ID: 928109838

View in Genome Browser
Species Human (GRCh38)
Location 2:28497698-28497720
Sequence GAGAATATACAAATGGACAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 729
Summary {0: 1, 1: 3, 2: 26, 3: 109, 4: 590}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928109838_928109840 7 Left 928109838 2:28497698-28497720 CCGTTGTCCATTTGTATATTCTC 0: 1
1: 3
2: 26
3: 109
4: 590
Right 928109840 2:28497728-28497750 TTTTTTTTTGAGACAGAGTCTGG 0: 996
1: 2879
2: 4518
3: 4666
4: 4860
928109838_928109841 21 Left 928109838 2:28497698-28497720 CCGTTGTCCATTTGTATATTCTC 0: 1
1: 3
2: 26
3: 109
4: 590
Right 928109841 2:28497742-28497764 AGAGTCTGGCTGTGTCACCCAGG 0: 27
1: 1437
2: 23020
3: 85918
4: 159719
928109838_928109842 25 Left 928109838 2:28497698-28497720 CCGTTGTCCATTTGTATATTCTC 0: 1
1: 3
2: 26
3: 109
4: 590
Right 928109842 2:28497746-28497768 TCTGGCTGTGTCACCCAGGCTGG 0: 101
1: 4838
2: 61337
3: 151742
4: 185728

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928109838 Original CRISPR GAGAATATACAAATGGACAA CGG (reversed) Intronic
900492433 1:2958940-2958962 CAGGATAGACACATGGACAAAGG + Intergenic
901266834 1:7917337-7917359 CAGGATAGACAAATTGACAATGG + Exonic
901587540 1:10310496-10310518 GACAATATGGAAATGAACAAGGG + Intronic
902356953 1:15910246-15910268 GGTAATTTAGAAATGGACAAGGG + Intronic
902720248 1:18299473-18299495 GAAAATATACAGAGGGAGAAGGG - Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
902825134 1:18967944-18967966 AAAAATAGACAAATGGACCAAGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904990276 1:34586988-34587010 GGGAATATACTAATGAGCAAAGG - Intergenic
905248810 1:36634027-36634049 GAAGATATACAAATGGTCAATGG - Intergenic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
905960622 1:42039650-42039672 GAGAATAAAGAAATGGATACTGG - Intergenic
906549176 1:46647953-46647975 GAGGATAGACAAATGGACAAAGG - Intronic
907514365 1:54984015-54984037 GAGAATGTACACATGTAAAAGGG - Intronic
908554379 1:65242934-65242956 GAGAATATACAAAACAACATTGG - Intergenic
908744899 1:67367083-67367105 GAGGCTATAGAAATGGAAAAAGG + Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909587363 1:77305113-77305135 GACAATATACAAATGGCAAACGG - Intronic
910092739 1:83484504-83484526 GAGAATAGACAAATCTACCAAGG + Intergenic
910196584 1:84647529-84647551 GAGAATGTACAAATCAAAAATGG - Exonic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
910403143 1:86856840-86856862 GAGAATATTAAAATGAACATTGG + Intergenic
910645769 1:89513567-89513589 AAAAATGGACAAATGGACAAAGG - Intergenic
911096997 1:94062756-94062778 GAGAAGACACAGAGGGACAAAGG + Intronic
911584337 1:99672952-99672974 CAGATGATACAAATGGGCAAAGG + Intronic
911963746 1:104339009-104339031 GATGACATACAAATGGCCAATGG - Intergenic
912171497 1:107106030-107106052 GAAAGAATACAAATGGAAAAAGG - Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
913390482 1:118305492-118305514 TAAAATTTACAAATGTACAAAGG - Intergenic
913503512 1:119494286-119494308 GAGAATATACAAATAAACGGTGG + Intergenic
913665922 1:121048845-121048867 CAGAATATACAATCGAACAATGG + Intergenic
914017320 1:143832121-143832143 CAGAATATACAATCGAACAATGG + Intergenic
914399462 1:147304182-147304204 AAGAATAAAAAAGTGGACAAAGG + Intergenic
914655931 1:149740653-149740675 CAGAATATACAATCGAACAATGG + Intergenic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
915611129 1:156993863-156993885 GAGAATAGACAAATGGTCTCTGG + Intronic
916082891 1:161247072-161247094 GAATATAAACAAATGGAGAATGG - Intergenic
916294994 1:163208616-163208638 AAAAATAAAGAAATGGACAAGGG + Intronic
916477244 1:165181982-165182004 CAGGATATATAAATAGACAAAGG + Intergenic
916585539 1:166146644-166146666 GCGAATATACAATGGGTCAAGGG + Intronic
916733632 1:167587938-167587960 GATGACATACAAATGGCCAATGG + Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918749492 1:188255084-188255106 GAAGATATACAAATGGCCAATGG - Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919102431 1:193111001-193111023 GACAATATACAAATGGGAAATGG - Intergenic
919333110 1:196196580-196196602 GAGAATATACAAATGCACATAGG - Intergenic
919523391 1:198617373-198617395 TAGGATATCCAAATGGCCAATGG + Intergenic
920273080 1:204781689-204781711 AAGATTATACAAATAGTCAATGG + Intergenic
921457248 1:215386833-215386855 GAAAATATACATATACACAATGG + Intergenic
921694891 1:218197685-218197707 GAAAATATTTAAATGGAGAAAGG + Intergenic
921762765 1:218936303-218936325 AAGAATTTAAAAATGAACAAAGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923386307 1:233468104-233468126 GGGATTAGACAAATGGACATAGG + Intergenic
923922564 1:238584121-238584143 GAGACTAAAGAAAAGGACAAGGG + Intergenic
924049035 1:240061787-240061809 CAGAATAAACAAACAGACAATGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924495034 1:244579664-244579686 AAAAATATACAAATGACCAATGG + Intronic
1063539954 10:6922178-6922200 GAGAATATACTAAAGGAATAAGG - Intergenic
1063597258 10:7447194-7447216 AATAAAAAACAAATGGACAAAGG - Intergenic
1064336491 10:14448102-14448124 GTGAATAAGCAAATGAACAAGGG + Intronic
1066283989 10:33946075-33946097 GAGAAAATCCAAGTGGAAAATGG - Intergenic
1066466535 10:35655440-35655462 GAGAAAAAAAAAATGGACAAAGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066785529 10:39000033-39000055 GAGAATATACAAAGGGACATTGG - Intergenic
1066791176 10:39065495-39065517 GAGAATCTGCAAAGGGACACTGG - Intergenic
1067854757 10:49782748-49782770 GAGAACATAAAAAAAGACAATGG + Intergenic
1068008248 10:51415817-51415839 GAAAATATTAAAATGGACATAGG - Intronic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069830800 10:71281318-71281340 CAAAATATAAAAATGGAAAAAGG + Intronic
1070231993 10:74578102-74578124 GAAAATATATAAAAGGACATTGG + Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1072809529 10:98448036-98448058 GACAATTTAAAAATGGATAAAGG - Intergenic
1073713029 10:106067300-106067322 GAAGACATACAAATGGCCAAAGG + Intergenic
