ID: 928107147

View in Genome Browser
Species Human (GRCh38)
Location 2:28477915-28477937
Sequence CTGCAGAAGCAGACTCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 366}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928107147_928107150 -10 Left 928107147 2:28477915-28477937 CCCTTCTGAGTCTGCTTCTGCAG 0: 1
1: 0
2: 4
3: 45
4: 366
Right 928107150 2:28477928-28477950 GCTTCTGCAGGTTCTGTATCTGG 0: 1
1: 0
2: 0
3: 10
4: 207
928107147_928107160 27 Left 928107147 2:28477915-28477937 CCCTTCTGAGTCTGCTTCTGCAG 0: 1
1: 0
2: 4
3: 45
4: 366
Right 928107160 2:28477965-28477987 CCTGCTCCCCTAAACCCTGGAGG 0: 1
1: 0
2: 2
3: 20
4: 216
928107147_928107157 24 Left 928107147 2:28477915-28477937 CCCTTCTGAGTCTGCTTCTGCAG 0: 1
1: 0
2: 4
3: 45
4: 366
Right 928107157 2:28477962-28477984 ATCCCTGCTCCCCTAAACCCTGG 0: 1
1: 0
2: 3
3: 49
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928107147 Original CRISPR CTGCAGAAGCAGACTCAGAA GGG (reversed) Intronic
900780314 1:4613716-4613738 CTGCAGAGTCAAAGTCAGAATGG - Intergenic
900881116 1:5381999-5382021 GTGCATCAGGAGACTCAGAAAGG + Intergenic
903549754 1:24149740-24149762 CTGGAGAAACAGACTCAGAGTGG + Intergenic
904751452 1:32743180-32743202 CTGCAGCAGCAGTCTAGGAAAGG - Intronic
905997416 1:42393214-42393236 CTGTAGAAGCTCACTCAGACAGG - Intronic
906328368 1:44863793-44863815 TTGCAGAAGGATACACAGAACGG - Intronic
906383171 1:45345676-45345698 ATGAAGAAACAGACTCAGAGAGG + Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
907338760 1:53718658-53718680 CTGCAGATGGAGTCTTAGAAAGG - Intronic
908103099 1:60811540-60811562 TTGCAGAAGCATACCCAGAAAGG - Intergenic
909073336 1:71023346-71023368 CTGCAGAGGAATACCCAGAAAGG - Intronic
909111879 1:71489369-71489391 CTGGTGAAGCAGCCTAAGAATGG - Intronic
909257531 1:73443336-73443358 CTCCAGACTCAGACTCAGTAAGG + Intergenic
909546228 1:76851321-76851343 CAGAAGAACCAGGCTCAGAAAGG + Intergenic
910172648 1:84394241-84394263 CTCTAGAGGAAGACTCAGAAAGG + Intergenic
912000219 1:104823729-104823751 CTGCAAATGCAGACTGATAAAGG - Intergenic
912509899 1:110182171-110182193 TTTCAGAAGCAGAGTCAAAAGGG + Intronic
912738664 1:112173683-112173705 CTGCTGAAGCAGAGTGGGAAAGG - Intergenic
912933727 1:113985240-113985262 CTGCAAAGGCAGACACAGAGAGG - Intergenic
914243369 1:145867717-145867739 CTCCAGGAGGAGACTGAGAAAGG + Intronic
914965016 1:152248630-152248652 ATGAGGAAACAGACTCAGAAAGG - Intergenic
915454332 1:156029475-156029497 CTCCTGAAACAGACTCTGAAGGG + Intergenic
915745217 1:158150938-158150960 GAGCAGAAGCACACACAGAAAGG - Intergenic
915853423 1:159352865-159352887 CTTCAGAAGCAGATGCAGATGGG + Intergenic
917712918 1:177705374-177705396 ATACAGAAGCAGACTAAGAAGGG + Intergenic
918125227 1:181577743-181577765 CTGCAGACAGAGACACAGAAGGG - Intronic
919805739 1:201380102-201380124 CTGCAGCTGCAGCCTCAGCAGGG - Intronic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
919983820 1:202659116-202659138 CTGCTGCAGCATTCTCAGAAGGG + Intronic
920793120 1:209111559-209111581 CTGCACAAACAGACTGAGACAGG + Intergenic
920903222 1:210133234-210133256 CTGGAGAATCAGACTCAGTTTGG + Intronic
922490396 1:226011969-226011991 GTGTGGAAACAGACTCAGAAAGG + Intergenic
922677828 1:227563624-227563646 CTGCAGCAGCAGAGTCACCAGGG - Exonic
923248265 1:232154858-232154880 CTGCAGAATCAGGTTCAGCAAGG + Intergenic
924009779 1:239652233-239652255 TTGCAGATTCAGACTCAGTAGGG - Intronic
924334118 1:242969688-242969710 CTGCAGAACCTGACTCTCAAAGG + Intergenic
924690342 1:246343467-246343489 CTGCAGAAGCAGGGTCAAAGAGG + Intronic
1062993354 10:1841510-1841532 GAGCAGAAGCAGCCACAGAAAGG + Intergenic
1065673176 10:28144523-28144545 ATGCAAAAGCAGCCTCAGAACGG - Intronic
1067344530 10:45427995-45428017 CTGCAGAAGCAGAGGGGGAAGGG - Intronic
