ID: 928111844

View in Genome Browser
Species Human (GRCh38)
Location 2:28516895-28516917
Sequence GCGTGTGTATGGAGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 641
Summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 573}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928111834_928111844 8 Left 928111834 2:28516864-28516886 CCAGAGGTAAGGGCTTTGGCTGG 0: 1
1: 0
2: 4
3: 18
4: 176
Right 928111844 2:28516895-28516917 GCGTGTGTATGGAGGGGAGAGGG 0: 1
1: 0
2: 4
3: 63
4: 573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928111844 Original CRISPR GCGTGTGTATGGAGGGGAGA GGG Intronic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
900371378 1:2333665-2333687 GCTTGTGAATGGGGTGGAGAAGG - Intronic
900740514 1:4328196-4328218 GGGTGTGTTTGTAAGGGAGAGGG - Intergenic
900952120 1:5864032-5864054 GCCTGTGGAGGGAGGGGACAGGG + Exonic
901210860 1:7525274-7525296 GTGTGTGTAGGGGGGTGAGATGG - Intronic
901435143 1:9242972-9242994 GTGTGTGTATTTAGGGGTGAGGG + Intronic
901436557 1:9250444-9250466 GTGTGTGTAGGGTGGGGAGTGGG - Intronic
901698280 1:11027595-11027617 GCGTATATATGGAGGGCAAAAGG - Exonic
902512870 1:16975680-16975702 GCCTGTGTATGGAGTAGAGGCGG + Exonic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904032710 1:27543189-27543211 GAGGGAGTAGGGAGGGGAGAGGG + Intronic
904128374 1:28258714-28258736 GAGAGTGTCTGGAGGGAAGAGGG + Intergenic
904234047 1:29102332-29102354 TACTGTTTATGGAGGGGAGAAGG + Intronic
905297679 1:36964422-36964444 GCATGTGTGAGGAGGGGAGAGGG - Intronic
905597875 1:39224179-39224201 ATGTGTGTATGGGGGGGAGTAGG - Intronic
905600013 1:39241714-39241736 GTGTATGTATGGCGGGGAGGGGG + Intronic
906690191 1:47787502-47787524 GCATTTGTAGGGAGGGGAGGCGG - Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
907745573 1:57209824-57209846 GTGTGTGTGTGAGGGGGAGAGGG - Intronic
907784968 1:57602780-57602802 GTGTGTGTGTGGAGGGGAGTGGG + Intronic
908253723 1:62285407-62285429 GCGTAAGTGTGGAGAGGAGAGGG - Intronic
908860011 1:68473941-68473963 GCGTGTGTGTGTGGGGGGGAGGG - Intergenic
909490066 1:76216251-76216273 GCGTGTGTGTGTAAGAGAGATGG - Intronic
910317488 1:85902753-85902775 AAGGGTGTATGGATGGGAGAGGG + Intronic
911103633 1:94113216-94113238 GAGGGTGTATGGTGGGGAGGGGG - Intronic
911261695 1:95693989-95694011 GTGTGTGTGTGGCGGGGTGAGGG + Intergenic
912449228 1:109759173-109759195 GTGTGTGTGTGGTGGGGTGATGG + Intronic
912451679 1:109771012-109771034 CCACGGGTATGGAGGGGAGAGGG + Intronic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
913243848 1:116854141-116854163 GCATGTGTATGGAAGGGGGAAGG - Intergenic
915359667 1:155278275-155278297 GCGGGTGTGGGGATGGGAGATGG - Intronic
915849566 1:159306715-159306737 GCCTGTGTATTGAGGGAGGAGGG + Intronic
916116922 1:161492897-161492919 GAGTGTGTGTGGTGGGGGGATGG + Intergenic
917267816 1:173240323-173240345 GAATGTCTATGGAGGGGAAAAGG - Intergenic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
919403984 1:197152793-197152815 GTGTGTGTGTGGAGGGGTGGGGG + Intergenic
919856790 1:201711584-201711606 GCTTGCGGATGGAGGGGAAAAGG + Intronic
919907407 1:202087278-202087300 GGGTGTGTATGGGGGAGGGAGGG + Intergenic
920002840 1:202811316-202811338 GCGGGTGTATCTAGGGGCGAAGG - Intergenic
920222903 1:204417042-204417064 GAGTGTGGGGGGAGGGGAGAGGG + Intergenic
920256742 1:204660532-204660554 GTCTGTGTAAGGCGGGGAGAAGG - Intronic
920689721 1:208136603-208136625 GCCTGTATATTGAGGGGAGCGGG + Intronic
921101504 1:211932837-211932859 GCATGTGTTTGGTGGGGAGCTGG + Intergenic
921257951 1:213359444-213359466 GTGTGTCTCTGCAGGGGAGATGG + Intergenic
921579119 1:216874534-216874556 GCCTCTGTATGGAAGGAAGAAGG - Intronic
921584274 1:216929472-216929494 GTGCGTGTGTGGAGGGGAGCTGG + Intronic
921875053 1:220186440-220186462 GCGTGTTTGTGGAGGAGAAATGG + Intronic
922003508 1:221504529-221504551 ACCTGGGCATGGAGGGGAGAGGG - Intergenic
922006060 1:221531846-221531868 AAGTGTGTATGAAGGGGAGGGGG + Intergenic
922770836 1:228182323-228182345 GGGTGTGTATGGTGGGGACGGGG + Intergenic
922770882 1:228182459-228182481 GGGTGTGTGTGGTGGGGAGATGG + Intergenic
922780747 1:228250397-228250419 GGGTGTGCATGGGAGGGAGAGGG + Intronic
922782586 1:228264548-228264570 GGGTGTGCATGGGAGGGAGAGGG + Intronic
922887648 1:229032142-229032164 TGGTGTGTATGTAGGGGAGTGGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924043900 1:240009275-240009297 GAGCGTGTAGGGAGGGGATAGGG + Intergenic
924333297 1:242962335-242962357 GGGTGTGTGTGGAGTGTAGAGGG + Intergenic
1063039240 10:2319980-2320002 GTGTGTGTGTGGTGGGGGGAGGG - Intergenic
1063648815 10:7913079-7913101 GCGTGTGTGCGGAGAGGAAAGGG - Intronic
1063762336 10:9094090-9094112 GCGGGTGGAGGGAGGGAAGAGGG + Intergenic
1063898628 10:10708835-10708857 GTGTGTGTTTGGAGGGGTCAAGG - Intergenic
1063982708 10:11468633-11468655 GCGTGGGAGTGGAGGGGAGGAGG + Intronic
1065768828 10:29057536-29057558 GTGTGTGTATGGAGTGGGGGAGG - Intergenic
1066189678 10:33044909-33044931 GACAGGGTATGGAGGGGAGATGG + Intergenic
1067242517 10:44508584-44508606 GCCTGTGTCTGCTGGGGAGAAGG + Intergenic
1067616976 10:47763781-47763803 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1067681188 10:48442289-48442311 GCGTGTGCATGCAGGGCAGGGGG + Intergenic
1068068905 10:52170552-52170574 GAGTGTCGATGGAGTGGAGAGGG - Intronic
1069004092 10:63297984-63298006 GCGTGTGGATGGAGGGAATGTGG - Intronic
1069187074 10:65437282-65437304 GGGTGTGAATGGAGCAGAGAGGG - Intergenic
1069297335 10:66862495-66862517 GCCTGTTTGTGGAGGGGATATGG + Intronic
1069319167 10:67146089-67146111 GTGTGTGTGTGGAGGGGTGCTGG - Intronic
1069924047 10:71836074-71836096 GCTTGTGTCTGAAGGGGTGAAGG - Intronic