1074674245 10:115830150-115830172 GTGGATATACAAGTGAACAAAGG + Intronic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1077345225 11:2045245-2045267 GAGAATGGAAAAATGGAGAATGG - Intergenic
1077571627 11:3344247-3344269 AAGAAAATACAAATTCACAATGG + Intronic
1077767329 11:5173842-5173864 GAAGATATACAAATGAACATTGG + Intronic
1079379326 11:19923324-19923346 GAGAATATCCTAAAGGATAATGG - Intronic
1079549637 11:21678258-21678280 AAAAACATACAAATGGCCAAAGG - Intergenic
1080237363 11:30086618-30086640 AAAAATATACAAACAGACAATGG - Intergenic
1080972532 11:37295505-37295527 CACAATTTAAAAATGGACAAAGG - Intergenic
1080980485 11:37398267-37398289 AAGGATCTACAAATGGTCAAGGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1082128568 11:48459835-48459857 GGGAAAATACATAAGGACAAGGG - Intergenic
1082753090 11:57043756-57043778 GAAGACATACAAATGGCCAATGG + Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1083090587 11:60195322-60195344 AGGAATATACTAATGGAGAAAGG - Intergenic
1083210203 11:61179481-61179503 AGGAGGATACAAATGGACAACGG - Intergenic
1084336897 11:68463478-68463500 GAAAATATAGAACTAGACAATGG - Intronic
1084467373 11:69333925-69333947 GCAAATGGACAAATGGACAAAGG - Intronic
1085348927 11:75785846-75785868 GAGAAAATGCAAATTCACAAAGG + Intronic
1085980853 11:81722935-81722957 AAGGATATCCAAATGGAAAAGGG + Intergenic
1086085245 11:82946386-82946408 AAGAACATACAATTGGAAAAGGG + Intronic
1086158092 11:83690730-83690752 GACTATATAAAAATGGACAGTGG - Intronic
1086497173 11:87416307-87416329 GAATATATACAAATGGCTAATGG + Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086971137 11:93082351-93082373 GAGAATATAGCCATGAACAAAGG + Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087342447 11:96924484-96924506 GAAGACATACAAATGGCCAACGG + Intergenic
1087456716 11:98395979-98396001 CAGAATATAGATATGGGCAAAGG + Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1088306707 11:108417714-108417736 GAGAATGAACACATGGACACAGG + Intronic
1088340785 11:108763925-108763947 CAGAAAATACAGATTGACAAAGG + Intronic
1088853610 11:113726121-113726143 GAGAATATGTAACTGGCCAAAGG + Intergenic
1089080034 11:115767919-115767941 GAGAATATCCAAAAGTACAATGG - Intergenic
1089955885 11:122570547-122570569 AAGAACATACAAAGGCACAAAGG - Intergenic
1090200369 11:124850245-124850267 GAAGACATACAAATGGTCAATGG + Intergenic
1090481325 11:127071216-127071238 GAAAATATAGCAGTGGACAATGG - Intergenic
1092422030 12:8339826-8339848 GAGAATGTATAAATGGAGAGAGG - Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093646964 12:21597407-21597429 GAAGACATACAAATGCACAATGG + Intronic
1093689076 12:22089144-22089166 GAGAATGTACAAATAGACTTGGG - Intronic
1094612553 12:32008316-32008338 GAAGATACACAAATGGCCAACGG + Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095721960 12:45410411-45410433 AATAATATAAAAATGGACCAAGG - Intronic
1095724033 12:45432860-45432882 GGCAATATGTAAATGGACAATGG + Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1097168000 12:57095922-57095944 GAGACTATGCAAAAGTACAAGGG - Exonic
1097374702 12:58827687-58827709 GAAGACATACAAATGGCCAATGG + Intergenic
1097478783 12:60094164-60094186 TAGATTATACAGATTGACAAAGG + Intergenic
1097807184 12:63978984-63979006 GATGATATACAAATGGCAAATGG - Intronic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098079306 12:66766918-66766940 GAGAATGAACAAATGGATAAGGG + Intronic
1099889709 12:88576153-88576175 TAGAAAATAGAAATGGAAAATGG - Intronic
1100107844 12:91198857-91198879 GAAAATATACAAATGGCCAATGG - Intergenic
1100925563 12:99543794-99543816 CAGAATAGACAAATTGATAAAGG + Intronic
1101632422 12:106508195-106508217 GAGAATATGCAAATGTCCACTGG - Intronic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1102591752 12:113961406-113961428 AATAATATACAAAAGTACAATGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104114874 12:125739675-125739697 AAGAATCTACAAATGTAGAATGG + Intergenic
1104348518 12:128024628-128024650 GAAAATAAATAAAAGGACAAGGG + Intergenic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104703751 12:130927087-130927109 GAGAATATACTTCTGGAGAATGG - Intergenic
1106309025 13:28536649-28536671 TAGTGTATACAAGTGGACAAAGG + Intergenic
1106373219 13:29157943-29157965 GACAAAATAGAAATGGAGAAAGG + Intronic
1106733863 13:32569687-32569709 GATGACATACAAATGGCCAACGG - Intergenic
1106863054 13:33932163-33932185 TAGAATAGACAGATGAACAATGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106928482 13:34637769-34637791 GGGAATATATAAATGTGCAACGG - Intergenic
1106963633 13:35032781-35032803 GAAGATATACAAATGGCAAATGG - Intronic
1107006141 13:35614126-35614148 GAAGACATACAAATGGCCAATGG - Intronic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107387208 13:39924978-39925000 AAGAATATACAAATATACAAGGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108463904 13:50695273-50695295 GAAAATACACAAATGGACAATGG + Intronic
1108956105 13:56159352-56159374 GAGAGTAGAATAATGGACAAGGG + Intergenic
1109376822 13:61506280-61506302 GAAAACATACAAATGGCTAATGG + Intergenic
1109405161 13:61888139-61888161 GAAAATATACAATTAGACAATGG + Intergenic
1109550920 13:63898877-63898899 CAAAATTTAAAAATGGACAAAGG + Intergenic
1109574360 13:64233479-64233501 GAAAATTTACAAATGACCAACGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109900658 13:68765036-68765058 GATGACATACAAATGGCCAAAGG + Intergenic
1109919603 13:69038768-69038790 GAAATTATAAATATGGACAATGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1109991220 13:70060134-70060156 GAAGATATACAAATGGAAACAGG + Intronic
1110427673 13:75387273-75387295 AAGTATATATAAATGGAAAAGGG + Intronic
1110634544 13:77751549-77751571 GAGAAGGAACAAATGAACAAGGG - Intronic
1111077692 13:83259985-83260007 GAAGACATACAAATGGCCAATGG + Intergenic
1111167409 13:84478121-84478143 AAGACTATACAAATGACCAAAGG + Intergenic
1111291280 13:86173372-86173394 GAGTATATACAAAGGCAGAATGG + Intergenic