1067706600 10:48610926-48610948 TTTCAGAAGCAGGCTCAGAGCGG + Intronic
1067842391 10:49691406-49691428 CTGAAGAAGCAAACACAGAATGG - Intronic
1067842533 10:49692334-49692356 CTTCAGAAAGAGACTCAGCAAGG - Intronic
1068033756 10:51735019-51735041 CTGAAGAAGCAGAGTGAGATAGG + Intronic
1068092967 10:52455360-52455382 CTGAAGAAGGTGAGTCAGAAAGG - Intergenic
1068279380 10:54849262-54849284 AAGCAGAAGAAGACACAGAAAGG - Intronic
1069324679 10:67218585-67218607 CTCCAGAATCACACACAGAATGG - Intronic
1070300876 10:75202696-75202718 CCCCAGAAGCAGGCTCAGGATGG - Intergenic
1070827105 10:79397702-79397724 CTGCAGAACCAGATCCAGAGTGG - Intronic
1071119405 10:82260611-82260633 CTAGAGAAGCAGAGTGAGAATGG + Intronic
1071164398 10:82787636-82787658 TTGCAGAAGCAGCCTCAGCATGG - Intronic
1071178587 10:82956449-82956471 AGGCAGAGGCAGGCTCAGAATGG + Intronic
1071200029 10:83211574-83211596 CTGCAGAATCAGAGTCAGGGTGG + Intergenic
1071858601 10:89650151-89650173 CCTCAGCAGCAGCCTCAGAAAGG + Intergenic
1072804431 10:98415611-98415633 CTGCACTGGCAGACTCAGCATGG - Intergenic
1072958623 10:99909084-99909106 CGGCAGACACAGACCCAGAAGGG + Exonic
1073058783 10:100720190-100720212 CTGCAGAAGAGGACACAGGAAGG + Intergenic
1073103553 10:101019523-101019545 AGGCAGAAGCAGAAGCAGAAGGG - Intronic
1073111690 10:101066527-101066549 CCACAGAAGCAGAATCAGAGGGG + Intronic
1073477349 10:103762959-103762981 CTGGAGAAGCTGACCCAGACAGG - Intronic
1075386566 10:122059594-122059616 GTGCAGGAGCAGGCACAGAATGG - Intronic
1076080261 10:127573733-127573755 ATGCAGATCCAGAATCAGAAAGG + Intergenic
1077557302 11:3231813-3231835 CTGCAGGTGCAGACTCTCAAGGG - Intronic
1077731746 11:4738217-4738239 TTGCAGAAGCAGACACAGGAAGG - Intronic
1080196066 11:29610578-29610600 CTGGAAAATCAGACTCAGATAGG + Intergenic
1081346927 11:41999365-41999387 CTGAAGAAGCAGCTTCAGTATGG + Intergenic
1081866926 11:46365292-46365314 CATCAGGAGCAGAGTCAGAAGGG + Intronic
1082740065 11:56901008-56901030 ATGAAGAAACAGACTCACAAAGG + Intergenic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1084192811 11:67506466-67506488 CTGAAGAACCAGACCCAGAAAGG + Intergenic
1084392406 11:68886448-68886470 TTGGAGAAACAGACTCAAAAAGG - Intergenic
1088560070 11:111105707-111105729 CTGAAGAAGCAGATTCACAGGGG - Intergenic
1089807788 11:121106834-121106856 CTGCAGAAGCAGCGTCACACAGG + Intronic
1090432692 11:126659667-126659689 GATCAGAAGCAGAGTCAGAATGG + Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1092023834 12:5224230-5224252 CTGCAGAAGCAAACCCTGACAGG - Intergenic
1094447992 12:30553124-30553146 CTGCAGAAGCAAGCTCAAAGTGG - Intergenic
1095704995 12:45227477-45227499 CTGAAGAAACAGGCTCAGAGAGG - Intronic
1096078668 12:48819638-48819660 CTGCAGAGGAAGCCTCAGCAGGG - Intronic
1096090329 12:48895358-48895380 CTGCAGAAACACATTCAGATAGG + Intergenic
1096452557 12:51756420-51756442 CTGCAGGGGAAGACTCACAAGGG - Intronic
1096479025 12:51925806-51925828 ATGCAGAAACAGACTTACAAGGG + Intergenic
1097949192 12:65408033-65408055 CATCAGAACCAGACTCAGATAGG - Intronic
1098104878 12:67059115-67059137 CTGCAGAAGGTGACTAAGACAGG + Intergenic
1098113093 12:67145019-67145041 TTGCAGAAGAAGAAACAGAAAGG - Intergenic
1098128474 12:67323560-67323582 CTGCAGAAGCAGTGGCAGAGAGG - Intergenic
1098181848 12:67855557-67855579 CTGGGGAACTAGACTCAGAATGG - Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100233475 12:92633742-92633764 CTGCAGGAGCAGTCTCAGGTAGG - Intergenic
1101084080 12:101217434-101217456 AGGCAGAGGCAGACCCAGAATGG + Intergenic
1103040105 12:117687914-117687936 CTGGAGACCCAGGCTCAGAAAGG - Intronic
1103087301 12:118071417-118071439 CAGCAGAAGGAGGCTCACAATGG + Exonic
1104795029 12:131511331-131511353 CAGGAGACACAGACTCAGAAAGG + Intergenic