1071284227 10:84129525-84129547 GGGTCAGAATGGAGGGGAGAAGG - Intergenic
1071523719 10:86346404-86346426 GCCTGTGTTTGGAGGGCAGCTGG + Intronic
1072187866 10:93059944-93059966 GGGTGTGTGTGGAGGGGTGCAGG - Intergenic
1073035804 10:100563433-100563455 GTGTGTGGATGTAGGGGTGAGGG - Intergenic
1073093820 10:100968178-100968200 GGATGTGTGTGGCGGGGAGAGGG - Intergenic
1074343239 10:112655130-112655152 GGGTGTGTATGGGGGGTGGAGGG - Intronic
1074465404 10:113677398-113677420 GCGGGTGGGGGGAGGGGAGAGGG + Intergenic
1075054549 10:119207662-119207684 GCGTGTTGAGGGAGGGGGGAGGG + Exonic
1075242776 10:120793264-120793286 GTGTGTGTGTGGGGGGGAGGGGG - Intergenic
1075268316 10:121025549-121025571 GTGGGTGTAAGGAGGGGAGCAGG + Intergenic
1075677872 10:124308736-124308758 GTGTGTATATGGAGGGGGTAGGG - Intergenic
1076470246 10:130713697-130713719 GTTTGTGTAAGGAGGGGAGGGGG + Intergenic
1076599144 10:131645869-131645891 GTGTGTGCCTTGAGGGGAGAGGG + Intergenic
1076716204 10:132365228-132365250 GCGTGAGTCTGGAGGAGAGTGGG + Intronic
1078429745 11:11280007-11280029 GTGTGTGTTGGGAGGGGACATGG + Intronic
1079158323 11:17969520-17969542 GAGTGTGGGTGGAGGGGTGAGGG + Intronic
1079698130 11:23509603-23509625 GGGTGTGTTTGGAGGTGACAGGG - Intergenic
1080070314 11:28076168-28076190 GTCTGTGTTTGGAAGGGAGAGGG + Intronic
1080232507 11:30033806-30033828 ACCTGAGTATGGAGGGTAGAAGG + Intergenic
1081577219 11:44326784-44326806 GCGTGTGTGTGGAGGGAGGGAGG + Intergenic
1081611799 11:44567383-44567405 GTGTGTGTATGTAGGGCAGGGGG + Intronic
1081786853 11:45753810-45753832 GAGGGTGGACGGAGGGGAGAGGG + Intergenic
1082002841 11:47403215-47403237 GCCTGTGTATCCAGGGGACAAGG + Intergenic
1082801271 11:57416531-57416553 GCTTGGGTCTGGAGGAGAGATGG + Intronic
1083420888 11:62552602-62552624 GTGTGTGTATGGGGTGGAGGCGG - Intronic
1083741939 11:64715922-64715944 GCTTGTGTGTGGGGGGGTGAGGG - Intronic
1083810704 11:65104868-65104890 GCCTTTGTGTGGAGGGGAAAGGG + Intronic
1084144353 11:67256201-67256223 GCGTGTGTGTGGAGGGAGGGAGG + Exonic
1084463629 11:69309650-69309672 GCAGGTGTCTGGAGGAGAGAGGG + Intronic
1084477139 11:69395499-69395521 TCGTGTGTGGGCAGGGGAGAAGG + Intergenic
1084934059 11:72577597-72577619 GCGGGTGCATGGGGGGCAGAGGG + Intronic
1085283721 11:75346714-75346736 GCCTGGGTATGGAGAGAAGAGGG - Intronic
1085294644 11:75424187-75424209 GTGTGTGTGTTGAGGGGTGAGGG - Intronic
1085341536 11:75734669-75734691 GTGCATGTATGGAGGGGAGGAGG - Intergenic
1085954495 11:81375056-81375078 GCGTGTGTGTGGGGGGGTGTGGG + Intergenic
1086124243 11:83333596-83333618 AGGTGAGTATGGAGGGGAGTTGG - Intergenic
1086164745 11:83764458-83764480 GGGTGTGCAGGGAAGGGAGAAGG + Intronic
1086497228 11:87416941-87416963 GTGTGTGTGTGGAGGGGCTAAGG + Intergenic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1087007969 11:93487434-93487456 GTGGGTGTATGGAGGGGAGGAGG + Intronic
1087716242 11:101612274-101612296 GCGTGTGTATTGTGGGGTGTAGG - Intronic
1087934629 11:104018137-104018159 GGGTGTGTGTGGAGGGGGGTGGG - Intronic
1089125123 11:116171487-116171509 GCATGTGTGTGTTGGGGAGAGGG + Intergenic
1089291855 11:117442516-117442538 GCGTGTGTGTGTATGGGGGAAGG + Intronic
1089325371 11:117653188-117653210 GGGTGTGTGTGTAGGGGAAATGG + Intronic
1089887753 11:121844875-121844897 GGGAGTGGAGGGAGGGGAGAGGG - Intergenic
1091196933 11:133739162-133739184 GGGTGTGTATGGGGGGGTGTGGG + Intergenic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1092045800 12:5431350-5431372 GCTTGAGTGTGGAAGGGAGAGGG - Intergenic
1092288595 12:7144751-7144773 GGGTGGGTTTAGAGGGGAGAGGG + Intronic
1092385508 12:8033212-8033234 GTGTGTGTTTGGAGGGGCGGGGG - Exonic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094297961 12:28928896-28928918 GCCTGTGTATGGAGTGGAGAGGG + Intergenic
1094842902 12:34349388-34349410 GGGTGGGTGTGGAGGGGACAAGG + Intergenic
1095705158 12:45228977-45228999 ACTTGGGTCTGGAGGGGAGAAGG + Intronic
1096197195 12:49656354-49656376 GTGTGTGTTTGCGGGGGAGAAGG - Intronic
1096231637 12:49900114-49900136 GGGTGTGTAGGGAAGGGAGGAGG + Intronic
1096545802 12:52339463-52339485 GAGTGTGTCTGAAGGTGAGAGGG - Intergenic
1096777971 12:53975162-53975184 GCGTCTGGAGGGAGGGGAGGGGG - Exonic
1097124548 12:56763471-56763493 GTGTGTGTGTGTAGGGGATATGG + Intronic
1097272261 12:57783284-57783306 GTGTGTGTGTGGAGGGGTGCAGG + Intronic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1098590698 12:72208175-72208197 GTGTGTGTATAAAGGGCAGAGGG - Intronic
1100738973 12:97570546-97570568 GAATGTGTATGGAGGGGTGGTGG - Intergenic
1101093635 12:101313710-101313732 GGGTGTGTGTGGTGGGGAGTGGG + Intronic
1101556953 12:105819013-105819035 GGGTGTGTGTGGAAGGAAGATGG + Intergenic
1101570850 12:105952246-105952268 GGGAGTGTTTGGAGAGGAGAGGG - Intergenic
1101738546 12:107482072-107482094 GCCTGTGCAGGGAGTGGAGAGGG + Intronic
1102430977 12:112882572-112882594 GCGTGTGTGTTGAGGGTGGAGGG - Intronic
1102576925 12:113861504-113861526 GTGTGTGTGTGAAGGAGAGAAGG + Intronic
1103316523 12:120060344-120060366 GGGTGTGTAGGGTGGGGTGAGGG + Intronic
1103360082 12:120348173-120348195 GCCTGTGTCTGAAGAGGAGATGG - Intronic
1104906488 12:132215988-132216010 ACGTGTGGAGGGAAGGGAGACGG + Intronic
1106048660 13:26169299-26169321 GAGAGTGTATGGGAGGGAGAAGG + Intronic
1106186563 13:27414973-27414995 GTGTGTATATTGTGGGGAGACGG + Intergenic
1107728545 13:43324782-43324804 GCGTGGGTGTGGTGGGGAGCAGG - Intronic
1108474587 13:50801283-50801305 GCAGGTGGATGGAGGGGTGACGG - Intronic
1109095426 13:58107861-58107883 GCCTGGGTATGGTGTGGAGAGGG + Intergenic
1110295243 13:73856523-73856545 GTGCGTGTATGGAGGAGGGAGGG - Intronic
1110638233 13:77790998-77791020 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