1111385362 13:87520614-87520636 GAGAATAGACTAATGTATAAGGG + Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112133486 13:96549958-96549980 GAGAACATACAATGTGACAAGGG - Intronic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114394557 14:22345292-22345314 GAGAATATTCAATGGCACAAAGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115095066 14:29625007-29625029 CAGAAAATAGAAATGGAAAATGG + Intronic
1115096325 14:29640554-29640576 GAGATTATAAAAATAGCCAAAGG + Intronic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115189227 14:30729060-30729082 AAAAATGGACAAATGGACAAAGG - Intronic
1115483046 14:33881127-33881149 GAGAATATAAAGCTGGATAAGGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116360168 14:43984201-43984223 GAGAAAATATAAAAGGAAAATGG - Intergenic
1117199297 14:53372007-53372029 AAGAATATAAAGATGGAAAAAGG + Intergenic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1118497316 14:66320933-66320955 GAAGACATACAAATGGCCAATGG + Intergenic
1119014059 14:71031192-71031214 GCAAATATGCAAATGGAGAAGGG + Intronic
1119451603 14:74716636-74716658 GGGGATATACAAATACACAAGGG - Intronic
1119497236 14:75090344-75090366 GAGAAAATACAAATGGGCAAAGG + Intronic
1120351178 14:83360704-83360726 GAGAATAAACATAAAGACAATGG - Intergenic
1120382558 14:83799712-83799734 GGGAAGATAAAAGTGGACAACGG - Intergenic
1120727282 14:87959185-87959207 GAAGACATACAAATGGCCAATGG + Intronic
1120929682 14:89836140-89836162 GAGAAAACACAGATGGTCAAGGG + Intronic
1121188880 14:92005820-92005842 GAGACTCTAAAAATGGAAAAAGG - Exonic
1121530949 14:94653080-94653102 GAATACATACAAATGGCCAACGG + Intergenic
1121780838 14:96621433-96621455 GAGAATATATAGATGAAAAATGG - Intergenic
1124156824 15:27233299-27233321 GAGCATAAAAAAGTGGACAAGGG + Intronic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124474967 15:30025386-30025408 GGAAATATACAAATATACAAGGG - Intergenic
1124640749 15:31394704-31394726 GTGAATATACTAAAGGCCAATGG - Intronic
1126495388 15:49284299-49284321 GAAGATATACAAAGGGACATAGG + Intronic
1126880980 15:53097206-53097228 GAAGACATACAAATGGCCAATGG - Intergenic
1126961804 15:54004783-54004805 GAATATATACAAACGGAAAATGG - Intergenic
1127173737 15:56330946-56330968 GAAAATAAAGAAATGGAAAAAGG + Intronic
1127390671 15:58502745-58502767 GAGAATGTACAAAATGAGAAAGG + Intronic
1129127703 15:73458700-73458722 GGGGATAAAGAAATGGACAAAGG + Intronic
1130702379 15:86197601-86197623 GAGAAGAAAGAAATTGACAAAGG + Intronic
1130759250 15:86800815-86800837 GAGAATAAAGAAATGGAGACTGG + Intronic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1132393922 15:101458581-101458603 GAGAAGATACACATGGTGAAAGG - Intronic
1133376261 16:5289748-5289770 GAGAATGTATAAATGGAGAGAGG + Intergenic
1133920066 16:10144484-10144506 GACAATTAAAAAATGGACAAAGG - Intronic
1134781633 16:16903399-16903421 GAAGACATACAAATGGCCAATGG - Intergenic
1135277420 16:21125587-21125609 GAGAATACCCAAATGGAAAGGGG + Intronic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1135789659 16:25382002-25382024 GAGGATATCCAAATGGCCAAAGG + Intergenic
1137914900 16:52419307-52419329 GAGAATATCCAAAGGAAGAAGGG - Intergenic
1138197882 16:55067404-55067426 GAGAAAATTCACATGGACATGGG - Intergenic
1138318730 16:56092734-56092756 GAGAATTTACACATGGTCCAGGG + Intergenic
1139724486 16:68886209-68886231 GAAAAAAAAAAAATGGACAAAGG - Intronic
1140637934 16:76938596-76938618 AGGAACACACAAATGGACAATGG + Intergenic
1140694630 16:77520491-77520513 CAGAAGATACTAATGAACAAAGG + Intergenic
1140716519 16:77730910-77730932 AAAAATTTAAAAATGGACAAAGG - Intronic
1140876794 16:79160154-79160176 GAGAACATCCAAATGAACACTGG + Intronic
1141182943 16:81766699-81766721 GAGGATATAAGAATGGACAAGGG - Intronic
1203018955 16_KI270728v1_random:381994-382016 GAAGACATACAAATGGCCAACGG + Intergenic
1203037290 16_KI270728v1_random:655152-655174 GAAGACATACAAATGGCCAACGG + Intergenic
1142909280 17:3073185-3073207 GAAAATATAAAAAAGGACATTGG - Intergenic
1142925280 17:3231053-3231075 GAAAATATAAAAAAGGACATTGG + Intergenic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1144061611 17:11587940-11587962 CAAAATAGACAAATGAACAATGG + Intergenic
1144095388 17:11895725-11895747 CAAATTATACAAATGGAGAATGG - Intronic
1145183893 17:20777547-20777569 GAAGATATGCAAATGGACAATGG - Intergenic
1145446063 17:23175636-23175658 TAGAATCTACAAGTGGACATTGG + Intergenic
1146817806 17:35957729-35957751 AAGAATACACAAATGGATTAAGG - Intergenic
1148324516 17:46775473-46775495 CAAAATAAACAAATGGAAAAAGG - Intronic
1148525058 17:48324107-48324129 GAAAATATAGAAAAGCACAAAGG + Intronic
1150114247 17:62531151-62531173 GATAATATTCAAAGAGACAATGG - Intronic
1150214284 17:63457986-63458008 TAGAATAAATAAATGGACTAGGG + Intergenic
1150577118 17:66440342-66440364 GAGAAGAAACAAATGAACATTGG - Intronic
1153016650 18:588472-588494 GAAGACATACAAATGGCCAATGG - Intergenic
1153425519 18:4959204-4959226 GAAGATATAAAAATGGCCAATGG + Intergenic
1153611130 18:6886304-6886326 AAGAAAATACAGAGGGACAAAGG + Intronic
1153783988 18:8517962-8517984 CAGAACAAAAAAATGGACAAAGG + Intergenic
1153815332 18:8785812-8785834 AAGAAAACAAAAATGGACAAGGG - Intronic
1154137557 18:11793621-11793643 AATAATTTAAAAATGGACAAAGG + Intronic
1154279084 18:12985208-12985230 GACATAATACAAATGGAAAAGGG - Intronic
1155265766 18:24091785-24091807 GCCAATTTAAAAATGGACAATGG + Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155983957 18:32209996-32210018 GAGAATATGAAAAAGGAAAATGG - Intronic
1156224695 18:35092805-35092827 GAAAACATACAAATGGCCACAGG + Intronic
1156625849 18:38907588-38907610 GACAAAATACGAATGGGCAAAGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157530633 18:48417802-48417824 TAGAACAGACAAATGCACAAAGG + Intergenic
1158091617 18:53721261-53721283 GGGAATATACAAAGGCACAGTGG - Intergenic
1158152753 18:54390870-54390892 CAGAAAATACAAATTGCCAAAGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158174102 18:54634637-54634659 GAGAACAAACACATGGACACAGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158820650 18:61154802-61154824 GAGAACACACAAGTGAACAAGGG - Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159149246 18:64498812-64498834 GAGAATATCCAAGTCTACAAGGG + Intergenic
