
1021520638 7:21536526-21536548 GGCCCCGGTGTGGGATCCACTGG - Intergenic
1021567819 7:22032304-22032326 GGCCCCAGTGCGGGATCCACTGG - Intergenic
1022174073 7:27856993-27857015 GGCCCTGGTGCAGGATCCACTGG - Intronic
1022611228 7:31875473-31875495 GGCCCCACAGCAGGATTCTCTGG - Intronic
1022750514 7:33219396-33219418 AGCCCCAGTGCAGGGTCCACTGG + Intronic
1023396133 7:39753887-39753909 GGCCCAGGTGCGAGATCCACTGG - Intergenic
1024159759 7:46662322-46662344 GGCCCCAGTTCAGAATCCATGGG - Intergenic
1024269154 7:47628900-47628922 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1024335557 7:48202850-48202872 AGCCCTGGTGCGGGATCCACTGG - Intronic
1024443909 7:49454057-49454079 AGCTCCAGTGCAGGATCCACTGG + Intergenic
1024465981 7:49711680-49711702 AGCCCCAGTGTGGGATCCACTGG + Intergenic
1024562076 7:50653219-50653241 GGCCCCAGTGCATGCTCCGAGGG + Intronic
1024700560 7:51900822-51900844 AGCCCCAGTGCCAGATCCACTGG - Intergenic
1024735738 7:52302831-52302853 GGCCCTTGTGCGGGATCCACTGG - Intergenic
1024834122 7:53495444-53495466 AGCCCCAGTGCGGGATCCACTGG + Intergenic
1025962003 7:66231298-66231320 AGCCCCGGTGCGGGATCCACTGG - Intronic
1026512417 7:71038018-71038040 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1026516643 7:71078410-71078432 AGCCCCGGTGTGGGATCCACTGG + Intergenic
1027237949 7:76309417-76309439 GGCCCCCATACAGGATTCACTGG - Intergenic
1027561750 7:79739724-79739746 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1027579639 7:79977541-79977563 AGCCCCAGTGCAGGATCCACTGG - Intergenic
1027667461 7:81057420-81057442 AGCCCTGGTGCGGGATCCACTGG - Intergenic
1027674553 7:81142161-81142183 GGCCCCGGTGCGGGATCCACTGG + Intergenic
1027698208 7:81437027-81437049 AGCCCCAGTGCGGGATCCACTGG - Intergenic
1027779024 7:82499993-82500015 AGCCCCAGTGTGGGATCCACTGG + Intergenic
1027868173 7:83673734-83673756 AGCCCCAGTGCGGGATCCACTGG + Intergenic
1028070176 7:86440991-86441013 AGCCCTGGTGCTGGATCCACTGG + Intergenic
1028392754 7:90334836-90334858 GACCCTAGTGCGGGATCCACTGG + Intergenic
1028778398 7:94705916-94705938 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1028852442 7:95552403-95552425 AGCCCCGGTGTGGGATCCACTGG - Intergenic
1028989581 7:97034769-97034791 GGCCCCAGTGAGAGATCCACTGG + Intergenic
1029076213 7:97936305-97936327 AGCTCCTGTGCGGGATCCACTGG + Intergenic
1029110831 7:98212342-98212364 GGCCCCGGTGCAGGACACAGAGG + Exonic
1029809564 7:103034181-103034203 AGCCCCAGTGCGAGATCCACTGG - Intronic
1029904028 7:104072183-104072205 AGCCCCAGTGCGGAATCCACTGG + Intergenic
1030215656 7:107042299-107042321 AGCCCCAGTGCGGGATCCACTGG - Intergenic
1030292724 7:107888241-107888263 CGCCCCAGCGCAGGATCCACTGG + Intergenic
1030366948 7:108657187-108657209 AGCCCCAGTGCAGCATCCACTGG - Intergenic
1030733564 7:113017769-113017791 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1030780489 7:113593741-113593763 AGTCCCGGTGCGGGATCCACTGG + Intergenic