1112151454 13:96769113-96769135 GTGTGTGTTTGGTGGGGAGGTGG - Intronic
1112223470 13:97514514-97514536 GCCTGGGAATGGAGCGGAGAAGG + Intergenic
1112237437 13:97649051-97649073 GGATGTGGGTGGAGGGGAGAGGG - Intergenic
1113103658 13:106749387-106749409 GCGTGTGTGTGGCGGGGAGGGGG - Intergenic
1113333192 13:109352033-109352055 GTGTGTGTGTGGAGGTGAGAGGG + Intergenic
1113492139 13:110700439-110700461 GCGTGTGCAGAGAGGGGAGGCGG + Intronic
1113852415 13:113425266-113425288 GCGTGTGTGTGGCGGGGAAGTGG + Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1113954988 13:114095394-114095416 GGGACTGTAGGGAGGGGAGATGG - Intronic
1113957097 13:114104882-114104904 ACGTGTGTGGGGAGGGGAGTGGG - Intronic
1113957105 13:114104908-114104930 ACGTGTGTGGGGAGGGGAGGGGG - Intronic
1114069540 14:19096602-19096624 GTGAGTGTGTGGGGGGGAGAGGG + Intergenic
1114092722 14:19303401-19303423 GTGAGTGTGTGGGGGGGAGAGGG - Intergenic
1114479744 14:23025356-23025378 GCATATGTGTGGAGGGGAGAGGG - Intronic
1114492561 14:23112642-23112664 GGCTGGGGATGGAGGGGAGAAGG + Intergenic
1114811164 14:25901305-25901327 GTGTGTGTATAGGGGGGAGATGG - Intergenic
1116934971 14:50730432-50730454 GCGTGTGTATAGATGTGAGGTGG - Intronic
1118181041 14:63493494-63493516 GCGTGTGTGTGGTGGGGGGAGGG + Intronic
1119153065 14:72383230-72383252 GTATGTGTGTGGATGGGAGAGGG + Intronic
1119187116 14:72650840-72650862 GGGTGTCTGTGGAGGAGAGATGG - Intronic
1120015707 14:79470986-79471008 GTGTGTGTGTGTTGGGGAGAAGG + Intronic
1120353263 14:83392046-83392068 GTGTGTGTATGGATGTGAAAGGG + Intergenic
1120711952 14:87801876-87801898 GTGTGTGGATGTAGGGGACAAGG - Intergenic
1121564936 14:94902136-94902158 GTGTGTGTATGGTGGGGTGGGGG - Intergenic
1121777940 14:96603059-96603081 GAGTGTCTGGGGAGGGGAGAGGG + Intergenic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122690099 14:103528219-103528241 GAGTGTGTGTGCAGGGGAGCGGG - Intergenic
1122842231 14:104471601-104471623 GCGTGTGTGGGGAGTGGGGATGG - Intergenic
1122879470 14:104683603-104683625 GTGTGTGTGTGGTGGGGAGGGGG - Intergenic
1124563879 15:30797901-30797923 GTGGGTGGATGGAAGGGAGAGGG + Intergenic
1124632180 15:31344246-31344268 GCCTGTGTCAGGAGGGGAGTGGG + Intronic
1124636838 15:31371021-31371043 GGGTCTGTATGGGGGTGAGAGGG + Intronic
1124857162 15:33400363-33400385 GTGTGTGTGTGGCGGGGGGAAGG - Intronic
1125130544 15:36279254-36279276 GCCTGGGTATGGAATGGAGAGGG + Intergenic
1125383852 15:39115458-39115480 GCCTGAGCATGGAGTGGAGAGGG - Intergenic
1125391047 15:39193469-39193491 GAGTGTGTATGAAAGGGAGGGGG - Intergenic
1125809430 15:42524961-42524983 GCGTGTTTATGAAGGGGTGGTGG - Intronic
1126301906 15:47206805-47206827 GCCTGTGGATGGTGGGGAGAGGG - Intronic
1126702168 15:51378172-51378194 GTATGTGAATGGAGGTGAGATGG + Intronic
1127358376 15:58223672-58223694 GTATGTGTATTGAGGGGAGGGGG - Intronic
1127869064 15:63055095-63055117 GTGTGTGTATTGAAGGGTGAGGG - Intronic
1129375371 15:75126860-75126882 GCGTGTGTATGGGGGGGCTGGGG + Intergenic
1129894326 15:79092227-79092249 GCGTGTGTGTGGTGGGGTGTGGG - Intergenic
1130138528 15:81202467-81202489 GTGGGTGTAGGGAGGGGGGAGGG - Intronic
1130747350 15:86669832-86669854 AAGTGTGTGTGGAGGGGAGTGGG + Intronic
1130990936 15:88875232-88875254 GCGGGGGTGGGGAGGGGAGAAGG - Exonic
1131353003 15:91718590-91718612 GAGTGTGTGTTGAAGGGAGAAGG + Intergenic
1131527242 15:93162269-93162291 GAGTGTGTCTGGTGGGGAGGGGG - Intergenic
1131585093 15:93684435-93684457 GCCTGGGTATGGAGCAGAGAGGG - Intergenic
1131686790 15:94776941-94776963 GTGTGTGTATGGGGGGGAGGGGG - Intergenic
1132667125 16:1086636-1086658 TTGTGTGTGTGGAGGGGTGAGGG + Intergenic
1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG + Intronic
1133303810 16:4798026-4798048 GCGTGTGCATGGCGGGCAGTGGG + Intronic
1134474821 16:14564063-14564085 GCGTGTGTAGGGCGGGTAGTGGG - Intronic
1135173621 16:20208851-20208873 GGGTGGGTATTGAGGGGACAGGG + Intergenic
1136371179 16:29837030-29837052 ACGTGCGTCTGGAGGAGAGAAGG - Intronic
1137024706 16:35460902-35460924 GTGTGTGTGTGTTGGGGAGAGGG + Intergenic
1137356676 16:47773077-47773099 GCGTGTGTTTGCATGTGAGATGG + Intergenic
1138161612 16:54759986-54760008 GTGTGTGTATAGAGAGGGGAAGG + Intergenic
1138457294 16:57128742-57128764 GCGAGAGGATGGAGGGGTGACGG - Intronic
1138677687 16:58663917-58663939 GAGTGTGGCTGGAGCGGAGAGGG + Intergenic
1138983733 16:62301490-62301512 GCTTCAGTGTGGAGGGGAGAGGG - Intergenic
1139342618 16:66278346-66278368 GCCTGGGTGTGGAGTGGAGAGGG - Intergenic
1139342642 16:66278463-66278485 GCCTTGGCATGGAGGGGAGAAGG - Intergenic
1139631290 16:68233491-68233513 ATGTGTCTATGGAGGGGAGTTGG - Intronic
1140608553 16:76570536-76570558 GTGTGTGTGTGGAGGGGGGTGGG - Intronic
1140717266 16:77738050-77738072 GTGTGTGTATGAAAGCGAGATGG + Intronic
1141007103 16:80362869-80362891 GTGTGTGTATGTGGGGGTGAGGG + Intergenic
1141167299 16:81669159-81669181 GGGTGTGGAAGGAGGTGAGAGGG - Intronic
1141167339 16:81669345-81669367 GGGTGTGGAAGGAGGTGAGAGGG - Intronic
1141178282 16:81734894-81734916 GCGTGTGTGTGGTGGGGTGGGGG + Intergenic
1141210307 16:81973517-81973539 GCCTGGGCATGGAGCGGAGAGGG - Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1142139557 16:88466758-88466780 GGGTGTGTATGTGGGGGAGGGGG + Intronic
1143107890 17:4538495-4538517 GTGTGTGCATGGATGGGAGGTGG - Exonic
1143173933 17:4945833-4945855 GTGTGTGTATGGGGAGGAAAGGG + Exonic
1143866480 17:9927276-9927298 GTGTGTGTATGTAGTAGAGATGG - Intronic
1144399980 17:14886742-14886764 GCCTGAGTATGGAGTGGAGAGGG + Intergenic
1144458684 17:15439932-15439954 GCCTGTTTGTGGTGGGGAGAGGG + Intronic
1145279820 17:21458745-21458767 GTGTGTGTGTGGCGGGGAGCAGG + Intergenic