1105260432 13:18775247-18775269 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1105262637 13:18791101-18791123 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1106477249 13:30109168-30109190 CAGCAGAAGCAGACTCACCTTGG + Intergenic
1111925013 13:94454018-94454040 CTAGAACAGCAGACTCAGAAGGG + Intronic
1113222108 13:108116805-108116827 CTGCAGAAACAAAAACAGAATGG + Intergenic
1113640116 13:111951356-111951378 CTGTAGAAGCTCACCCAGAATGG - Intergenic
1113955259 13:114096974-114096996 GTGGAGGAGCAGACTCAGAGTGG - Intronic
1114027794 14:18544449-18544471 ATGCAAAACCAGCCTCAGAATGG + Intergenic
1114276139 14:21146770-21146792 AAGAAGGAGCAGACTCAGAAAGG + Intergenic
1114370340 14:22079753-22079775 CTGCAGAAACAGAGTCACTAGGG - Intergenic
1115224011 14:31085120-31085142 CTGGCGAAGCAGACATAGAATGG - Exonic
1116630585 14:47326373-47326395 GTGAAGAATGAGACTCAGAAAGG + Intronic
1117181227 14:53193801-53193823 GAGCAGAAGGAGACCCAGAAAGG - Intergenic
1117931158 14:60841607-60841629 CAATAGAAGCAGACTCAGAAAGG - Intronic
1119173607 14:72553292-72553314 CTGCTGGCGCAGAGTCAGAATGG + Intronic
1120877206 14:89385987-89386009 TTGCAGATTCAGACTCACAACGG + Intronic
1122913615 14:104845582-104845604 CTCCAGAAGCAGACTCAGACAGG + Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123155058 14:106216825-106216847 CAGCAGAAGCAGAGACACAAAGG - Intergenic
1123206509 14:106718876-106718898 CAGCAGAAGCAGAGACACAAAGG - Intergenic
1202928419 14_KI270725v1_random:15427-15449 CTGCAGAAGCTGACTAAAATGGG + Intergenic
1123434742 15:20246943-20246965 CTGCATGACCAGACTCTGAAGGG + Intergenic
1123629789 15:22253701-22253723 CCTCAGAAGAAGACTCAGAGTGG - Intergenic
1123798098 15:23794015-23794037 CTGAAGAAGCAGTTTCAGAGGGG + Intergenic
1123829968 15:24125348-24125370 CTGCAGAAGTAGATGCATAATGG - Intergenic
1123844878 15:24289289-24289311 CTGCAGAAGTAGATGCATAATGG - Intergenic
1123860029 15:24455968-24455990 CTGCAGAAGTAGATGCATAATGG - Intergenic
1125222016 15:37349479-37349501 ATGCAGAAGGGGAATCAGAACGG + Intergenic
1127058825 15:55161438-55161460 CCGCAGAAGCATCCTAAGAAGGG - Intergenic
1127764149 15:62168300-62168322 ATGCAGAAACAGGCTCACAAAGG + Intergenic
1128046558 15:64623079-64623101 CTGCAGAAGCAGGTTGAGAAGGG - Intronic
1129673986 15:77622482-77622504 CTGGGGAGGGAGACTCAGAAAGG + Intronic
1129838944 15:78731650-78731672 CTAGAGACGGAGACTCAGAAAGG - Intergenic
1130573003 15:85065737-85065759 CTTCAGAAGCAGACTGAAAATGG - Intronic
1131707811 15:95017420-95017442 CTCCAGAAGCCTACTCAGAATGG - Intergenic
1132265275 15:100464890-100464912 TTGCAGATGCTGACTGAGAATGG + Intronic
1133721445 16:8498233-8498255 CTGCAGAAGCAGAGCGGGAATGG - Intergenic
1135397162 16:22139988-22140010 CTCCTGCAGCAGATTCAGAAGGG - Intronic
1135485184 16:22858717-22858739 ATACAGAAACAGACTCAGAGAGG - Intronic
1136097008 16:27963847-27963869 ATGCAAAGGCAGACTCAGGATGG - Intronic
1136849882 16:33604167-33604189 CTGCATGAGCAGACTCTGAAGGG - Intergenic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137943678 16:52713733-52713755 CTGCAGAATCAGGTTCAGACTGG - Intergenic
1138115490 16:54357518-54357540 CTGCAGAAGACAACACAGAATGG - Intergenic
1141340571 16:83200119-83200141 CTTCAGACTCAGAGTCAGAAGGG + Intronic
1141973353 16:87497055-87497077 CCTCAGAAGAAGACTCAGAGTGG + Intergenic
1203111493 16_KI270728v1_random:1452620-1452642 CTGCATGAGCAGACTCTGAAGGG - Intergenic
1142544889 17:693834-693856 CTTCTGAAGAACACTCAGAAGGG - Intronic
1143032914 17:3977618-3977640 CCTCAGAAGCAGCCTCAGAGTGG + Intergenic
1143618018 17:8064891-8064913 CTGCAGAAACAAAGACAGAATGG - Intergenic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1143931250 17:10428829-10428851 CTGCAGAAGCACACTGAAATAGG + Intergenic
1144049817 17:11488964-11488986 CTTCAGAAACAGACTCATCAGGG - Intronic