1030819242 7:114076788-114076810 AGCCCCGGTGCCGTATCCACTGG - Intergenic
1030980619 7:116181920-116181942 AGCCCCAGTGCGGGATCCACTGG - Intergenic
1031110038 7:117596532-117596554 AGCCCCAGTGCGGGATCCACTGG + Intronic
1031378866 7:121060359-121060381 GCCCCCGGTGCGGGATCCACTGG + Intronic
1031409284 7:121422150-121422172 GGCCCCAGTGCGGGATCCACTGG + Intergenic
1033065147 7:138146544-138146566 AGCCCCAGTGCGAGATCCACTGG + Intergenic
1033312357 7:140271282-140271304 GACCCGGGTGCGGGATCCACTGG - Intergenic
1033633789 7:143189233-143189255 GGCCCCACAGCAGCATCCAGCGG + Intergenic
1033664028 7:143424335-143424357 AGCCCTGGTGCGGGATCCACTGG - Intergenic
1033866572 7:145697350-145697372 GGCCCCGGTGCGGGATCCACTGG - Intergenic
1034097989 7:148426831-148426853 AGCCCCAGTGCGGGATCCACTGG + Intergenic
1034632066 7:152538825-152538847 AGCCCCGGTGCGGGATCCACGGG - Intergenic
1034651846 7:152697544-152697566 AGCCCCAGTGCAGGATCCACTGG + Intergenic
1034886827 7:154804704-154804726 GACACCAGTGCAGATTCCACTGG - Intronic
1034967024 7:155398082-155398104 AGCCCCAGTGCGAGATCCACTGG - Intergenic
1034969495 7:155410265-155410287 GGCCCAGGTGCAGGGTCCTCAGG - Intergenic
1035151113 7:156873943-156873965 AGCCCTAGTGCGGAATCCACTGG - Intronic
1036206761 8:6811406-6811428 TGCCCCAGTGCAGGCTTCCCTGG - Exonic
1036440954 8:8781329-8781351 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1036554591 8:9847737-9847759 GGCCCTGGTGCGGGATCCACTGG - Intergenic
1036831425 8:12023025-12023047 GGCTCTTGTGCGGGATCCACTGG + Intergenic
1036901648 8:12673828-12673850 GGCTCCTGTGTGGGATCCACTGG + Intergenic
1036915051 8:12796686-12796708 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1037065102 8:14567259-14567281 CACACCAGTGCGGGATCCACTGG + Intronic
1037263770 8:17036755-17036777 AGCCCTGGTGCGGGATCCACTGG - Intronic
1037425536 8:18750981-18751003 AGCCCCGGTGCGGGATCCACTGG - Intronic
1037559007 8:20055148-20055170 GGCCCCTGTGCGAGATCCCCTGG + Intergenic
1037957473 8:23070718-23070740 AACCCCGGTGCGGGATCCACTGG - Intergenic
1038638350 8:29304677-29304699 AGCCCCTGTGCAGGATCCACTGG + Intergenic
1038639480 8:29311885-29311907 AGCCCCTGTGCGGGATCCACTGG + Intergenic
1038870771 8:31490290-31490312 AGCCCCAGTGCGAGATCCACTGG + Intergenic
1039068809 8:33632103-33632125 GGCCCCGGTGCAGGATTCACTGG + Intergenic
1039069033 8:33633765-33633787 AGCCGCAGTGCGGGTTCCACCGG - Intergenic
1039335163 8:36581182-36581204 GGCCCCAGTGAATGATCCGCTGG - Intergenic
1039587681 8:38720219-38720241 AGCCCCGGTGCCCGATCCACTGG + Intergenic
1039637379 8:39180550-39180572 AGCCCTGGTGCGGGATCCACTGG + Intronic
1040351346 8:46571948-46571970 GGCCCCAGTGCAGGATCCACTGG + Intergenic
1040622155 8:49102940-49102962 GGCCCCGGTGCGAGATCCACTGG - Intergenic