1145739143 17:27257678-27257700 GCCTGTGGCTGGAGTGGAGATGG - Intergenic
1146519658 17:33516422-33516444 GTGTGTGTATGGAGGAGGGGTGG + Intronic
1146710998 17:35041282-35041304 GTGTGTGTGTTGAGGGGAGGAGG - Intronic
1146959791 17:36964302-36964324 GAGTGGGGATGGAGTGGAGATGG + Intronic
1147042922 17:37731833-37731855 GGGAATGGATGGAGGGGAGATGG + Intronic
1147241148 17:39091300-39091322 GGGTGTGTGTTGCGGGGAGATGG - Intronic
1147314234 17:39611970-39611992 GAGTGTGTGTGGAGGGGAGGTGG + Intergenic
1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG + Intergenic
1148110918 17:45144357-45144379 GCCTCTGTGTGGAGGGGAGAGGG + Intergenic
1150004699 17:61462541-61462563 GAGGGTGCAGGGAGGGGAGAGGG + Intronic
1150250538 17:63702008-63702030 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1151104188 17:71593292-71593314 GTGTGTGTGTGGAGGGAATAGGG + Intergenic
1151191559 17:72401960-72401982 GCGGGGGTAGGGAGGGGAGTGGG - Intergenic
1151381296 17:73727471-73727493 GGGTGTGTGTGGAGGAGAAAGGG + Intergenic
1151654332 17:75488802-75488824 GGGTGAGGGTGGAGGGGAGAAGG - Exonic
1151891492 17:76953365-76953387 GCCTGTGTATGTGGGGGAGGTGG - Intergenic
1152077733 17:78169264-78169286 GTGTGTGTGTGGCGGGGAGGGGG + Intronic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152388277 17:79988106-79988128 GTGTGTGTTTAGAAGGGAGAGGG + Intronic
1152467671 17:80475242-80475264 GAGTGTGTCTGGATGGGGGAGGG + Intronic
1153301198 18:3593582-3593604 GTGTGTGTAAGGGGAGGAGAGGG + Intronic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1154518709 18:15202485-15202507 TAGTGTGTTTGAAGGGGAGAGGG - Intergenic
1155930533 18:31702861-31702883 GAGTGGATATGGAGGGGAAATGG + Intergenic
1156061823 18:33086807-33086829 TGGTGTGTGTGAAGGGGAGAGGG + Intronic
1157469358 18:47976701-47976723 GTGTGTGTGTGGAGGGGCGGGGG + Intergenic
1157910062 18:51608704-51608726 GCCTGTGCATGGTGGGGAGTGGG + Intergenic
1157918470 18:51692741-51692763 GTGTGTGTGTGGAGGGGAGGGGG + Intergenic
1157940345 18:51921706-51921728 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
1157966542 18:52215231-52215253 GTGTGTGTGTGGTGGAGAGAAGG - Intergenic
1159793087 18:72808458-72808480 GTGTGTGTGTGGTGAGGAGATGG + Intronic
1160440286 18:78884334-78884356 GCCTGGGTGTGGAGTGGAGAGGG - Intergenic
1161777372 19:6270937-6270959 GTGGGAGTACGGAGGGGAGAAGG - Intronic
1162184315 19:8892777-8892799 GCTTGTGTCTCTAGGGGAGATGG + Intronic
1162412632 19:10515621-10515643 GTGTGTGTTTGGTGGGGAGGGGG - Intronic
1162486005 19:10960993-10961015 GCGTGTGTGTGAAGGGGGGGCGG + Exonic
1163490872 19:17616551-17616573 GAGTGTGTGTGGAGGGGGCAGGG + Intronic
1163509021 19:17724459-17724481 GCGTGGGTCTGGAGGTGGGAAGG + Intronic
1163672180 19:18636024-18636046 GGGTGTGCAGGGTGGGGAGAGGG + Intergenic
1164678239 19:30117402-30117424 GTGTGTGTGTGGCGGGGGGAAGG + Intergenic
1164813221 19:31174759-31174781 ACATTGGTATGGAGGGGAGAGGG + Intergenic
1166417703 19:42608663-42608685 TCTTGTGTATGTAGGAGAGAGGG + Intronic
1166503797 19:43359261-43359283 ACGGGTGTAAGTAGGGGAGATGG + Intronic
1166506657 19:43375497-43375519 ACGGGTGTAAGTAGGGGAGATGG - Intergenic
1166991511 19:46695607-46695629 GCTTGTGTGCGGAGGGCAGATGG + Intronic
1167512531 19:49903349-49903371 GATGGTGTCTGGAGGGGAGACGG + Intronic
1167565678 19:50255176-50255198 GTGGGTGGGTGGAGGGGAGATGG - Intronic
1168328078 19:55548394-55548416 GTGTGTGTATGGGGGGGTGGTGG + Intergenic
925059194 2:878165-878187 GTGTGTGTGTGTAGGGGTGAGGG - Intergenic
925059207 2:878211-878233 GTGTGTGTGTGTAGGGGTGAGGG - Intergenic
925059228 2:878326-878348 GCGTGTGTGTGTAGGGGTGAGGG - Intergenic
925059256 2:878481-878503 GCATGTGTATGTAGGGGTGAGGG - Intergenic
925160158 2:1677928-1677950 GTGTGTGTGTGCAGCGGAGATGG + Intronic
925281833 2:2690419-2690441 GTGTGAGTAGGGAGGAGAGAGGG - Intergenic
925533250 2:4887438-4887460 GGGTGTGGCTGGAGGGGAGGAGG + Intergenic
925692168 2:6536639-6536661 ACCTATGTATGGAGAGGAGATGG - Intergenic
925768447 2:7259712-7259734 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
926096897 2:10087221-10087243 GTGTGTGTGTTTAGGGGAGAGGG - Intergenic
926327332 2:11796726-11796748 GAGTGTGCTTGGAAGGGAGAAGG + Intronic
926676403 2:15626182-15626204 GGGTATGTGTGGAGGGGAGAGGG - Intronic
927291833 2:21412357-21412379 GTGTGTGTGTGGAGGGGGGGTGG - Intergenic
927863028 2:26572164-26572186 GGGGGTGGGTGGAGGGGAGATGG - Intronic
928111844 2:28516895-28516917 GCGTGTGTATGGAGGGGAGAGGG + Intronic
929169920 2:38921306-38921328 GCATGTATCTGGAGGGGATAGGG + Intronic
929723015 2:44390519-44390541 GTGTGTGTGTGGGGGGGAGGTGG + Intronic
930210811 2:48635098-48635120 GCCTGGGCATGGAGTGGAGAGGG + Intronic
930255736 2:49088178-49088200 GCGTGTGTATGTGGTGCAGAGGG + Intronic
931516578 2:63053736-63053758 GTGTGTGTGTGCAGGGGAGAGGG + Intronic
932030768 2:68182077-68182099 GTGTGTGTGTGGTGGGGGGAGGG - Intronic
932036395 2:68251733-68251755 GAGTGAGTGTGGAGGGGAGGGGG + Intronic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
932495571 2:72144312-72144334 GAGTGTGTTTGGTGGGGAGAGGG - Intronic
933336745 2:80968119-80968141 GCCTGGGCATGGAGTGGAGATGG - Intergenic
933729254 2:85444910-85444932 GTCTGTGAATGGAGGGGAGAGGG + Intergenic
935987385 2:108688157-108688179 GCGTGTGTAGGGAGAGGCAAAGG - Intergenic
936126209 2:109790853-109790875 GCGTGTGTAGGGAGAGGCAAAGG - Intergenic
936218484 2:110580615-110580637 GCGTGTGTAGGGAGAGGCAAAGG + Intergenic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
937015723 2:118603498-118603520 GTGTGTGTGTTGAGGGCAGAGGG + Intergenic
937048014 2:118862937-118862959 TCATGTGTGTGGAGGGGACATGG - Intergenic
937246138 2:120495198-120495220 GTGTGTGTGTGGGGGGGGGAGGG - Intergenic