1145416428 17:22717178-22717200 CTGCAGGAGCCCACTCAGATGGG - Intergenic
1147306309 17:39566794-39566816 CTCCAGAAGCAGACCCAGAATGG + Intergenic
1154425587 18:14269548-14269570 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154428321 18:14289133-14289155 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154428803 18:14292607-14292629 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154431083 18:14308952-14308974 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433279 18:14324789-14324811 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433753 18:14328261-14328283 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154782414 18:18863401-18863423 AGGCAGAAGCATTCTCAGAAAGG + Intergenic
1155145391 18:23078997-23079019 CTGCAGAGGCAAAGTCAGACAGG + Intergenic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155577016 18:27259270-27259292 CTGCAGAGGCAGTGGCAGAAAGG + Intergenic
1155880767 18:31145496-31145518 CTACAGAAGCATGCTGAGAAAGG + Intronic
1157304739 18:46508744-46508766 CTGCAGCACCAGACTCATAAAGG - Intronic
1157394263 18:47328615-47328637 TTGCAGTATCAGACACAGAATGG + Intergenic
1159182151 18:64922200-64922222 GTGTAGAAGGAGACTCACAAAGG - Intergenic
1159403225 18:67964290-67964312 CTTCAGACTCAGACTCAGACTGG - Intergenic
1160139789 18:76311239-76311261 CTGGAGAAGCAGACACAGCTCGG - Intergenic
1160679368 19:405727-405749 CTGCAACACCAGGCTCAGAAGGG + Exonic
1161115669 19:2495308-2495330 CTGCACAAGCCGGCTCAGAGAGG + Intergenic
1161299699 19:3536837-3536859 CTGCAGAAGCAGCTTCTGAGGGG + Intronic
1161642435 19:5432729-5432751 CACCAGAATCAGAATCAGAAAGG + Intergenic
1161671569 19:5614489-5614511 CAGCAGTACCAGACTGAGAAAGG + Intronic
1162194764 19:8976008-8976030 CTTCAGTAGTTGACTCAGAAAGG + Exonic
1164891692 19:31829063-31829085 TTGCAGCAGGTGACTCAGAATGG - Intergenic
1165824096 19:38695804-38695826 CTGGTGAGGCAGACACAGAAAGG - Intronic
1166491835 19:43267081-43267103 CCCCAGAAGCAGAAACAGAAGGG - Intronic
1166922113 19:46236002-46236024 AAGCATAAGAAGACTCAGAAAGG - Intergenic
925274763 2:2640986-2641008 GAGCAGAAGCAGAGGCAGAAGGG + Intergenic
927408268 2:22796836-22796858 CTGCAGAGGCAGATACAGAAGGG + Intergenic
927528455 2:23770518-23770540 ATGCAGAAGTTGACTCACAATGG - Intronic
927604793 2:24477127-24477149 CTGTAGGAGCAGAGTTAGAAAGG - Intergenic
927825580 2:26307467-26307489 CTACAGAAGCGCACTCAGAAAGG + Intergenic
928107147 2:28477915-28477937 CTGCAGAAGCAGACTCAGAAGGG - Intronic
928174547 2:29024775-29024797 CTGCAGAGGCAGCCTGAGCATGG + Intronic
928191382 2:29173012-29173034 TGGCAGAATCAGACTCACAAAGG - Intronic
928637696 2:33264957-33264979 CTTCAGACTCAGACTCAGACTGG - Intronic
929037653 2:37710026-37710048 CTGCTGAAGAAAACTAAGAATGG + Intronic
929123097 2:38499517-38499539 CTACAGAAGCAGAATCTGTAGGG + Intergenic
931151646 2:59580792-59580814 CTACAGATGGACACTCAGAAGGG + Intergenic
933030748 2:77325841-77325863 CTTCAGAAGCAAACTATGAATGG - Intronic
933522874 2:83394898-83394920 CTGCAGCAATAGACCCAGAATGG + Intergenic
934492365 2:94770267-94770289 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
934540107 2:95166684-95166706 CTGCAAAAGAAGAGTCAAAAGGG + Intronic
934623213 2:95829035-95829057 CTGCAGAAGCAGTGGCAGAGAGG + Intergenic
934810553 2:97273058-97273080 CTGCAGAAGCAGTGGCAGAGAGG - Intergenic
934827139 2:97434881-97434903 CTGCAGAAGCAGTGGCAGAGAGG + Intergenic
935041117 2:99428130-99428152 CTGCAGAGGCAGCCTTAGCAAGG + Intronic
935329590 2:101967094-101967116 TTGAGGAAGCAGACTCAGAGAGG + Intergenic
937827930 2:126388310-126388332 CTGCAGAGGCAGAGACATAATGG + Intergenic
937861353 2:126713951-126713973 CTGAAGATGCAGACTTAGACAGG + Intergenic
937920551 2:127126396-127126418 TTGCAAAAGCTGACTCAAAATGG - Intergenic
937962118 2:127468097-127468119 TTGAAGAAGCAGGCTCAGAAAGG - Intronic