1040723200 8:50350341-50350363 GGCCCTGGTGCGGGATCCACTGG + Intronic
1040806763 8:51404761-51404783 CACCCTGGTGCAGGATCCACTGG - Intronic
1040954847 8:52969771-52969793 AGCCCCAGTGTGAGATCCACTGG - Intergenic
1041034588 8:53775838-53775860 AGCCCCAGTGCGGGACCCACTGG - Intronic
1041604284 8:59761936-59761958 CGGCCCTTTGCAGGATCCACTGG - Intergenic
1041636592 8:60152905-60152927 GGCCCTGGTGTGGGATCCACTGG - Intergenic
1041732683 8:61078074-61078096 AGCCCCAGTGCAGGCTTCCCTGG + Intronic
1041914595 8:63126497-63126519 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1042378449 8:68082780-68082802 GGCTCCAGTGCAGGAGACAGAGG - Intronic
1043073268 8:75665403-75665425 GGCCCCGGTGCGGGATCCACTGG - Intergenic
1043110172 8:76169994-76170016 AGCCCCAGTGCATGATCCACTGG + Intergenic
1043129862 8:76447553-76447575 AGTCCCCGTGCGGGATCCACTGG - Intergenic
1043352418 8:79377141-79377163 TGCCCCGGTGCGGGATCCACTGG - Intergenic
1043701193 8:83290773-83290795 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1043731877 8:83693935-83693957 GGCCCCAGTATGGGATCCACTGG - Intergenic
1044075896 8:87821257-87821279 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1044088558 8:87971537-87971559 GGCCCTGATGCGGGATCCACTGG + Intergenic
1044404958 8:91816744-91816766 AGCCCAGGTGCGGGATCCACTGG + Intergenic
1044633400 8:94300271-94300293 TGCCCCGGTGTGGGATCCACTGG - Intergenic
1044788760 8:95824062-95824084 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1044862084 8:96533784-96533806 GGCCCCAGTGCAGGATCCATTGG - Intronic
1044880596 8:96719024-96719046 AGCCCCGGTGCGGGATCTACTGG - Intronic
1045678339 8:104632830-104632852 GGCCCCAGCGCAGCGTCCACCGG - Intronic
1045743277 8:105387270-105387292 CGCCCCAATGCGGGATCCACTGG - Intronic
1046149272 8:110202514-110202536 CGGCCCGGTGCGGGATCCACTGG - Intergenic
1046208815 8:111040775-111040797 AGCCCCAGTGCGAGATCCACTGG - Intergenic
1046284981 8:112082957-112082979 AGCCCCCTTGCGGGATCCACTGG - Intergenic
1046288981 8:112133115-112133137 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1046445414 8:114311773-114311795 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1046450783 8:114386578-114386600 AGCCCTGGTGCGGGATCCACTGG + Intergenic
1046621281 8:116531467-116531489 AGGCCCCGTGCGGGATCCACTGG + Intergenic
1047124833 8:121948499-121948521 CGCCCCAGTGCGGGATCCACTGG + Intergenic
1047631628 8:126714575-126714597 GGCCCCAGTGCGGGGTCCACTGG - Intergenic
1048575968 8:135690395-135690417 AGCCCCAGTGTGGAATCCACTGG - Intergenic
1048655344 8:136530390-136530412 GGCCTCAGTGTAGGATCCACTGG - Intergenic
1048899931 8:139027548-139027570 GGCCCCAGGGAAGCATCCAGAGG - Intergenic
1049087562 8:140490454-140490476 AGCCCCAGTGTGGGATCCACTGG - Intergenic
1049157765 8:141077063-141077085 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1049180899 8:141221655-141221677 GGCCCCAGCTCAGGGTGCACCGG + Exonic