1159262194 18:66028633-66028655 GGGAATTGACAGATGGACAAAGG + Intergenic
1159340779 18:67129904-67129926 GCAAACATAAAAATGGACAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159710827 18:71757485-71757507 GAAGATATACAAATGGCAAAAGG + Intronic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161639418 19:5411607-5411629 GACAATATACAAATGGCCAATGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1164626667 19:29733583-29733605 GAAAATATACAAATGACCACAGG - Intergenic
1165566926 19:36738231-36738253 GAAGACATACAAATGGCCAATGG + Intronic
1166827366 19:45617739-45617761 GAGAATGTCCAGATGGACATGGG - Intronic
1168489214 19:56794036-56794058 CAAAATATACATATGGAAAAGGG - Intronic
1168653496 19:58109867-58109889 GAGAATATAAAGATGGATGAAGG + Intronic
925036262 2:688802-688824 GAGAGAACACAAATGGACCACGG + Intergenic
925068518 2:949546-949568 GAGAATAGAGAAATGGGGAAGGG + Intergenic
925085474 2:1104574-1104596 GGGAAAACACAAATGGAGAAAGG + Intronic
925093182 2:1171791-1171813 GATATTATACAGCTGGACAAAGG + Intronic
925566267 2:5257790-5257812 GAGAATAAACCAATGCAAAAAGG - Intergenic
925643345 2:6008653-6008675 GAGAAAAAAATAATGGACAAAGG + Intergenic
925902739 2:8520033-8520055 AAGAATATAGAACTGGACATTGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927987506 2:27422821-27422843 GAAGATATACAAATGGCTAACGG + Intergenic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928996635 2:37299346-37299368 GCCAAAATAAAAATGGACAAAGG + Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929354867 2:41009786-41009808 GAATACATACAAATGGCCAACGG - Intergenic
930061811 2:47295967-47295989 GAGAGTATAAAACTGGACAGAGG + Intergenic
930617941 2:53613575-53613597 TAAAACATACAAATGGCCAATGG - Intronic
930626459 2:53703767-53703789 GAAAATATACAAATGAGAAAAGG + Intronic
931136502 2:59408163-59408185 AAGATTTTAAAAATGGACAAGGG + Intergenic
931880325 2:66562275-66562297 GAGGATAAACTAAAGGACAAAGG + Intronic
932542549 2:72671372-72671394 GAAGACATACAAATGGACATTGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933334191 2:80935796-80935818 AAAAATATACAAATGGCCAGTGG + Intergenic
933346701 2:81095655-81095677 GAAAATATTCAAATGGGAAAGGG + Intergenic
933444413 2:82360416-82360438 GATGACATACAAATGGCCAATGG - Intergenic
933623933 2:84576736-84576758 CAGCATATGCAAATTGACAAAGG + Intronic
933943024 2:87260880-87260902 GAGAAAGGACAAATGCACAAAGG + Intergenic
934071271 2:88385991-88386013 GAAAATATACAAATGGGGCAGGG + Intergenic
934710432 2:96510609-96510631 GAGAATGTCCAAAAGGACAGTGG + Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935330148 2:101971219-101971241 GTGGATATACAAAAAGACAATGG - Intergenic
935590188 2:104841072-104841094 GTAAATATACATATGCACAAGGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936337189 2:111600682-111600704 GAGAAAGGACAAATGCACAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938449341 2:131402809-131402831 CAGAATATTCAAATGAACACAGG - Intergenic
938823787 2:134984422-134984444 GATAATATACAAACCAACAATGG + Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939636243 2:144585682-144585704 GAGAACATGAAAAAGGACAAAGG - Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
940746753 2:157575854-157575876 GACACTATACAAATTGACAAGGG + Intronic
940874970 2:158889251-158889273 GAGGATATACAGATGGTTAAAGG + Intergenic
941134762 2:161700406-161700428 GAGAATAGAGAAATGGCCATTGG + Intronic
941144055 2:161821059-161821081 GAGAATATCCAAATGGCCAAAGG - Intronic
941268571 2:163395875-163395897 CAGAATATAAAAATTGAAAAGGG + Intergenic
941288331 2:163643355-163643377 CACAATATACAAATGTACAGGGG + Intronic
941332089 2:164191125-164191147 GATAATATACATCTGGAAAATGG + Intergenic
942122296 2:172790226-172790248 GAAGACATACAAATGGCCAACGG - Intronic
942486524 2:176445658-176445680 GAGAACATAGGAATGGACAAGGG - Intergenic
942862624 2:180634736-180634758 GTCAATAGAAAAATGGACAAAGG + Intergenic
942927605 2:181452589-181452611 GAAGATATACAAATGGCAAACGG - Intergenic
943453830 2:188078172-188078194 GACAATGTACAAATAGAAAAGGG + Intergenic
943875537 2:193062474-193062496 GAGCATATTCAAATGAATAATGG + Intergenic
943935651 2:193912327-193912349 AAAAATATACATATGGACATAGG + Intergenic
943976519 2:194485391-194485413 GAGGATTTAAAAATGGAAAAGGG + Intergenic
943995896 2:194765003-194765025 GACACTGTGCAAATGGACAATGG - Intergenic
944189566 2:196987402-196987424 CAGAATATACAAATATAAAAAGG + Intronic
944225033 2:197341148-197341170 GACAAAATACAGAAGGACAAAGG - Intergenic
944330504 2:198460617-198460639 TAGAATATAAATATAGACAAAGG - Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
946457008 2:219835154-219835176 GATGACATACAAATGGCCAATGG - Intergenic
946693536 2:222329074-222329096 GATGATATACAAATGGCTAACGG - Intergenic
947674412 2:231964134-231964156 GACAAAAAACAAATGGAGAAGGG - Intronic
947911367 2:233803010-233803032 GCGCACAAACAAATGGACAAGGG - Intronic
948392379 2:237621741-237621763 GAGAGTAAACAAATGCACACTGG - Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169331119 20:4717209-4717231 GAAAATGTCCAAATGGAGAAAGG - Intergenic
1169702112 20:8458304-8458326 TGAAATATACAAACGGACAATGG - Intronic
1170189300 20:13628774-13628796 AAGAAAATAAAAATGGCCAAAGG + Intronic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1170912560 20:20588597-20588619 CAGAATATACAAATGTAAACTGG + Intronic
1171104375 20:22418550-22418572 GAGAAATGTCAAATGGACAAAGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172114211 20:32564023-32564045 GAGAGGAGACAAAGGGACAAAGG + Intronic
1172627262 20:36354467-36354489 GAGCAACTACAAATGGACAGAGG - Intronic
1172974761 20:38897877-38897899 GAAGACATACAGATGGACAACGG - Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1173913839 20:46691515-46691537 GAAGACATAAAAATGGACAACGG - Intergenic