938060476 2:128250748-128250770 CCCCAGGAGCAGACTCAGCAAGG + Intronic
938123136 2:128647680-128647702 CTCCAGAAGCAGAATAAGAGAGG - Intergenic
938282181 2:130072241-130072263 CTGCAGAGGCAGTGGCAGAAAGG + Intergenic
938332808 2:130460813-130460835 CTGCAGAGGCAGTGGCAGAAAGG + Exonic
938357000 2:130659858-130659880 CTGCAGAGGCAGTGGCAGAAAGG - Intergenic
938433436 2:131266664-131266686 CTGCAGAGGCAGTGGCAGAAAGG - Intronic
938477477 2:131629247-131629269 CTGCAGAGGCAGTGGCAGAAAGG - Intergenic
938792058 2:134685173-134685195 CTTCAGAAGCTGACTCAGCCAGG - Intronic
939131396 2:138240026-138240048 TTTCAGCAGCAGACTCTGAAAGG + Intergenic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
941502374 2:166295664-166295686 CGGAAGAGGCAGACTCAGTAAGG + Intronic
943733646 2:191330131-191330153 CTGCAGAAGCACCCTCACAGTGG - Intronic
944355029 2:198777688-198777710 CTTCAGACACAGACTCAGGAGGG + Intergenic
944409236 2:199421095-199421117 CTCCAGAAATACACTCAGAAGGG + Intronic
945239433 2:207662586-207662608 CAGCAGAAACAGACTAAGATGGG + Intergenic
945500528 2:210567680-210567702 CTTCAGAAGAAGACCCAAAAAGG - Intronic
946050404 2:216857500-216857522 CTGCTGAGGCAGACTCAGAAGGG - Intergenic
947592756 2:231394955-231394977 GTGCACAAGCAGACTAATAAAGG + Intergenic
948880891 2:240856616-240856638 ATGCAGCAGCAGGCTCAGCATGG + Intergenic
949044269 2:241863777-241863799 CTGCAGAAGCAGTTTCGGGATGG - Intergenic
949070318 2:242020560-242020582 CTGCAGCTGCAGACCCAGAGAGG + Intergenic
1168957544 20:1844901-1844923 CGGCAGCAGCAGCCCCAGAAGGG - Intergenic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170406492 20:16043334-16043356 CTGCAGCAATTGACTCAGAATGG - Intronic
1170482338 20:16778790-16778812 TTCCAGAAGCAGGCTCTGAAAGG + Intergenic
1170771529 20:19337009-19337031 ATGAAGAAACAGACTCAGAGAGG - Intronic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171519735 20:25766571-25766593 CTGCAGGAGCCCAGTCAGAAGGG - Intronic
1171557185 20:26089922-26089944 CTGCAGGAGCCCAGTCAGAAGGG + Intergenic
1172285313 20:33736253-33736275 TTGCAGAGGCAGTTTCAGAATGG - Intronic
1172963148 20:38812916-38812938 ATGCAGAAACTGACTCAGTAGGG + Intronic
1173725850 20:45297185-45297207 CTCCAGAAACAGACTAAGTAGGG - Intronic
1174619331 20:51862283-51862305 CTGCTGCACCAGCCTCAGAAGGG - Intergenic
1175660433 20:60808020-60808042 CTGCGGAAGCAGACATAGCATGG + Intergenic
1176032561 20:63020617-63020639 CAACAGAAACAGACCCAGAAAGG - Intergenic
1176056883 20:63153503-63153525 CTGCAGCAGCTTACTCAGAGAGG + Intergenic
1176057323 20:63155593-63155615 CAGCAGGAGCAGGCTCAGGACGG + Intergenic
1176590448 21:8644070-8644092 CTGCAGAAGCTGACTAAAATGGG + Intergenic
1176843280 21:13857483-13857505 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176843768 21:13860968-13860990 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176845966 21:13876817-13876839 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
1176846444 21:13880288-13880310 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176848699 21:13896360-13896382 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1178027347 21:28483306-28483328 CATCAGAAGGAGACTCAGGATGG + Intergenic
1178282365 21:31294398-31294420 GTGGAGAAGCAGAGTTAGAAAGG - Intronic
1178661673 21:34511834-34511856 CTGCAGAAGCACATGGAGAAGGG - Intergenic
1179461415 21:41537980-41538002 CTGCAGAAGCAGAGACAGACGGG - Intergenic
1180273276 22:10621103-10621125 CTGCAGAAGCTGACTAAAATGGG + Intergenic
1180451919 22:15471498-15471520 ATGCAAAACCAGCCTCAGAATGG + Intergenic
1180885287 22:19239177-19239199 CAGCAGAAGCAGACTAAAAATGG + Intronic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1181894029 22:26090954-26090976 CTGAAGCAGCAGACCCAGAAGGG - Intergenic