1049500386 8:142959899-142959921 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1049588947 8:143446823-143446845 GGCCCCAGTCCAGGCCCCAGAGG - Intronic
1049857997 8:144875550-144875572 GGCCCTGGTGTGGGATCCACTGG + Intergenic
1050455794 9:5832910-5832932 GGCCCGAGCGCAGGAGCCTCTGG - Exonic
1050892076 9:10836379-10836401 GGCCCCCGTGCAGGATCCCTGGG + Intergenic
1050975190 9:11928840-11928862 GGCCCCGGTGTGGGATTCACTGG - Intergenic
1051305013 9:15699982-15700004 AGCCCGGGTGCGGGATCCACTGG - Intronic
1051439928 9:17073025-17073047 AGCCCCCGTGCGGGATCCACTGG + Intergenic
1051449327 9:17178350-17178372 GGCCCGGGTGCGGGATCCACTGG - Intronic
1051459271 9:17294620-17294642 GGCCCCTGTGCGGGATACACTGG - Intronic
1051463873 9:17354358-17354380 AGCCCCGGTGCGGGATCCACTGG + Intronic
1052056606 9:23914397-23914419 GGCCCCAGTGCGGGATCCACTGG - Intergenic
1052075520 9:24135489-24135511 AGCCCCGGTGCAGGACCCACTGG + Intergenic
1052979625 9:34438368-34438390 AGCACCGGTGCGGGATCCACTGG + Intronic
1053027207 9:34740174-34740196 AGCCCCGGTGCGGAATCCACTGG - Intergenic
1053393512 9:37752346-37752368 GGCCCCAGTGCTGGATCCACTGG + Intronic
1054722528 9:68617446-68617468 AGCCCTGGTGCCGGATCCACTGG + Intergenic
1055102496 9:72480177-72480199 AGCCCTGGTGCGGGATCCACTGG - Intergenic
1055248512 9:74275878-74275900 GGCCCCCGTGCGGGATCCACTGG - Intergenic
1055461389 9:76523666-76523688 AGCCCCTGTGTGGGATCCACTGG - Intergenic
1055651445 9:78410417-78410439 AGCCCCAGTGCGGGATCCACTGG + Intergenic
1055814081 9:80185229-80185251 GGCCCTGGTGCTGGATCCACTGG - Intergenic
1055985453 9:82054319-82054341 GGCCCCGGTGCAGGATCCACTGG - Intergenic
1056743823 9:89282847-89282869 AGCCCCAGTGCGCGATCCAGTGG + Intergenic
1056914111 9:90729913-90729935 AGCCCCTGTGCCAGATCCACTGG + Intergenic
1057300774 9:93880331-93880353 GACCCCAGTGCAGGATCCACTGG + Intergenic
1057543788 9:96001657-96001679 AGCCCCGGTGCGGGATCCACTGG - Intronic
1057726983 9:97574596-97574618 GGCCCCGGTGCAGGATCCACTGG + Intronic
1058174796 9:101724053-101724075 AGCCCCGGTGCAGGATCCACTGG - Intronic
1058727604 9:107818224-107818246 GGCCCCGGTGTGAGATCCACTGG + Intergenic
1059791084 9:117642703-117642725 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1059810687 9:117852407-117852429 AGCCCCGGTGTGGGATCCACTGG + Intergenic
1059891377 9:118809197-118809219 CGCCCAGGTGCGGGATCCACTGG - Intergenic
1060091416 9:120746767-120746789 AGCCCGGGTGCGGGATCCACTGG + Intergenic
1060305307 9:122406137-122406159 GGCCCCGCTGCGGGATCCACTGG - Intergenic
1060594157 9:124838671-124838693 AGCCCTGGTGCGGGATCCACTGG - Intergenic
1061529304 9:131197740-131197762 GTCACCAGTGCAGGATCCTCTGG + Exonic
1061929650 9:133825769-133825791 GGCCCCAGGGCAGGATCCAATGG + Intronic
1062146137 9:134990970-134990992 AGCCCCAGTGCGGGATCCACTGG - Intergenic