938343339 2:130549599-130549621 GCCTTTGGAAGGAGGGGAGAGGG - Intronic
938346494 2:130571123-130571145 GCCTTTGGAAGGAGGGGAGAGGG + Intronic
938775743 2:134539972-134539994 GCCTGTGCATGGAGGTGAGCGGG - Intronic
939124837 2:138165335-138165357 GCCTGTGTGTAGAGTGGAGATGG - Intergenic
939302869 2:140368957-140368979 AGGTGTGAATGGAGGGGAAAGGG + Intronic
940408453 2:153332703-153332725 GCCTGGGCATGGAGTGGAGAGGG + Intergenic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
941566662 2:167117301-167117323 GTATGTGTATGGCGGGGAGTGGG - Intronic
941580516 2:167292361-167292383 GCGTTTATTTGGAGGGAAGACGG + Intergenic
941587600 2:167379918-167379940 GCCTGTGCATGTAGAGGAGAGGG + Intergenic
942711649 2:178842971-178842993 GTGTGTGTGTTGAGGGTAGAGGG + Intronic
944607308 2:201363641-201363663 GCCTGAGCATGGAGGAGAGAGGG - Intergenic
944650851 2:201828878-201828900 GCATGATTAGGGAGGGGAGAGGG - Intronic
944839137 2:203608646-203608668 GAGGGAGTATGGAGGGGAGGGGG - Intergenic
944912776 2:204326710-204326732 GAGTGTGTATTGAGGGTAGAGGG + Intergenic
945490086 2:210444338-210444360 GCGTGTGGAAGTAGTGGAGAGGG - Intronic
946976614 2:225160039-225160061 GTGTGTGTGTGGAGGGGTGGGGG - Intergenic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
947741491 2:232486937-232486959 GTGTGTGCAGGGAGGGGACAGGG - Intronic
948163188 2:235841993-235842015 GCGTCTGCATGGAGTGGTGACGG - Intronic
948271446 2:236676932-236676954 GTGTGTGTGCGGAGGGGAGCAGG + Intergenic
948338529 2:237230650-237230672 GCATGAGTTTGGAAGGGAGACGG - Intergenic
948458421 2:238117946-238117968 GAGGGTGGATGGAGGGGAGGTGG + Intronic
948627224 2:239276590-239276612 GCCTGTGTCTGGAGAGCAGATGG - Intronic
948742317 2:240056128-240056150 GCGTGCGGCTGGAGGGGACACGG + Intergenic
948920712 2:241064728-241064750 GCGTGGGTGTGGAGGGGCGGGGG - Intronic
949042521 2:241855857-241855879 GTGTGTGTGTGGAGGTGGGAAGG + Intronic
1168755448 20:313836-313858 GCCAGTGTTTGGCGGGGAGAGGG - Intergenic
1168830534 20:842984-843006 GCGTGTGTGTGTAGGGGCGGGGG - Intronic
1170161659 20:13319731-13319753 GTGTGTGTGTGCAGGGGGGAGGG - Intergenic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1171447528 20:25215352-25215374 GAGTGTGTATGGAGGAGGAAGGG + Intronic
1171852053 20:30316020-30316042 GCATGTGTATGGGAGGGAGGAGG + Intergenic
1172129342 20:32645382-32645404 GGGGGTGTATGGAGGGGAGGGGG + Intergenic
1172215085 20:33230034-33230056 GTGTGTGTGTGGTGGGGTGAGGG - Intergenic
1172224151 20:33293328-33293350 GCATGTGGATGGAGGTGGGAAGG - Intronic
1172601989 20:36190417-36190439 CCATGTGTATGGAGGGGAGCAGG + Intronic
1173617651 20:44413549-44413571 GCATGTGGAATGAGGGGAGATGG - Intronic
1173653774 20:44684771-44684793 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1174404806 20:50296209-50296231 GCCTGTGTGTGGAGATGAGAGGG + Intergenic
1174439475 20:50538525-50538547 GCGTGTGTTTGGAGAAGAGTGGG + Intronic
1175109117 20:56633805-56633827 GCATCTGTATTGAGGGGAGGTGG + Intronic
1175403197 20:58712121-58712143 GTGTGTGTATTGAGGGGACGCGG + Intronic
1175714091 20:61244036-61244058 GCCTGTGTCTGGAGGGGAAATGG + Intergenic
1175790315 20:61736581-61736603 GCGAATGGATGAAGGGGAGAGGG + Intronic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1180488007 22:15819165-15819187 GTGAGTGTGTGGGGGGGAGAGGG + Intergenic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1182364174 22:29766808-29766830 GGGTGTGGATAGAGGGGCGAGGG - Intronic
1182551764 22:31104571-31104593 GCGTGTGTATGTGGGGGGGAGGG - Exonic
1182623289 22:31629509-31629531 GGGTGTGTATGTAGGTGCGAGGG + Intronic
1183055535 22:35303117-35303139 GTGTGTGTTGGGAGGGGAGGTGG - Intronic
1183948296 22:41339032-41339054 TCGTGGGCGTGGAGGGGAGAAGG - Exonic
1184023521 22:41836822-41836844 GTATGTGTATGGTGGGGATAAGG + Intronic
1184450759 22:44581204-44581226 CCGTGTGAATAGAGGAGAGATGG + Intergenic
1184924195 22:47625930-47625952 GTGGGAGTATGGAGGGCAGAGGG - Intergenic
1185288680 22:50013599-50013621 GTGTGTGTGTGGGGGGGGGATGG + Intergenic
949340053 3:3019722-3019744 GTGTGTATATGGTAGGGAGAAGG + Intronic
949627690 3:5886820-5886842 GTGTGTGTATGGGGGGGCGGTGG - Intergenic
950023804 3:9807118-9807140 GTGTGTGAAAGGAGGGGAGGTGG + Intronic
950190276 3:10971758-10971780 GTGTGTCTATGGAGGGGATCAGG + Intergenic
950472748 3:13196780-13196802 GTGTGTGTGTGGTGGGGAGCAGG + Intergenic
951194035 3:19804154-19804176 GCTTGGGTGTGGAGGGTAGAGGG - Intergenic
951966455 3:28391342-28391364 GTGTGTGTGTGGCAGGGAGAGGG - Intronic
952448539 3:33408370-33408392 GTGTGTGTGTGAAGGAGAGAGGG + Intronic
952966507 3:38624198-38624220 GTGTGTGTGTGTAAGGGAGAAGG - Intronic
954313837 3:49790192-49790214 GCATGTGTGTGAAGGAGAGAGGG - Intergenic
954640916 3:52097236-52097258 GTGTGTGTGTGGCGGGGAGAGGG + Intronic
955156820 3:56425199-56425221 GTGTGTGTTTTGTGGGGAGATGG - Intronic
955937508 3:64115454-64115476 GTGTGTGTCTGCATGGGAGATGG - Intronic
956167720 3:66408952-66408974 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
956369200 3:68539710-68539732 GCATGTGTGTGGTGGGGGGAGGG + Intronic
956638443 3:71390565-71390587 GTGTGTGTGTGGTGGGGAGGGGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
958755945 3:98249298-98249320 GGGGTTGTATGGAGGGGTGATGG - Intergenic
958980143 3:100710059-100710081 GCGTTTGGATTGAGAGGAGAGGG + Intronic
959948106 3:112148996-112149018 GCTTGTGTGTGGAGCAGAGATGG + Intronic
960591364 3:119368944-119368966 GGGTGGGTAGAGAGGGGAGAGGG + Intronic
960692662 3:120363183-120363205 GTGTGTGTGTGGTGGGGAGGAGG + Intergenic
961865860 3:129953061-129953083 GGGTGAGGATGGAGTGGAGAGGG - Intergenic
961869932 3:129979993-129980015 CCGTGTGTGTGTTGGGGAGAAGG - Intergenic