1181982734 22:26777348-26777370 CTGAAGAAACAGAGTCAGAGAGG - Intergenic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182438145 22:30344499-30344521 AAGCAGAAACAGGCTCAGAAAGG - Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1183316964 22:37142180-37142202 CAGCAGGAGCAGAGGCAGAATGG + Intronic
1183321628 22:37168521-37168543 ATGCAGAAACAGGCTCAGAGAGG - Intronic
1184841863 22:47056858-47056880 CTGCAGGGACAGACACAGAATGG + Intronic
1184976604 22:48066758-48066780 CTGCCGAGGCAGACACAGAAGGG - Intergenic
949136834 3:577605-577627 CTGCAGAAGCTGACTAAAATGGG - Intergenic
950601005 3:14035470-14035492 CTGCAGAAGCAGTGGCAGAAAGG + Intronic
951720891 3:25696914-25696936 ATGCAAAAAGAGACTCAGAAAGG + Intergenic
958982631 3:100741184-100741206 CTGTAGAACCAGGCTCAGATAGG + Intronic
960515853 3:118601926-118601948 CTGAAGAAGTATGCTCAGAAAGG - Intergenic
960841572 3:121963896-121963918 CTGCAGAAGCAGTGACAGAGAGG - Intergenic
961128775 3:124446161-124446183 CTGCAGGAGCTCACTCAGGATGG - Exonic
961988117 3:131158689-131158711 CAGCAGCAGCAGAGACAGAATGG - Intronic
962020581 3:131496974-131496996 CTGCAGAAGCAGAGACAACATGG - Intronic
963433390 3:145237610-145237632 CTGGAGAAGGAGAGGCAGAATGG - Intergenic
964837341 3:160954111-160954133 ATGAAGAAACAGACTCAGAGAGG - Intronic
966027053 3:175296913-175296935 CAGGAGCAGAAGACTCAGAATGG + Intronic
966194964 3:177303764-177303786 CTCCAGATTCAGACTCAGACTGG - Intergenic
966565499 3:181376263-181376285 TAGCAAAAGCAGACTGAGAAAGG + Intergenic
966732072 3:183159579-183159601 CAGCAGAAGCAGCCCCAGCAGGG + Intronic
966803496 3:183786674-183786696 CATCAGAAGCAGACCCAAAAGGG - Intronic
968135981 3:196219950-196219972 CTGGACTAGCAGACTCAGAATGG - Intronic
968351015 3:198051924-198051946 ATGCAGAAGCAAGTTCAGAAGGG - Intergenic
968887752 4:3344341-3344363 CTGCTGATGAAGACTCAAAAGGG + Intronic
968961953 4:3750171-3750193 CTGCAGCAGCAGGGACAGAAGGG + Intergenic
969134118 4:5016332-5016354 CAGCAGAAACAGACTAAGACAGG + Intronic
969135044 4:5022511-5022533 CTGCTGAAGGAGCCTCAGAAGGG - Intergenic
970622791 4:17842358-17842380 CTGCTGAAGCCGACTCTGAAAGG + Exonic
971738230 4:30485464-30485486 CTCCTGAACCAGTCTCAGAAAGG - Intergenic
971996483 4:33972253-33972275 CTGCAGAAAAAGGGTCAGAAGGG - Intergenic
974064773 4:57067502-57067524 TTATAGAAGCAGACACAGAATGG + Intronic
976118447 4:81753898-81753920 CAGCACAAACAGACTAAGAAAGG - Intronic
978324610 4:107538170-107538192 CAGCACAAGCAGACTAAGACAGG - Intergenic
979118198 4:116855298-116855320 CTGCATAAGCACACAAAGAAGGG + Intergenic
979194211 4:117900576-117900598 ATACAGAAGCAGACACAGAAGGG - Intergenic
979242993 4:118465592-118465614 CTGCAGAACCTGACTCTCAAAGG - Intergenic
981800653 4:148651980-148652002 CTCCAAAAGCAGGCTCAGAGAGG + Intergenic
982068496 4:151674918-151674940 CTGCAGACGCAGACCCAGGAGGG - Intronic
982113784 4:152080033-152080055 CTGCAGCAGCACAGTCAGCATGG - Intergenic
983867865 4:172789759-172789781 CTTTAGAACCAGAATCAGAAAGG + Intronic
986254252 5:6088544-6088566 CTGCAGCTGGAGACCCAGAAAGG - Intergenic
987465436 5:18266382-18266404 ATGCATAAGCATACCCAGAATGG - Intergenic
988536271 5:32072101-32072123 CAGCAGAAGCAGACTTTCAAGGG - Intronic
988949760 5:36244284-36244306 ATGCAGAAGTAGTCTCAGGAAGG - Intergenic
992550440 5:77854845-77854867 CTGCAAAAGCTTTCTCAGAATGG + Intronic
992553651 5:77882991-77883013 CTGCAGAGGCAGATTCTGCAAGG - Intergenic
992643036 5:78785899-78785921 CTGCAGAAGAAGGGTCAGAGAGG + Intronic
993189349 5:84661525-84661547 ATGTAGAAACAGGCTCAGAAAGG + Intergenic
994473414 5:100238433-100238455 CTGCAGAAGCAGTAGCAGAGAGG + Intergenic
995396062 5:111688479-111688501 CTGCAAAGGCAAACTCAGACAGG - Intronic
995808988 5:116084382-116084404 CTGCAGATGCAGATACAGGAGGG + Intergenic