1062273392 9:135719847-135719869 GGCCCCAGTGCAGGCCTCCCGGG + Intronic
1203460362 Un_GL000220v1:30959-30981 GGCCCTGGTGTGGGATCCACTGG - Intergenic
1203662805 Un_KI270753v1:61342-61364 GGCCCTGGTGCAGGATCCACTGG - Intergenic
1203670561 Un_KI270755v1:7354-7376 GGCCCTGGTGCAGGATCCACTGG + Intergenic
1186152524 X:6690446-6690468 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1186293281 X:8122030-8122052 CGGCCCAGTGCCAGATCCACTGG + Intergenic
1186295581 X:8144909-8144931 GGCCCCAGTGCAGGATCCACCGG - Intergenic
1186323181 X:8452429-8452451 AGCCCCGGTGCGGGATCCACTGG - Intergenic
1187139125 X:16575874-16575896 AGCCCCAGTGCGGGATCCACTGG + Intergenic
1187234285 X:17452416-17452438 GGCCCCACTGCAGGGTCACCGGG - Intronic
1187904084 X:24050114-24050136 AGCCCCGGTGCCGGATCCACTGG + Intergenic
1188112071 X:26205181-26205203 AGCCCCAGTGGGAGATCCACTGG + Intergenic
1188166892 X:26873639-26873661 AGCCCCAGTGCGGGATCCACTGG - Intergenic
1188189597 X:27157425-27157447 AGCCCCAGTGCGGGATCCACTGG + Intergenic
1188242748 X:27809713-27809735 GGCCCCAGTGCGGGATCCACTGG + Intronic
1188881907 X:35499700-35499722 CGGCCCGGTGCAGGACCCACTGG + Intergenic
1189209905 X:39276002-39276024 GGCCCTGGTGCGGGATCCACTGG + Intergenic
1189233704 X:39471755-39471777 TGCCCCAGTGAAAGAACCACAGG + Intergenic
1189896775 X:45664756-45664778 GGCCATGGTGCAGGATCCACTGG - Intergenic
1190045797 X:47110942-47110964 AGCCCAGGTGCGGGATCCACTGG - Intergenic
1190413895 X:50163270-50163292 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1191618570 X:63192511-63192533 AGCCCCGATGCGGGATCCACTGG - Intergenic
1192186824 X:68952536-68952558 AGCCCCAGTGCGGGATCCACTGG + Intergenic
1192251481 X:69417184-69417206 GGCCCCAGTGCGGGATCCACTGG + Intergenic
1192285065 X:69726860-69726882 GGCCCCATGGTAGCATCCACGGG + Intronic
1193040138 X:76996597-76996619 AGCCCCAGTGCGGGATCCACTGG - Intergenic
1193271137 X:79531004-79531026 GGCCCCAGTGCGAGATCCACTGG + Intergenic
1193675640 X:84448382-84448404 GGCCCCAGGGCAGTATACTCTGG - Intronic
1193708899 X:84856584-84856606 CGGCCCGGTGCAGGATCCACTGG - Intergenic
1193803967 X:85972297-85972319 AGCCCTGGTGCGGGATCCACTGG - Intronic
1194025529 X:88746313-88746335 CGGCCTAGTGCAGGATCCACTGG - Intergenic
1194084106 X:89505293-89505315 GGCCAAAGTGAAGGGTCCACAGG + Intergenic
1194384454 X:93236159-93236181 GGCCCCAGTGCGGGATCCACTGG + Intergenic
1195257966 X:103107287-103107309 AGCCCCAGTGTGGGATCCACTGG - Intergenic
1195259301 X:103117049-103117071 TGGCCCTGTGCGGGATCCACTGG - Intergenic
1195259997 X:103122530-103122552 AGCCCCAGTGCAGGCTCCTGGGG - Intergenic
1195460203 X:105115689-105115711 CGGCCCAGTGCGGGACCCACTGG - Intronic
1195664062 X:107412765-107412787 GGCCCCAGAGCAGCTTACACTGG + Intergenic
1195896296 X:109749273-109749295 AGCCCCAGTGAGGGATCCACTGG - Intergenic
1195909535 X:109875833-109875855 GGCTCCTGTGCGGGATCCACTGG - Intergenic