961951822 3:130757506-130757528 GTGTGTGTGTGTCGGGGAGAGGG - Intergenic
962358477 3:134715180-134715202 GGCTCTGTATGGAGGAGAGATGG - Intronic
962875952 3:139536194-139536216 ACTTGTGAATGGAGGGGAGCTGG - Intronic
965567968 3:170140952-170140974 GGGTGTGCCTGGTGGGGAGAAGG + Intronic
966351361 3:179035505-179035527 GAGTGTGTGTGGTGTGGAGAGGG - Intronic
966974187 3:185070556-185070578 GCCTGTGTTTGGGTGGGAGAAGG - Intergenic
967676513 3:192305518-192305540 GTGTGTGTCTGGAAGAGAGACGG - Intronic
968051886 3:195660159-195660181 GTGTGTGTGTGGTGGGGAGTGGG + Intergenic
968887348 4:3341656-3341678 GGGTGTGGGGGGAGGGGAGATGG + Intronic
969103022 4:4784304-4784326 GTGTGTGTGTGGTGGGGATAAGG - Intergenic
969230734 4:5828464-5828486 GAGTGTGTCTGCAGGGGAGCGGG - Intronic
969244479 4:5923583-5923605 GGGTAGGGATGGAGGGGAGAAGG + Intronic
970214968 4:13749381-13749403 GTGTGTGTCTGGGGGGGAGTTGG - Intergenic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
971337021 4:25732736-25732758 GTGTGTGTGTGGTGGGGAGTCGG + Intergenic
972446355 4:39148044-39148066 GTGTGTGTGTGGAGGGGGGGCGG - Intergenic
973001832 4:44961404-44961426 GCGTGAGCATGGAAGGGAGAAGG + Intergenic
973129813 4:46636504-46636526 GAGTGTGTATGTTGGGGATAGGG - Intergenic
973970203 4:56205562-56205584 GTGTGTGTGTGTTGGGGAGAAGG + Intronic
975276328 4:72505909-72505931 GCCTGGGTGTGGAGTGGAGATGG + Intronic
975335844 4:73174076-73174098 GCGAGGGAAGGGAGGGGAGAAGG + Intronic
976998784 4:91468353-91468375 TGGTGTGCAGGGAGGGGAGAGGG + Intronic
977003890 4:91541369-91541391 TGGTGTGCAGGGAGGGGAGAGGG - Intronic
981739246 4:147985118-147985140 GCTTGGGTATGGAGCAGAGAGGG + Intronic
982705116 4:158700545-158700567 GTGTGTGTGTGGTGGGGGGAGGG - Intronic
982843733 4:160223945-160223967 GCCTGGGTGTGGAGTGGAGAGGG + Intergenic
982934001 4:161447991-161448013 GTGTTTGTTTGGAGTGGAGAGGG + Intronic
983804183 4:171973075-171973097 GTGTGTGTATGTTGGGGAGGAGG - Intronic
984150382 4:176122881-176122903 GTGTGTGTATTGAGGGTAGGAGG + Intronic
984867300 4:184292613-184292635 GAGTGTGTGTGGAGGGGCGGGGG + Intergenic
984963788 4:185123672-185123694 GCGTGTGTGGAGAGGGGATAGGG + Intergenic
986603299 5:9495927-9495949 TAGTGTGTGTGGATGGGAGAGGG - Intronic
987191351 5:15481615-15481637 GCCTGTCTATGGATGGGAGTTGG - Intergenic
987591411 5:19932555-19932577 GTGTGTGTATTGTGGGGAGAGGG - Intronic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
989250446 5:39308238-39308260 GATTGTGTAAAGAGGGGAGAGGG - Exonic
989460835 5:41696655-41696677 GCCTGGGTATGGAGAGGAGAGGG + Intergenic
990701868 5:58482826-58482848 GCATGTGTGTGAAGGTGAGATGG + Intergenic
991044804 5:62211428-62211450 GTGTGTGTTTGTATGGGAGAGGG - Intergenic
992135022 5:73735938-73735960 GTCTCTGTATGGATGGGAGAGGG - Intronic
992179866 5:74185372-74185394 GTGTATGTTTGGATGGGAGAGGG - Intergenic
992775064 5:80082173-80082195 GTGTGTGTGTGGAGGGGGGTGGG - Intronic
993589186 5:89773078-89773100 GCATGTGTGTGAAGGGAAGAAGG + Intergenic
994225838 5:97250604-97250626 GCGTGTGTATGGGGTGGGGTGGG + Intergenic
994399725 5:99264072-99264094 GCCTGGGCATGGAGTGGAGAGGG - Intergenic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
994611065 5:102040347-102040369 TTGTGTGTATAGAGGGGAGGGGG - Intergenic
995148332 5:108811276-108811298 GCCTGGGTATGGAGTGGAGTGGG + Intronic
996198889 5:120645380-120645402 GTGTGTGTGTGGGGGGGGGATGG - Intronic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
996360620 5:122641443-122641465 GTGTGTGTGGGGAGGGGAGGGGG - Intergenic
997783645 5:136685735-136685757 GCATGGGTGTGGAGTGGAGATGG - Intergenic
998150560 5:139754952-139754974 GTGTGTGTGTGCAGTGGAGAGGG + Intergenic
998187514 5:139993114-139993136 GTGTGTGTGTGGTGGGGAGGGGG + Intronic
998457345 5:142283568-142283590 GCCTGTGTTTTGAGGTGAGATGG + Intergenic
998684224 5:144505713-144505735 GCATGTGTGTGGTGGGGGGAAGG + Intergenic
999475938 5:151899022-151899044 GTGTGTGTATGAAGGAGGGAGGG + Intronic
1000143462 5:158429632-158429654 GTGTGTGTGTGTAGGGGAGGAGG - Intergenic
1000795892 5:165663912-165663934 GTGTGTGTGTGGAGGGGTGCTGG + Intergenic
1001060789 5:168486848-168486870 GCGTGTGTATGCAGAAGAGGAGG - Intronic
1001254703 5:170174678-170174700 GGGTGTGTAGGGAGAGGATATGG - Intergenic
1001561300 5:172670752-172670774 GCGTGTGAATGAATGGGTGAAGG - Intronic
1001629982 5:173167907-173167929 GGGTGGGTATGGGCGGGAGATGG - Intergenic
1001681125 5:173557622-173557644 GTGTGTGTATGGGGGGCAGGGGG + Intergenic
1001750428 5:174126064-174126086 GTGTGTGTGTGGATGGGAGATGG - Intronic
1001930852 5:175672054-175672076 GTGTGTGTGTGGAGGGGTGAAGG - Intronic
1002838122 6:882641-882663 GATTGTTTATGGAGGGGAGCAGG + Intergenic
1002915858 6:1527237-1527259 GGGTGTGTGTGGAGGGGGCAGGG - Intergenic
1004009058 6:11663909-11663931 GTGTGTGTGTGTAGGGGAGGCGG + Intergenic
1004045782 6:12021487-12021509 GCATGTCTGTGGAGGGGAGGAGG - Intronic
1004244218 6:13956911-13956933 GTGTGTGTATGGTGGGGGGCGGG - Intronic
1005712561 6:28515858-28515880 GTGTGTGTAGGGAGTGGAGGTGG - Intronic
1005714839 6:28537012-28537034 GCGAGTGTCTGGATGGGAGTGGG + Intergenic
1006917361 6:37603145-37603167 GTGTGTGTGTGGAGGGGGGGCGG + Intergenic
1007098811 6:39230607-39230629 GTGTGTGTGTGGCGGGGAGAGGG - Intergenic
1007210174 6:40187386-40187408 GTGTGTGTGTGGCGGGGTGAGGG + Intergenic
1007323713 6:41044475-41044497 GCATGTGAATGGAGGCGAGCTGG - Intronic
1007341434 6:41193713-41193735 GTCTGTGGATGGAGAGGAGAGGG - Intronic
1007389961 6:41545430-41545452 GCGTGTGTGGGGCGGGGAGGGGG + Intergenic
1007561046 6:42808670-42808692 GGGTGTGTGTGGGGGAGAGATGG + Intronic
1007909467 6:45499047-45499069 GTGTGGGTATGGAGGAGAGTGGG + Intronic