1174940912 20:54926118-54926140 TAGAATATACAGATAGGCAATGG - Intergenic
1175245060 20:57577215-57577237 GAGAATAGACAGATGGATAGTGG + Intergenic
1175452552 20:59082103-59082125 AAGAATACATAAACGGACAAAGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175638015 20:60601763-60601785 GAGAATATACAAGTGGACTACGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177147185 21:17419549-17419571 GAGGAAATAAGAATGGACAAAGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177679858 21:24352835-24352857 GAGAATATCCACATAGACATGGG + Intergenic
1177871734 21:26580941-26580963 GAGAATAGACTAATGCACCAGGG + Intergenic
1178363785 21:31971515-31971537 GAGAACATACAAACAGAGAAAGG + Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179224065 21:39437012-39437034 GAGGATATAGCAATAGACAAAGG - Intronic
1179331431 21:40406013-40406035 GATGATATATAAATGGCCAAGGG + Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1180509224 22:16060169-16060191 GAGAATCTGCAAGTGGACATTGG - Intergenic
1184966962 22:47983859-47983881 CACAATTTACCAATGGACAAAGG - Intergenic
950470857 3:13185405-13185427 CAGAATAAACAAGTAGACAAAGG - Intergenic
950581077 3:13862513-13862535 GAAAATATACAGATGGAAAAAGG + Intronic
950999384 3:17540118-17540140 GAAAATATACAAATGGCAATTGG - Intronic
951617597 3:24565837-24565859 GAAGACATAAAAATGGACAATGG + Intergenic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953291752 3:41671941-41671963 GAAGACATACAAATGGCCAACGG + Intronic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953576518 3:44117066-44117088 TAGAATCTACAAATGCACAAAGG - Intergenic
955201814 3:56858486-56858508 GAGATTATAACAATTGACAATGG + Intronic
955543988 3:60007900-60007922 GAGGGTAGACAAATGGAAAAAGG + Intronic
955851624 3:63226064-63226086 GAAGACATACAAATGGCCAACGG + Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956483196 3:69693722-69693744 GAGAATAGAAAAATGGATATGGG - Intergenic
956628547 3:71291072-71291094 GAGAAAATATAAAAGGATAAGGG - Intronic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956855078 3:73268164-73268186 GAAGACATACAAATGGCCAACGG - Intergenic
956903254 3:73739042-73739064 GAGAAGATACAAATTTATAAGGG + Intergenic
957126499 3:76168064-76168086 GGCAATATAAAAATAGACAAAGG - Intronic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957248765 3:77746117-77746139 CAGAATATCAAAATGGACACTGG - Intergenic
957430442 3:80098627-80098649 CACAATATATAAATGAACAAGGG + Intergenic
957722555 3:84022687-84022709 GATAATATTCTAATGTACAAGGG + Intergenic
957746821 3:84354801-84354823 GAGAATAAACAATTTGACCAAGG - Intergenic
958184481 3:90102874-90102896 AAGAAAATGCAAATGGACAGAGG + Intergenic
958501645 3:94918280-94918302 GAAGATATACCAATGGAAAAAGG - Intergenic
958900985 3:99886575-99886597 TAGAACAAACAAATGAACAAAGG + Intronic
958906455 3:99947247-99947269 GAAACTATACAAAAGGTCAAGGG - Intronic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
959181072 3:102980859-102980881 GAAGACATACAAATGGCCAAAGG + Intergenic
959229111 3:103624524-103624546 GAAGACATACAAATGGCCAAAGG - Intergenic
959508483 3:107181400-107181422 GAAGATACTCAAATGGACAATGG + Intergenic
959561496 3:107788178-107788200 GAGAATAGAGACAAGGACAAGGG + Intronic
959680065 3:109085474-109085496 GACAACATACAAATAGCCAAAGG + Intronic
959956319 3:112242311-112242333 GAAAATATACATATACACAATGG + Intronic
960056641 3:113280523-113280545 GAGAAGAAACAAGTTGACAATGG - Intronic
960132753 3:114074702-114074724 GAAAATACACAAATCAACAATGG - Intronic
960323573 3:116267213-116267235 GAGGAAATAAAAATGAACAATGG + Intronic
960502764 3:118457035-118457057 GAGATTTTACTCATGGACAAAGG + Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
960726157 3:120672418-120672440 GACAAAATACAGAAGGACAACGG + Intronic
961231511 3:125316208-125316230 GAAAATGTACATATGCACAATGG - Intronic
961689617 3:128659387-128659409 AAGAGTATACAAATGGCCAGTGG + Intronic
962113505 3:132475670-132475692 GAGCATATCCAAATGGAATATGG - Intronic
962842035 3:139242698-139242720 AAGGACACACAAATGGACAATGG - Intronic
962894634 3:139703031-139703053 AAAGATATACAAATGGCCAAAGG + Intergenic
963429816 3:145185473-145185495 GAGATAATTAAAATGGACAAAGG - Intergenic
963818491 3:149860972-149860994 GAAGACATACAAATGGCCAACGG + Intronic
964165268 3:153697197-153697219 GGGAATAGCCAAGTGGACAAAGG - Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964336524 3:155660501-155660523 GAGAATACAGAGATTGACAAAGG + Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966163844 3:176994972-176994994 GAGAAGCTACTAATGGAAAATGG + Intergenic
966290268 3:178347866-178347888 TGTAATATACAAATGGACACTGG + Intergenic
966590585 3:181678295-181678317 AAGGACATAAAAATGGACAATGG - Intergenic
967281760 3:187830005-187830027 GAGAATATACTAAGGGGCACAGG - Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
968219390 3:196924406-196924428 GACATAATAGAAATGGACAAAGG + Intronic
969010433 4:4057505-4057527 GAGAATGTATAAATGGAGAGAGG - Intergenic
970069715 4:12143851-12143873 GATATTATACAAATGGTCATAGG + Intergenic
970173868 4:13317123-13317145 GAAGATATACAAATGGCCAATGG - Intergenic
970258817 4:14201136-14201158 GAGAATAGAAAAATGACCAATGG - Intergenic
970564030 4:17313894-17313916 GAAGACATACAAATGGCCAATGG - Intergenic
970759304 4:19465057-19465079 GAGAACATACCCATGAACAATGG + Intergenic
970923349 4:21421003-21421025 GAAGACATACAAATGGCCAACGG + Intronic
970976724 4:22050136-22050158 GAGAGTAGAGAAAAGGACAAAGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971745295 4:30572196-30572218 GAGAATATACAAACAGACACTGG + Intergenic
971747945 4:30609512-30609534 GAGAAAGAACAAATGGACACTGG + Intergenic
971991937 4:33909624-33909646 AAAAACATAGAAATGGACAAAGG + Intergenic
972651108 4:41018621-41018643 GAGAATATACTAGAGGAAAAAGG - Intronic
972904972 4:43734565-43734587 AAGAGTATACAAATTGAAAAGGG + Intergenic
972993869 4:44855214-44855236 GACAATTTAAAAATGCACAAGGG - Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