1196319463 X:114270499-114270521 AGCCCCGGTGCCGGATCCACTGG - Intergenic
1196582759 X:117395102-117395124 AGCCCCAGTGCGGGATCCATTGG + Intergenic
1196705838 X:118716875-118716897 AGCCCCAGTGCGGGATCCACTGG - Intergenic
1196860787 X:120025707-120025729 CGCCCAGGTGCGGGATCCACTGG - Intergenic
1197000215 X:121431467-121431489 AGCCCTGGGGCAGGATCCACTGG - Intergenic
1197031171 X:121817999-121818021 TGCCCCACGGCTGGATCCACTGG + Intergenic
1197331106 X:125155407-125155429 AGCCCCAGTACGAGATCCACTGG - Intergenic
1197340117 X:125256056-125256078 AGCCCCAGTGCGAGATCCACTGG + Intergenic
1197376729 X:125690517-125690539 AGCCCCAGTGCGAAATCCACTGG - Intergenic
1197533712 X:127662952-127662974 GGCCCCTGTGCGGGATCCACTGG - Intergenic
1197608013 X:128607046-128607068 GGCCGTGGTGCGGGATCCACTGG + Intergenic
1198084220 X:133267162-133267184 GGCCCTGGTGCAGGAGGCACAGG + Intergenic
1198300056 X:135325876-135325898 AGCCCCGGTGCAGGATCCACTGG + Intronic
1198468175 X:136921785-136921807 GGCCCCGGTGCAGGATCCACGGG + Intergenic
1198534492 X:137573735-137573757 GGCCCCGGCCAAGGATCCACTGG - Intronic
1198694526 X:139321225-139321247 GGCCCCGGTGGGGGATCCACTGG + Intergenic
1198872247 X:141188477-141188499 AGCCCCAGTGCGAGACCCACTGG - Intergenic
1198972519 X:142298184-142298206 AGCCCCTGTGCGGGATCCACTGG - Intergenic
1199050164 X:143228630-143228652 AGCCCCTGTGCGGGATCCCCTGG - Intergenic
1199134102 X:144231190-144231212 AGCCTCGGTGCGGGATCCACTGG - Intergenic
1199356174 X:146866821-146866843 AGCCCCTGTGCGGGATCCACTGG - Intergenic
1199628174 X:149758947-149758969 GGCCCTGGTGCCCGATCCACTGG + Intergenic
1199831727 X:151555130-151555152 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1200097692 X:153671885-153671907 GGTCCCGGTGCACGATCCCCAGG + Exonic
1200436749 Y:3161179-3161201 GGCCAAAGTGAAGGGTCCACAGG + Intergenic
1200512684 Y:4099538-4099560 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1200827688 Y:7660615-7660637 GGACCCAGAGCAGGTTCCCCAGG + Intergenic
1200888740 Y:8299038-8299060 AGCCCCGGTGCGGGATCCACTGG + Intergenic
1201285410 Y:12374948-12374970 AGCCCCTGTGCAAGATCCACTGG - Intergenic
1201422979 Y:13820144-13820166 AGCCCCTGTGCGAGATCCACTGG - Intergenic
1201430557 Y:13897579-13897601 GGTCCTGGTGCAGGATCCACTGG + Intergenic
1201468403 Y:14309665-14309687 GGCCCCAGTGTGGGATCCACTGG + Intergenic
1201469167 Y:14314872-14314894 AGCCCCAGTGCGGGATCCACTGG + Intergenic
1201488226 Y:14513235-14513257 AGCCCCGGTGCTGGATCAACTGG + Intergenic
1201556373 Y:15267675-15267697 GGCCCTGGTGTGGGATCCACTGG + Intergenic
1201715878 Y:17043535-17043557 AGCCCCGGTGAGGGATCCACTGG + Intergenic
1201901041 Y:19046503-19046525 GGCCCCAGTGCCAGATCCGCTGG - Intergenic
1202109908 Y:21407623-21407645 AGCCCCAGTGCGCGATCCACTGG + Intergenic
1202137021 Y:21676602-21676624 AGCCCCGGTGCGGGATCCACTGG - Intergenic