1008646229 6:53517668-53517690 GTGTTTGTGTGGAAGGGAGAAGG + Intronic
1008936421 6:56997414-56997436 GTGTGTATGTGGTGGGGAGATGG - Intronic
1009656911 6:66558847-66558869 GCCTGGGCATGGAGTGGAGAGGG + Intergenic
1009787582 6:68358877-68358899 GCCTGTGGATGGAGTGGAGAGGG + Intergenic
1010948388 6:82005645-82005667 GCTTGGGTGTGGAGTGGAGAGGG - Intergenic
1011009908 6:82692128-82692150 GTGTGTATGTGGAGGGGAGGAGG - Intergenic
1011130089 6:84043641-84043663 GTGTGTGTATGGGGGGGTGAGGG + Intronic
1011311199 6:85981492-85981514 GAATGTGCATGGAGTGGAGAAGG + Intergenic
1012624818 6:101392929-101392951 GCGGGAGTTTGGTGGGGAGAGGG + Intergenic
1013874167 6:114803796-114803818 GTGTGTGTCTGCAGGTGAGATGG + Intergenic
1015156500 6:130102188-130102210 ACCTGTGGATGGATGGGAGATGG - Intronic
1016612025 6:146000474-146000496 GAGTGTGTGTGGAGGGGATGGGG + Intergenic
1016814097 6:148287685-148287707 GCGTGTGTGTGGGGGGGTGGGGG + Intronic
1017062116 6:150493564-150493586 GTGTGTGTGTAGAGGGGAGAGGG + Intergenic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1018378833 6:163239669-163239691 GCGTGTGTGTGTAGGGGTGGGGG - Intronic
1019265672 7:116286-116308 TCCTGAGTGTGGAGGGGAGATGG - Intergenic
1019732231 7:2634560-2634582 GCGGGGGGATGGAGGGGAGGTGG + Intronic
1020011379 7:4807621-4807643 GCGGGAGGAGGGAGGGGAGACGG - Intronic
1020401980 7:7789614-7789636 GGGTCTGTGGGGAGGGGAGAAGG - Intronic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1022537403 7:31106701-31106723 GCCTGTGGATGGAGGAGAGGAGG - Exonic
1022812731 7:33885557-33885579 GTGTGTGTTTGGTGGGGGGATGG - Intergenic
1023385704 7:39655400-39655422 ATCAGTGTATGGAGGGGAGATGG + Intronic
1024028133 7:45431654-45431676 GCTTGGGGATGGTGGGGAGAGGG + Intergenic
1024173356 7:46812247-46812269 GCCTTTGTAAGGACGGGAGAGGG + Intergenic
1024368569 7:48552947-48552969 GGGTGTGTAGGGAGGGAAGTGGG - Intronic
1024951050 7:54860663-54860685 GCAAGTTTATGGAGGGGAGTAGG + Intergenic
1026197826 7:68188241-68188263 GTGTGTGTTGGGAAGGGAGAGGG - Intergenic
1026734604 7:72941864-72941886 GGGTGTCTTTGGAGGTGAGAGGG - Exonic
1026784939 7:73296776-73296798 GGGTGTCTTTGGAGGTGAGAGGG - Intergenic
1027109138 7:75423154-75423176 GGGTGTCTTTGGAGGTGAGAGGG + Exonic
1027495134 7:78878771-78878793 GCCTGGGCATGGAGTGGAGAAGG - Intronic
1028796546 7:94908704-94908726 GGGGGTGTGTGTAGGGGAGAGGG + Intronic
1028873649 7:95796175-95796197 GTGTGTTTAGTGAGGGGAGAAGG + Intronic
1029737916 7:102474704-102474726 GTGTGTGTGTGGCGGGGATAGGG - Intronic
1029755048 7:102568354-102568376 GTGTGTGTGTGGCGGGGATAGGG - Intronic
1029772998 7:102667434-102667456 GTGTGTGTGTGGCGGGGATAGGG - Intronic
1030106250 7:105989859-105989881 GGGGGTGTATGGTGGGGACAGGG - Intronic
1030750111 7:113222108-113222130 GTGTGTCTATGGAGTGGTGATGG - Intergenic
1031406926 7:121396595-121396617 GCGTGTAAACGGTGGGGAGACGG - Intergenic
1032010359 7:128342937-128342959 GCATGTGTATAGTGGGGAGAGGG - Intronic
1032417449 7:131747319-131747341 GTGTGTGTATGGAGGGGTGGGGG + Intergenic
1032743128 7:134759580-134759602 GCATGTGTGTGCAGGGGTGAAGG + Intronic
1033027386 7:137788684-137788706 GTGTGTGTATGGCAGGGGGATGG - Intronic
1033181331 7:139182088-139182110 GTGTGTGTGTGGAGGGGCGGGGG + Intronic
1033279773 7:139997556-139997578 GTGTGTGTATAGTGGGGGGAGGG - Intronic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1034355163 7:150445440-150445462 GAGTGGGTGGGGAGGGGAGAGGG + Intergenic
1034378024 7:150663916-150663938 CCATGTGTAGGGAGGGGACATGG + Intergenic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1035299480 7:157887725-157887747 GAGTGGGTATGGTGGGGAGTGGG - Intronic
1035359455 7:158300771-158300793 CCGTGTGGAGGGAGGGGAGGTGG + Intronic
1035555754 8:565883-565905 GCGTGTGTAGGGAAGGGAACGGG + Intergenic
1037321863 8:17651179-17651201 GCGTGTGTATGGTGGGAGGTGGG + Intronic
1037870403 8:22489386-22489408 GCATGTGTATACTGGGGAGAGGG - Intronic
1037885083 8:22591667-22591689 GCGTGAGTGTGGAGGGGGGTGGG + Exonic
1037907907 8:22726271-22726293 GCTTAGGTATGGAGGGCAGATGG + Intronic
1038533824 8:28339590-28339612 GTGTGTGTGTGGAGTGGGGAGGG - Intronic
1039064686 8:33598469-33598491 GTGTGTGTCTTGAGGGGAGGGGG + Intronic
1039143464 8:34419355-34419377 ATGTGTGTGTGTAGGGGAGAGGG + Intergenic
1040060688 8:43100551-43100573 GGGTGCTTATGGAGGGGAGGTGG + Intronic
1040570522 8:48605389-48605411 GACTGTGAATGGAGGAGAGAAGG + Intergenic
1040969439 8:53117821-53117843 GTGTGTGTGTGGTAGGGAGAAGG + Intergenic
1041136422 8:54764044-54764066 GCGTGAGTCTGGAGTGGAGGTGG - Intergenic
1041330355 8:56717523-56717545 GTGTGTGTATTTAGGGGAGGGGG - Intergenic
1041714119 8:60918195-60918217 GTGTGTGTATGGTGGGGAGGGGG + Intergenic
1042448841 8:68921277-68921299 GTGTGTGTATGGTGGGGGGGGGG + Intergenic
1042465506 8:69125877-69125899 GTGTGTCTATGCAGGTGAGATGG - Intergenic
1042611532 8:70607141-70607163 GCGTGTGTATTGGGGAGCGAGGG + Intronic
1042702647 8:71633455-71633477 GTGTGTGTGTTGGGGGGAGATGG + Intergenic
1044308585 8:90666282-90666304 GCCTGTGTATGGAGCAGAGAGGG + Intronic
1044554019 8:93542476-93542498 GAGTGAGTTTGAAGGGGAGAGGG + Intergenic
1044755712 8:95458989-95459011 GCCTATGTATGGAGGAGACAAGG - Intergenic
1044762439 8:95535791-95535813 GCAGGTGTGTGGAGTGGAGAGGG - Intergenic
1045739143 8:105334150-105334172 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
1046360494 8:113147660-113147682 GTAGGTGTGTGGAGGGGAGAGGG + Intronic
1046619207 8:116510150-116510172 GTGTGTGTATGTGGGAGAGAGGG - Intergenic
1047599472 8:126411733-126411755 GTGTGTGTATGGGGGATAGAGGG + Intergenic
1048141646 8:131800882-131800904 GTGGGTGTATGGAGGTGGGACGG + Intergenic
1048303861 8:133269996-133270018 GCATGTGTATGGTGGGTAGCAGG - Intronic