974313625 4:60247350-60247372 CAGAATATACATATAGACCAGGG + Intergenic
974390423 4:61259745-61259767 GAGAATATAAATATGTTCAAAGG - Intronic
974422010 4:61688732-61688754 GAAATTATACAAATAGTCAAGGG - Intronic
974936933 4:68420054-68420076 GAGGGTATACAAATGCACATAGG + Intergenic
975020324 4:69479005-69479027 GAAGATATACAAATGGTGAATGG + Intergenic
975338191 4:73205948-73205970 GAAAACATACACATGGCCAATGG + Intronic
975529471 4:75385845-75385867 AGGCATATACAAATGGGCAATGG + Intergenic
976066322 4:81191716-81191738 GAAAATATACACATCGAAAAGGG + Intronic
976082408 4:81370156-81370178 GAAGACATACAAATGGCCAACGG - Intergenic
976866794 4:89738159-89738181 TTGAATATACTAATGCACAAAGG + Intronic
976994006 4:91406898-91406920 GAGAATATTCAAATAAACAAAGG - Intronic
977073344 4:92421368-92421390 GAGGAAATACAGATGGAAAAAGG + Intronic
977076570 4:92459545-92459567 GAGAATATACTAATTGACATAGG - Intronic
977304779 4:95309644-95309666 GAAGACATACAAATGGCCAAGGG + Intronic
977967388 4:103168677-103168699 GAGAATCTGCTGATGGACAAGGG - Intronic
978180556 4:105789903-105789925 GAGAAAATTCAAAAGAACAATGG - Intronic
978252126 4:106643859-106643881 GAAGACATACAAATGGCCAATGG - Intergenic
978765317 4:112399365-112399387 GAGAATAAATAAATGGTCACTGG + Intronic
979353856 4:119679093-119679115 CAGCAAATATAAATGGACAAAGG + Intergenic
979563388 4:122125614-122125636 ACAAATATACAAATGGACATAGG - Intergenic
980192212 4:129539450-129539472 GACAATATAGAAATGGACACGGG + Intergenic
980467564 4:133204799-133204821 GAGAATCTGCAACTGGACACTGG + Intronic
981054718 4:140348986-140349008 GAAGACATACAAATGGCCAATGG - Intronic
981223759 4:142267908-142267930 GAAGACATACAAATGGCCAACGG + Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981342909 4:143642981-143643003 GAAGATATACAAATGGCCAACGG + Intronic
981414579 4:144476973-144476995 GAAGATATAAAAATGGCCAATGG - Intergenic
981450710 4:144894634-144894656 GAGACTATACAGATGGATAGTGG + Intergenic
982198852 4:152940066-152940088 GAGAATACACAAAAGAACGATGG - Intronic
982279686 4:153670123-153670145 GAAAATATATAAATGGCCAAGGG - Intergenic
982494728 4:156076758-156076780 AAGAATAGACAAATAGATAAAGG - Intergenic
982687192 4:158505022-158505044 GAAAATATACATATGTAAAATGG + Intronic
983002764 4:162438951-162438973 GAAGATATACAAATAGCCAATGG + Intergenic
983399316 4:167243729-167243751 CAGAATATCCAAATTGAGAAAGG - Intergenic
984556263 4:181217789-181217811 GAGAATGAACAATTGGAGAATGG + Intergenic
984556380 4:181218902-181218924 GAGAATGAACAATTGGAGAATGG - Intergenic
985173048 4:187172781-187172803 GAAAAAAAAAAAATGGACAATGG - Intergenic
985751291 5:1678016-1678038 GAAAACACACAAATGGCCAATGG - Intergenic
986058238 5:4161135-4161157 GACAATATACAAACAAACAATGG + Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987528682 5:19086161-19086183 GTCAATATACACATGGAAAATGG - Intergenic
987617155 5:20290989-20291011 AAAAATATTGAAATGGACAAGGG + Intronic
988521217 5:31947152-31947174 GACAATATACAAAGGTACATTGG + Intronic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
988978590 5:36540933-36540955 GAAGATATACAAATGGGCAACGG - Intergenic
989111589 5:37912028-37912050 GAAAATATACTTATGCACAATGG + Intergenic
989227314 5:39044430-39044452 TAAAATATAAGAATGGACAAGGG + Intronic
989698660 5:44235718-44235740 GAGGATATAAAAATGAAAAAGGG + Intergenic
990023172 5:51153942-51153964 GAAGACATACAAATGGCCAACGG + Intergenic
990092091 5:52064325-52064347 GAGAACAGACTAATAGACAAAGG + Intronic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
990934298 5:61130808-61130830 GAGAATCTGCAGATGGCCAAGGG + Intronic
991207280 5:64064241-64064263 GACAATATACAAATGGCGAATGG - Intergenic
991443870 5:66679554-66679576 GAGAGTATACAAATGAAGAAGGG - Intronic
991614495 5:68482010-68482032 GAGACTGTGCAAATGAACAATGG + Intergenic
991658382 5:68926207-68926229 TAGAAAACACAATTGGACAAAGG + Intergenic
992371059 5:76144632-76144654 GAGGAGATACAAAAGGAGAAGGG + Intronic
992800048 5:80287817-80287839 GAAGCTATACAAATGGCCAAAGG + Intergenic
993135989 5:83965152-83965174 GAGAAAATATAAATGATCAATGG - Intronic
993205892 5:84877922-84877944 GAAGATATACAAATGGCAAACGG + Intergenic
993222846 5:85124180-85124202 GATAACATGCAAATGGCCAATGG - Intergenic
993337356 5:86677568-86677590 GAGAAAAAACAAAGGGAGAAAGG + Intergenic
993452546 5:88090433-88090455 GAAAATATACAGATTGCCAAGGG + Intergenic
993456709 5:88135659-88135681 TATAATATACAAATGTATAATGG + Intergenic
994300845 5:98145634-98145656 GAGAAAATAAGAATGGAAAATGG - Intergenic
994319386 5:98374502-98374524 GGGGATTTACAAATGAACAAAGG - Intergenic
994348670 5:98718857-98718879 CAGAATATAGGCATGGACAAAGG + Intergenic
994588617 5:101744663-101744685 GAGACGATACAAATGGAAAAAGG + Intergenic
995266404 5:110166737-110166759 TAGAATATTTCAATGGACAATGG - Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997495796 5:134324059-134324081 GAAAATATACAGATGGCAAATGG + Intronic
997707333 5:135968908-135968930 GAAGACATACAAATGGCCAATGG - Intergenic
998590161 5:143469588-143469610 GAGAAAATACAACTAGAGAAGGG - Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999817114 5:155188198-155188220 CAAGATATACAAATGGCCAAAGG - Intergenic
999858832 5:155623669-155623691 GGGAATGCACAAATGGACAGAGG - Intergenic
999861283 5:155649353-155649375 GAGAATAAATAAATGAACAACGG + Intergenic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000366872 5:160500035-160500057 GAAAATCTACAAATGGAGAGGGG + Intergenic
1001998943 5:176185271-176185293 GAGAATGTTCAAATGAACACAGG + Intergenic
1002533083 5:179860304-179860326 GACAATATGCCAATAGACAATGG + Exonic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005528397 6:26676234-26676256 GACAAAATAAATATGGACAAGGG - Intergenic
1005529164 6:26685381-26685403 GACAAGATAAATATGGACAAGGG - Intergenic
1005541632 6:26816265-26816287 GACAAGATAAATATGGACAAGGG + Intergenic
1005542398 6:26825405-26825427 GACAAAATAAATATGGACAAGGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1005815408 6:29547918-29547940 GAGAATATACTAAAGGTTAAGGG + Intergenic