997376884 5:133403745-133403767 CTGGAGAAGCAGAGTTGGAAGGG + Intronic
998043758 5:138970135-138970157 TTGCAGAAGCAGAGGCAGAGAGG + Intronic
999052172 5:148534544-148534566 CTGCAGAAGCAGTGGCAGAGAGG - Intronic
1000483720 5:161812352-161812374 CTGAAGAATCAGAGTCTGAAGGG + Intergenic
1001741022 5:174052725-174052747 GTGCAGAAACAGGCTCAGACAGG + Intronic
1001787169 5:174423775-174423797 CTGCAGAAGCCGACTTGCAAAGG + Intergenic
1004069782 6:12288053-12288075 CTGCAGGGGCAGCCTCAGCAAGG + Intergenic
1004140824 6:13015170-13015192 CTTCAGAGGCCGACTAAGAACGG - Intronic
1004444124 6:15682165-15682187 TTGAAGAAACAGGCTCAGAATGG - Intergenic
1004804305 6:19185346-19185368 TTGAAGAAGCACACTGAGAAAGG + Intergenic
1006749518 6:36367815-36367837 CTGGGGAAGCAGACTCAGAGAGG - Intronic
1006787146 6:36676208-36676230 CTGCAGAAGCTGCCTAGGAAGGG - Intergenic
1006969328 6:38024762-38024784 CTGTAGAGGTAGACTCAGATTGG + Intronic
1007643636 6:43363748-43363770 GTGCAGAAGCAGACCCACACTGG + Intronic
1008383243 6:50857472-50857494 CTGATGAAGCAGATTCAGAGAGG - Intergenic
1010415903 6:75611161-75611183 CCACAGAAGCAGAGTCAGCAGGG - Intronic
1011063170 6:83294616-83294638 CTGCAGAGGCAGTGGCAGAAGGG - Intronic
1011321840 6:86104297-86104319 CTGCTTCAGCAGACTCAGATGGG + Intergenic
1013295110 6:108751975-108751997 CTGGAAAAGCAGCCCCAGAATGG - Intergenic
1014609940 6:123529934-123529956 CAGCAGAAGCAAATTAAGAAAGG - Intronic
1014701560 6:124695254-124695276 TTTCAGAAGCAGAGGCAGAAAGG - Intronic
1014708301 6:124775305-124775327 CTGCAAAAGAAGGTTCAGAATGG - Intronic
1015386795 6:132633750-132633772 CTGCAGGAGCAAAAACAGAAAGG + Intergenic
1016417366 6:143847037-143847059 TTGCTTAAGGAGACTCAGAAAGG + Intronic
1016811772 6:148267798-148267820 CTGCAGAATCAGCCTTCGAAGGG + Intergenic
1017594803 6:156016935-156016957 CCGCAAAAGCAGACTCAGGTTGG + Intergenic
1017658872 6:156654893-156654915 CTGCAAGATCAGACACAGAAAGG + Intergenic
1018024582 6:159794368-159794390 CTGCAGAAACTAACACAGAAAGG - Intronic
1018755032 6:166841645-166841667 CTGCAGAGGCTGAGTCAGAAAGG + Intronic
1020492323 7:8802917-8802939 CAGCATAAACAGACTAAGAATGG - Intergenic
1020503847 7:8958239-8958261 CTGAAGATGCAAACTAAGAAGGG - Intergenic
1022092207 7:27115015-27115037 CTTCAGAAGCAAACTCTGCAAGG + Intronic
1022146818 7:27551923-27551945 CTACAGATGCAGCCTCACAAGGG + Intronic
1022148500 7:27573080-27573102 CTGCAAAAGCAAACGCATAAAGG + Intronic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1024287947 7:47776478-47776500 CTCCAGCAGCTGACTCAGCATGG + Intronic
1026363537 7:69625177-69625199 TAGCAGAAGCGGACTCAGAAAGG + Intronic
1028176952 7:87671300-87671322 CTGCAGCGGCAGTCTCAGAGAGG + Intronic
1029104788 7:98166087-98166109 CAGCCGAGGCAGACTCAGCAAGG - Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030928700 7:115494113-115494135 CAGCAGAATCAAACTCAGTAGGG - Intergenic
1032674037 7:134111626-134111648 TTGCATAAGCAGACTCAGATGGG - Intergenic
1033071194 7:138203978-138204000 CAGAACATGCAGACTCAGAAGGG + Intergenic
1033809528 7:144994915-144994937 CTGCAGAAACAGAATCGGAAAGG + Intergenic
1034227673 7:149496484-149496506 CTGCAGAGAGAGACTAAGAAGGG - Intronic
1035486160 7:159227746-159227768 CTACAAAAGAAGACTCAGAAAGG - Intergenic
1035644352 8:1206783-1206805 CTGCAGGTGCAGACAAAGAATGG - Intergenic
1037565097 8:20111315-20111337 CTGAAGAAACAGACTCTGATGGG + Intergenic
1037747644 8:21659680-21659702 CTGCAGAAGGAGACAGGGAAGGG - Intergenic
1038290415 8:26244273-26244295 GTGAGGAAACAGACTCAGAAAGG - Intergenic
1039597232 8:38801370-38801392 ATGCAGAAACTGACTCAAAATGG - Intronic
1039634065 8:39144019-39144041 CTGCTGAGGCAGACACAGGAGGG + Intronic
1040416231 8:47198324-47198346 CTGCAGACGCAGACTCACATGGG + Intergenic
1041176662 8:55203781-55203803 CTGCAGAAAATGACTCATAAAGG + Intronic