1048351159 8:133617842-133617864 GTGTGTGTATGGGGCGGGGAGGG + Intergenic
1048995469 8:139791310-139791332 GTGTGTCTGTGCAGGGGAGACGG - Intronic
1048995501 8:139791565-139791587 GTGTGTCTGTGCAGGGGAGATGG - Intronic
1049452634 8:142670189-142670211 GCGCGGGCAGGGAGGGGAGAGGG + Intronic
1049456093 8:142690103-142690125 GTGTGTGTGTGGAGGGGAGGCGG + Intergenic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1050933796 9:11366903-11366925 GCGTGGGCAGAGAGGGGAGAGGG + Intergenic
1050980665 9:12009813-12009835 GTGTGTGTATTTAGTGGAGACGG - Intergenic
1051604798 9:18908649-18908671 GGGTGTGTGTGGAGTGGGGAGGG - Exonic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1052197894 9:25740373-25740395 GTGTGTGTATGGAGTGGAGAGGG + Intergenic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1053056640 9:34996885-34996907 GTGTGTGTGTGCTGGGGAGATGG + Intronic
1053345780 9:37377300-37377322 GTGTGTGTGTGTAGGAGAGAAGG + Intergenic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1053789835 9:41679276-41679298 GCATGTGTATGGGAGGGAGGAGG + Intergenic
1054155305 9:61635480-61635502 GCATGTGTATGGGAGGGAGGAGG - Intergenic
1054178175 9:61890966-61890988 GCATGTGTATGGGAGGGAGGAGG + Intergenic
1054659354 9:67689858-67689880 GCATGTGTATGGGAGGGAGGAGG - Intergenic
1054696667 9:68367299-68367321 GGGTGGGCATGAAGGGGAGAGGG - Intronic
1055008282 9:71534483-71534505 GTGTGTGTGTGGAGGGGTGGTGG + Intergenic
1055428267 9:76217900-76217922 GCGTTTGTATGGATGGGGGTGGG - Intronic
1055433255 9:76266541-76266563 GCATGTGCATGGAGGGGATCAGG - Intronic
1055494932 9:76844594-76844616 GTATGTATGTGGAGGGGAGATGG - Intronic
1055666018 9:78553886-78553908 GTGTGTGTATTGAGGGGAATTGG + Intergenic
1056102928 9:83317179-83317201 GTGTGTGTATGCATGAGAGACGG - Intronic
1056136269 9:83632189-83632211 GAGTGGGAATGGCGGGGAGATGG - Intronic
1057314319 9:93958889-93958911 GGGTGTGGGTGGAGGGGAGGTGG - Intergenic
1057483449 9:95463356-95463378 GGGTGAGCGTGGAGGGGAGACGG + Intronic
1057730412 9:97603387-97603409 GTGTGAGTATGAAGGAGAGAGGG - Intronic
1057846597 9:98530909-98530931 GTGTGTGTATAGAGGGGGAAGGG + Intronic
1058677159 9:107410161-107410183 GCGTCTGTCTGGAGGTGAGGGGG - Intergenic
1058758115 9:108102599-108102621 GTGTGTGTATGTTGGGGAGTAGG + Intergenic
1059246894 9:112856459-112856481 GCATGGGTGTGGAGGGGAGTGGG + Intronic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059516544 9:114901045-114901067 GTGTGTGTGTGGTGGGGAGGTGG + Intronic
1059541634 9:115136269-115136291 GTGTGTGTATGTTGGGGGGATGG + Intergenic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060824338 9:126679388-126679410 GAGGGTGGATGGAGGGGGGATGG + Intronic
1061418195 9:130459430-130459452 GTGTGTGTGTGTGGGGGAGAGGG + Intronic
1061483410 9:130908489-130908511 GTGGGTGGAAGGAGGGGAGATGG - Intronic
1061699827 9:132407430-132407452 GCATGTGAATGCAGGGGAGGGGG + Intergenic
1061892848 9:133631854-133631876 CCCTGTGTATGGAGGAGAGATGG + Intergenic
1185709724 X:2293809-2293831 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
1185853939 X:3516035-3516057 GCGTGTGTGTGTATAGGAGATGG - Intergenic
1186015722 X:5191060-5191082 GCGTGTGTGTGGTGGAGACAGGG - Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1186789075 X:12979402-12979424 GAGTGTGTATGGGGGGGAGGTGG + Intergenic
1187654849 X:21460070-21460092 GAGTATGTATGGTGGGAAGACGG - Intronic
1187940504 X:24376178-24376200 GTGTGTGTGTGGTGGGGAGTGGG + Intergenic
1188170465 X:26918187-26918209 GTGTGTGTGTGGAGGGGGGTGGG + Intergenic
1188473868 X:30569345-30569367 GTGTGGGTATGTAGGGGAAATGG + Intronic
1188509677 X:30921845-30921867 GAGAGTATATGGAAGGGAGAGGG - Intronic
1188747376 X:33862751-33862773 GGGTGGGTGTGGAGGGGAGGTGG - Intergenic
1188894718 X:35653068-35653090 GCGTGTGTATGGATGGGACAGGG - Intergenic
1189700694 X:43714774-43714796 GTGTGTGTGTGGTGGGGAAATGG + Intronic
1189760923 X:44320789-44320811 AGGAGTGAATGGAGGGGAGAAGG - Intronic
1190420817 X:50282495-50282517 CAGTGTGTATGTAGGGGACATGG + Intronic
1190508638 X:51154685-51154707 CCGTGTGTATGGTGGGGATAAGG + Intergenic
1191774067 X:64793352-64793374 GCTTGGGCATGGAGTGGAGAGGG - Intergenic
1192146839 X:68688110-68688132 GTGTATGTATGGAGGGGAAAGGG + Intronic
1192556111 X:72090801-72090823 GTGTGTGTATGGAGAGGGGGTGG + Intergenic
1193470883 X:81901808-81901830 GCATCTAGATGGAGGGGAGAAGG - Intergenic
1193779759 X:85686841-85686863 GGGTGTGTGTGCAGGAGAGAAGG + Intergenic
1193814021 X:86084383-86084405 GCATGTATAGGGAGGGGAGGGGG - Intergenic
1194923554 X:99796317-99796339 GCCTGGGCATGGAGTGGAGAGGG + Intergenic
1194976890 X:100405559-100405581 GTGTGTGTATGGGGGGGGGAGGG - Intronic
1195606078 X:106807199-106807221 GTGTGTGTATGGGGGGGGGCGGG - Intronic
1195810627 X:108825058-108825080 GCTTGAGTTTGGTGGGGAGAAGG - Intergenic
1195968075 X:110447450-110447472 GTGTGGGGATGTAGGGGAGATGG + Intronic
1196025134 X:111034027-111034049 TTGTGTGTATGGCAGGGAGAGGG - Intronic
1196339103 X:114575576-114575598 GTGTGTGTGTGGGGGGGAGTGGG - Intergenic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1197175009 X:123476364-123476386 GTGTGTGTGTGTTGGGGAGAGGG + Intronic
1198638818 X:138732782-138732804 GCTTGTGTATGGATGGGCGAGGG + Intronic
1198847585 X:140929348-140929370 GTATGTGTGTGGAGGGGAGGAGG + Intergenic
1198968233 X:142250425-142250447 GCCTGTGTGTGGAGTGCAGAGGG + Intergenic
1199109710 X:143916372-143916394 GAGTATGTATAGAGGGGTGAGGG - Intergenic
1199571091 X:149267992-149268014 GTGTGTGTATGTATGGGTGAGGG + Intergenic
1202391504 Y:24375052-24375074 GGGTGTGTGTGGAGTGTAGAGGG - Intergenic
1202479281 Y:25295065-25295087 GGGTGTGTGTGGAGTGTAGAGGG + Intergenic