1006153877 6:32003738-32003760 GAGAATATACAAAGGCCCAGAGG + Intergenic
1006160185 6:32036475-32036497 GAGAATATACAAAGGCCCAGAGG + Intergenic
1006765598 6:36502408-36502430 TAAAAAATACTAATGGACAAAGG - Intronic
1007000076 6:38302920-38302942 GAAGACATACAAATGGCCAATGG - Intronic
1008168657 6:48173863-48173885 GTGAATATACAAATTTCCAAAGG + Intergenic
1008431609 6:51424514-51424536 CAAGATATACAAATGGCCAAAGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009012440 6:57858322-57858344 GACAAGATAAATATGGACAAGGG + Intergenic
1009013205 6:57867525-57867547 GACAAAATAAATATGGACAAGGG + Intergenic
1009313056 6:62181408-62181430 GATGATATGCAAATGGACAATGG + Intronic
1009327331 6:62369290-62369312 AAGAATGTTCAACTGGACAAGGG - Intergenic
1009931087 6:70178524-70178546 AAGAATCTAGAAATAGACAATGG + Intronic
1010412331 6:75574663-75574685 TAGAATATAGACATGGGCAAAGG + Intergenic
1010630756 6:78194796-78194818 GAAGACATACAAATGGCCAAAGG - Intergenic
1010931849 6:81813249-81813271 GAGCATACACAAAGGCACAAAGG + Intergenic
1011038971 6:83009960-83009982 GAGAGTAGACAAATGGAGGAGGG + Intronic
1011153612 6:84303515-84303537 GAAGACATACAAATGGCCAAAGG + Intergenic
1011350835 6:86421900-86421922 GAGGATGTACAAAGGGAAAATGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011674545 6:89719344-89719366 GAGAAAATTCAAAAGGATAAGGG - Intronic
1012293245 6:97485243-97485265 GAAAATACACAAATGGCCAAGGG - Intergenic
1013299464 6:108790281-108790303 CACAATTTAAAAATGGACAAAGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014070040 6:117170397-117170419 GAGAACAGACAAATGTAGAAGGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1015132407 6:129828302-129828324 AAGAACATACAAATGGTCAAAGG - Intergenic
1015208283 6:130666846-130666868 AAGCCTATACAAATAGACAATGG + Intergenic
1015415652 6:132944933-132944955 GAAGACATACAAATGGCCAAAGG + Intergenic
1016201284 6:141412436-141412458 AAGAATAGTCAAATGGACCAAGG - Intergenic
1016542852 6:145185700-145185722 GAAGATATACAAATGGAAAATGG + Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016651929 6:146471818-146471840 GGAAATATTCAAATAGACAAAGG + Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016942640 6:149495876-149495898 TAGAATATATAAATGGAGACTGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017477703 6:154814882-154814904 GGGAAGATACAAAGGGAAAATGG - Intronic
1017963492 6:159243567-159243589 GAGAATAAACAAAACGACTATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1019125001 6:169832333-169832355 GAGTACATACAAATGTAGAAAGG + Intergenic
1020258746 7:6518292-6518314 AAGAAAACAAAAATGGACAAAGG + Intronic
1020410871 7:7890137-7890159 AAGAATGGACAAATGGACAGGGG + Intronic
1020506821 7:9000955-9000977 AAAAATACACAAATGGAGAAAGG + Intergenic
1021160386 7:17265290-17265312 GAAGACATACAAATGGCCAAAGG - Intergenic
1021546844 7:21822881-21822903 GAAGACATACAAATGGCCAACGG - Intronic
1021598112 7:22338531-22338553 GAGAATACACAAATGACTAAAGG - Intronic
1021736639 7:23645761-23645783 GAGAATATAGAGAAGCACAATGG + Intergenic
1021792659 7:24221590-24221612 AAGGATATACAAATAGACAATGG + Intergenic
1023073917 7:36464243-36464265 GACAATTGAAAAATGGACAAAGG - Intergenic
1023110901 7:36809530-36809552 GATGTTATACAAACGGACAATGG - Intergenic
1023204780 7:37736259-37736281 GAATATATGCAAATGGAAAAAGG + Intronic
1023896446 7:44437380-44437402 GAGAATTTACAAAGAAACAAAGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024133490 7:46382336-46382358 CATAATAGACAAATAGACAATGG + Intergenic
1024756904 7:52544162-52544184 GAGAACATTCACATGGGCAAGGG - Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025310303 7:57928463-57928485 TAGAATCTACAAGTGGACATTGG + Intergenic
1026557555 7:71421502-71421524 GATCATATAGAAAAGGACAAGGG + Intronic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1027309599 7:76941000-76941022 GAGAATAGACAAATCTACCAAGG + Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029069720 7:97885506-97885528 GAGAATGTATAAATGGAGAGAGG - Intergenic
1030391694 7:108936300-108936322 GAAGACATACAAATGGCCAAAGG + Intergenic
1030422003 7:109318801-109318823 GAAGACATACAAATGGCCAATGG + Intergenic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1031231382 7:119111954-119111976 GAGAATAAAGGAATGGAAAAGGG - Intergenic
1031249360 7:119359555-119359577 GAGAATATTCAATTGTATAAGGG - Intergenic
1031639834 7:124148537-124148559 CAGAATATATAAATGAGCAATGG - Intergenic
1031756761 7:125653935-125653957 GAAGATATACAAATGGCCAACGG - Intergenic
1031764138 7:125754820-125754842 GAAAACATACAAATGGCCACAGG - Intergenic
1031814510 7:126416641-126416663 GAGAAAATAAACATGGACAGGGG + Intergenic
1032043949 7:128586922-128586944 GATAATATTCAAAGAGACAATGG - Intergenic
1032667629 7:134052545-134052567 GATAATATATACATGAACAATGG + Intronic
1032674353 7:134114913-134114935 GAGGACATACAAATGGCCATAGG + Intergenic
1032967270 7:137113386-137113408 GAGACTACACAACAGGACAATGG + Intergenic
1033814245 7:145053084-145053106 GAGAATATGCACCTGGAAAAGGG - Intergenic
1033962811 7:146934664-146934686 GAAAAGAAAAAAATGGACAATGG + Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1036507714 8:9370513-9370535 GGGAATAGACAAATGGCGAAGGG + Intergenic
1036734760 8:11302315-11302337 GACAATATTCAAATGCATAATGG + Intronic
1036885421 8:12548820-12548842 GAGAATGTATAAATGGAGAGAGG - Intergenic
1038101666 8:24384467-24384489 GAGAAGATAAAACTGGACACTGG + Exonic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1039991992 8:42496372-42496394 GAAAATATACAAAAGGGCACAGG + Intronic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1042013267 8:64274900-64274922 GAGTATATTCAAATGGACATGGG + Intergenic
1042095186 8:65207638-65207660 TAAGATATACAAATGGCCAACGG - Intergenic
1042233712 8:66586396-66586418 GAAAACATACAAATGGACAATGG + Intronic
1042251972 8:66765334-66765356 GAAAATATACAAATGGCCACAGG - Intronic
1043103692 8:76081618-76081640 CATAATTTAAAAATGGACAAAGG - Intergenic