1041613295 8:59876118-59876140 CTTCAGAACCACACTCAGATAGG + Intergenic
1042187617 8:66152633-66152655 CTGTAGAAAGAGACTCAGGAGGG - Intronic
1042351107 8:67778641-67778663 CTGCAGTAGCTGCATCAGAATGG + Intergenic
1042836213 8:73081105-73081127 GTGCAGCAGGAGCCTCAGAACGG - Exonic
1043671815 8:82895873-82895895 CTGCAGAATCAGGATCAGAGGGG + Intergenic
1044857701 8:96493670-96493692 CCGGAGAAGCAGGCTCAGGAGGG + Exonic
1044911917 8:97068786-97068808 ATGAAGAAACAGACTCATAAGGG + Intronic
1044927899 8:97224691-97224713 CTGCAGAAGCAGCGGCAGAGGGG - Intergenic
1046958877 8:120088819-120088841 GTGCAGAAGCACACACACAATGG - Intronic
1047559585 8:125972271-125972293 CTGCAGAGGCAGCCCCAGCATGG - Intergenic
1048068567 8:130998475-130998497 TTTCAGAAGCAGACTCTGAAAGG + Intronic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1050447589 9:5741760-5741782 TGGCAGAAACAGACTCAGAAAGG - Intronic
1051550922 9:18328549-18328571 CTGAAGAAACATACCCAGAAGGG + Intergenic
1052236499 9:26217459-26217481 ATGCAGAAGCAGGCACAGGAAGG + Intergenic
1052747818 9:32458006-32458028 CTAAAGAAGCAGACTTAGAAAGG + Intronic
1052879869 9:33594927-33594949 ATGTAGAAGCAGTTTCAGAAGGG + Intergenic
1053496110 9:38549293-38549315 ATGTAGAAGCAGGTTCAGAAGGG - Intronic
1053665650 9:40315683-40315705 ATGTAGAAGCAGGTTCAGAAGGG + Intronic
1053858828 9:42364875-42364897 CTTAAGAAGCAGACGCAGTATGG - Intergenic
1053915233 9:42940730-42940752 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054376806 9:64455713-64455735 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054518964 9:66060601-66060623 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1055553710 9:77454632-77454654 CTAAAGAAACAGTCTCAGAATGG - Intronic
1056813016 9:89778831-89778853 CAGCAGAAGCGGGCTCTGAACGG + Intergenic
1057061529 9:92008146-92008168 CTGCAGTAGCAGTTTCAGAGAGG + Intergenic
1057676033 9:97136811-97136833 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1059449218 9:114359795-114359817 CTGCAGAAGAACACACAGAGGGG + Intronic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1060833450 9:126735318-126735340 CATCAGAAGTAGACTCAGCATGG + Intergenic
1062357989 9:136174049-136174071 CTGAGGCTGCAGACTCAGAAAGG + Intergenic
1203620454 Un_KI270749v1:122735-122757 CTGCAGAAGCTGACTAAAATGGG + Intergenic
1185961922 X:4553789-4553811 CTGCAGAGAGATACTCAGAAAGG - Intergenic
1186454629 X:9701408-9701430 CTGCAGGAGCTGACTCAGAGTGG + Intronic
1186687913 X:11944865-11944887 CAGCAGTAGCACACTGAGAATGG - Intergenic
1186715970 X:12251681-12251703 CTCTAGAAGCAGACACTGAAAGG - Intronic
1186808942 X:13167954-13167976 ATGCAGAAGGACATTCAGAACGG - Intergenic
1187276222 X:17818427-17818449 CTCCAGTAGCAGCCTCAGGATGG - Intronic
1188670628 X:32877850-32877872 CTGCAGAACCAGACTGAGGCTGG + Intronic
1191122991 X:56925609-56925631 CTGCAGAGGCAGTGGCAGAAGGG + Intergenic
1191922503 X:66271410-66271432 CTGCAGAGGCAGTGGCAGAAAGG - Intergenic
1192275302 X:69623769-69623791 GTGGAGAAGCAGACCCAGAGGGG + Intronic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1195086057 X:101415752-101415774 CTGGCTAAGAAGACTCAGAAGGG + Intergenic
1196409847 X:115406785-115406807 CTGCAGAAACAGAGCCACAAAGG - Intergenic
1197324393 X:125074324-125074346 CTGGGGAAGCAGACCCAGAGTGG - Intergenic
1198554719 X:137780831-137780853 CTGCAGAACCAGAGAAAGAAAGG - Intergenic
1199692862 X:150321905-150321927 CTGCAGGAGCAGACCAAAAAAGG + Intergenic
1200279790 X:154767163-154767185 CTGCAGCAGCCGACTGAAAAGGG - Intronic
1201717130 Y:17057530-17057552 TTGCAGGAACAGACACAGAAAGG - Intergenic
1201751596 Y:17437796-17437818 CTGCAGAGAGATACTCAGAAAGG - Intergenic
1202390718 Y:24367694-24367716 CTGCAGAACCTGACTCTCAAAGG - Intergenic
1202480066 Y:25302422-25302444 CTGCAGAACCTGACTCTCAAAGG + Intergenic