1043231393 8:77805788-77805810 AAGAATAGACAAATAGGCAATGG + Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043524173 8:81078541-81078563 GAGAAAACACACATTGACAAGGG + Intronic
1043548897 8:81346241-81346263 GAAGATATACAAATGGCTAATGG - Intergenic
1043705958 8:83351067-83351089 GAAAATATGCAAATAGCCAAAGG - Intergenic
1043948491 8:86281419-86281441 GAAAATATAGAAATAGAGAACGG + Intronic
1044116990 8:88348152-88348174 GACAATATACCAATGGATATTGG + Intergenic
1044154688 8:88829286-88829308 GAGAATAAACCAATGCCCAAAGG - Intergenic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045085116 8:98674078-98674100 GAGAAAATACATATGAAAAATGG + Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045598754 8:103689824-103689846 GAAAATAAAGAAATGGAAAAAGG - Intronic
1045880083 8:107028557-107028579 GAGAATATGAAAATGACCAAGGG + Intergenic
1046293698 8:112195004-112195026 GAGAAGAAAGGAATGGACAAAGG - Intergenic
1046434545 8:114169973-114169995 GAAAATTTACAAATGGCCACTGG - Intergenic
1047005700 8:120617808-120617830 GAGAAAATACATTTGGACTAAGG + Intronic
1047301762 8:123619484-123619506 TTCAGTATACAAATGGACAATGG - Intergenic
1047316805 8:123742011-123742033 GAGAATCTGTAAATGGACAAGGG + Intergenic
1047876263 8:129141145-129141167 GAGAAGACACAAATAGAAAAGGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051224943 9:14889418-14889440 GAGAACACACAAATGGCTAAGGG - Intronic
1051649748 9:19310151-19310173 GATAATATACAAATTAAAAAAGG - Intronic
1051753289 9:20367094-20367116 GAGAATTTACAAAAAAACAATGG - Intronic
1052247540 9:26354684-26354706 GAATACATACAAATGGACTATGG + Intergenic
1052477371 9:28977258-28977280 TATTATATACAAATGGAGAACGG + Intergenic
1052661964 9:31444799-31444821 GAGAACAAACACATGGACACAGG - Intergenic
1052957514 9:34264885-34264907 CAGCATATACAACTGGAAAAAGG + Intronic
1053711561 9:40815150-40815172 GAGAATCTGCAAGTGGACATTGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1053937663 9:43182107-43182129 GAGAATCTGCAAGTGGACATTGG + Intergenic
1054422025 9:64947026-64947048 GAGAATCTGCAAGTGGACATTGG + Intergenic
1054822908 9:69541482-69541504 GAGGACATACAGATGGTCAATGG - Intronic
1055041758 9:71881975-71881997 AAAGATATACAAATGGCCAATGG + Intronic
1055425251 9:76188683-76188705 GAGAATAAACAAAAGAACTAGGG - Intronic
1055673493 9:78631303-78631325 GAGAATAGAAAAAAGAACAAGGG + Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1056172665 9:84002455-84002477 TAGAACAGACAAATAGACAAAGG - Exonic
1056344426 9:85676414-85676436 GAAAATATATAAATGGGCAATGG + Intronic
1056562680 9:87746134-87746156 GAAAATATACATATACACAATGG - Intergenic
1056726900 9:89127201-89127223 GAGAATTTAAAAAATGACAAAGG - Intronic
1057482267 9:95454462-95454484 GAAAAAATACAAATATACAAAGG + Intronic
1057506640 9:95639426-95639448 GAACATATACAAATGGCCAATGG + Intergenic
1057926953 9:99161077-99161099 GAGAATAAACAAATGAATAAAGG - Intergenic
1058127862 9:101216303-101216325 GAAGACATACAAATGGCCAACGG - Intronic
1058582005 9:106468548-106468570 GAGCAAAAACAAAAGGACAATGG - Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059403642 9:114086434-114086456 AAGAAGATAGAAATGGAAAAAGG + Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1059979477 9:119754413-119754435 GAGGATATACAAATGGCCACAGG - Intergenic
1060253890 9:122008441-122008463 GAAAACATACAAATGGCCAATGG + Intronic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1185929526 X:4186863-4186885 GAGAAGATATAAATGGACACTGG - Intergenic
1186812005 X:13199594-13199616 TCTCATATACAAATGGACAATGG + Intergenic
1186940261 X:14499384-14499406 GAAGACATACAAATGGCCAATGG - Intergenic
1187841031 X:23488258-23488280 GCAGATATACAAATGGACAATGG + Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188707208 X:33349532-33349554 GAGAATATATAAATGAATTATGG - Intergenic
1188929790 X:36093534-36093556 GAAAACATACAAATGGCAAATGG - Intronic
1189079608 X:37957163-37957185 GCGAATATACAAATATATAAAGG - Intronic
1191586441 X:62832345-62832367 GAAGATATACAAATGACCAATGG + Intergenic
1191819662 X:65290634-65290656 GAAAATATACATATACACAATGG + Intergenic
1192124327 X:68487788-68487810 GAGAATCCACACATGGACAGAGG + Intergenic
1192333080 X:70195105-70195127 GAAAACATACAAATAGCCAAAGG + Intronic
1192749365 X:73972536-73972558 GAAAACATACAAATGGTCAATGG - Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193324634 X:80165403-80165425 GGGAATATACAAGATGACAATGG + Intergenic
1193375095 X:80750440-80750462 GACGACATACAAATGGCCAATGG + Intronic
1193633120 X:83914344-83914366 GATATTATAGAAATGGAGAATGG + Intergenic
1193870589 X:86793140-86793162 GAAGACATACAAATGGCCAACGG - Intronic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194413425 X:93581383-93581405 GAGAATATCCACATGACCAATGG + Intergenic
1194477167 X:94372466-94372488 GAAACTATAAAAATAGACAAAGG + Intergenic
1194528656 X:95014833-95014855 GAGAATATACATATGAGTAATGG - Intergenic
1194854949 X:98916735-98916757 AAGAATAGACATATAGACAAAGG - Intergenic
1195554384 X:106205129-106205151 GAGCAATTACAAATGGAGAAGGG - Intronic
1195559915 X:106271560-106271582 GAGAATATTCCAATGTACAGCGG - Intergenic
1195562047 X:106294779-106294801 GAGAATATTCCAATGTACAGCGG + Intergenic
1196262102 X:113595172-113595194 GAGGATATGCAAATGGACACAGG - Intergenic
1196981258 X:121216079-121216101 AAGGATAGACAAATAGACAAAGG - Intergenic
1198646598 X:138813878-138813900 GAGAATATATGAATGAATAAAGG + Intronic
1198844165 X:140891905-140891927 GAGTGTACACAAATGGGCAAGGG + Intergenic
1199204143 X:145128089-145128111 TCGAATATACAAACAGACAACGG + Intergenic
1199406311 X:147465401-147465423 GAAGACATACAAATGGCCAATGG + Intergenic
1199439340 X:147850584-147850606 AAGATTATAGAAATGGTCAAGGG + Intergenic
1199865945 X:151850202-151850224 GAAGACATACAAATGGCCAATGG + Intergenic
1199891931 X:152093260-152093282 GATAATATACATATAGAGAAGGG - Intergenic
1200362020 X:155617056-155617078 AAGAATGTATAAATGCACAAGGG - Intronic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic