ID: 928114415

View in Genome Browser
Species Human (GRCh38)
Location 2:28536943-28536965
Sequence GTCCCCCGCCTCTCCAGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928114409_928114415 25 Left 928114409 2:28536895-28536917 CCAGGGGTTTCTACAGCAAGATT 0: 1
1: 0
2: 0
3: 14
4: 129
Right 928114415 2:28536943-28536965 GTCCCCCGCCTCTCCAGGGACGG 0: 1
1: 0
2: 3
3: 23
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928114415 Original CRISPR GTCCCCCGCCTCTCCAGGGA CGG Intronic
900368968 1:2323114-2323136 GTCCCCGCCCCCTCCTGGGATGG + Intronic
900564497 1:3325697-3325719 GTCCCCAGCCTCTCCAGGTCTGG + Intronic
900579286 1:3400580-3400602 GTCCCAAACCTCTCCGGGGAAGG - Intronic
901822992 1:11842174-11842196 GACCCCGGCCTCTCGAGGGCTGG + Exonic
902140237 1:14347469-14347491 GTCCCCAGCCTCCCCAAGGCTGG + Intergenic
902684921 1:18070143-18070165 GTGCCCTCCCTCTGCAGGGAGGG + Intergenic
904632042 1:31849540-31849562 CTTCCTCGCCTCTCTAGGGAAGG + Intergenic
905237433 1:36559887-36559909 GTCCCCAGCCTCTTCTGTGATGG + Intergenic
912744695 1:112236012-112236034 ATTCCCTGCCTCTCCAGGAAAGG - Intergenic
915359622 1:155278060-155278082 GCCCCCAGCCTGTCCAGGCACGG - Intronic
915626725 1:157118463-157118485 GTGCCTCTCCTCTCCCGGGATGG - Intergenic
923021574 1:230168111-230168133 GTCCACCGCCTCCCCAGTCAGGG - Intronic
923047882 1:230368768-230368790 TTCCCCGGCCTCACCAGGGCAGG - Intronic
924179148 1:241424067-241424089 GCCCGCCGCCGCTGCAGGGAGGG + Intergenic
1063278634 10:4599295-4599317 GTTCTCCACATCTCCAGGGAAGG - Intergenic
1064552730 10:16520306-16520328 GACCCCCGCCTCTCCAGGGTGGG + Intronic
1076541799 10:131219619-131219641 GTCTCCCGCCTCCCCAGGGAAGG + Intronic
1076686879 10:132202176-132202198 GTCCTGCGCCTCTCCTGGGAAGG - Intronic
1077108969 11:853809-853831 CTCCCCAACCTCTGCAGGGAGGG - Intronic
1077372284 11:2188730-2188752 GACGGGCGCCTCTCCAGGGAAGG + Intergenic
1082005945 11:47419047-47419069 GCCCCCATCCTGTCCAGGGAGGG + Intronic
1083582645 11:63834942-63834964 GTCCACCACCTCGCCAGAGAAGG - Intergenic
1084694635 11:70746249-70746271 CTCTCCCGCCTCTCCAGGACAGG + Intronic
1084694667 11:70746348-70746370 CTCTCCCGCCTCTCCAGGACAGG + Intronic
1084694698 11:70746447-70746469 CTCTCCCGCCTCTCCAGGACAGG + Intronic
1084742455 11:71148456-71148478 ATCCCCCACCTCTGCAGGGCAGG + Intronic
1085305177 11:75481770-75481792 TGCCCCCGCCTCCCCAGGAAGGG + Intronic
1087039524 11:93784819-93784841 GGCCTCCGCCTCTCCCGCGATGG + Intronic
1087491022 11:98827506-98827528 GTCCTCAGCCTCTCCAGTGTTGG + Intergenic
1088679492 11:112226715-112226737 CTCCCCCACCCCTCCAGGGCTGG - Intronic
1089432737 11:118436800-118436822 GTCCTCAGCCTCTTCAGGGCCGG + Exonic
1089705055 11:120271820-120271842 GTCCCCTCCCTCTTCTGGGAGGG + Intronic
1092487450 12:8914681-8914703 CGCCCCCGCCCCTCCAGGAAGGG + Exonic
1092860572 12:12716741-12716763 GCCCCCAGCCTCCCCAGGGATGG + Intronic
1096389692 12:51218448-51218470 TTCCCCCGCCTTTCTAGGGAGGG - Intergenic
1096514027 12:52146635-52146657 AGCCCCAGACTCTCCAGGGATGG + Intergenic
1096946722 12:55414960-55414982 CGCCCCCGCCCCTCCAGGAAGGG - Intergenic
1097029674 12:56081655-56081677 GCCTCCTGCCTCCCCAGGGAGGG - Intronic
1097050773 12:56221843-56221865 GGTCCCAGCCTCTCCCGGGAAGG + Exonic
1098123795 12:67269528-67269550 GGCCCACGCCTCGCCAGGGAGGG + Exonic
1098249797 12:68557647-68557669 GTTCCCAGCATCTTCAGGGAGGG + Intergenic
1100997326 12:100316554-100316576 GTTCCCCTCCTTTCAAGGGAAGG - Intronic
1101591424 12:106128745-106128767 ATTCCCCGCCCTTCCAGGGAAGG + Intronic
1107722882 13:43267398-43267420 GGCCCCAGCCCCTCCAGGGAAGG - Intronic
1113345372 13:109472542-109472564 GTCCCTCGCTTTTCCAGGCAGGG - Intergenic
1113417413 13:110138855-110138877 GGCCCCGGCCTCTGGAGGGATGG - Intergenic
1113430907 13:110249450-110249472 GTCCCCGGCCACACCAGGGCAGG + Intronic
1117070070 14:52048293-52048315 GTCTCCCCCTTCTTCAGGGAAGG - Intronic
1118005603 14:61562158-61562180 CCCCACCTCCTCTCCAGGGAGGG + Intronic
1122031534 14:98915960-98915982 GTCCCTCTCCTCTCCAGGGAAGG + Intergenic
1123587435 15:21772635-21772657 GGCCCCATCCTCTCCAGGGCAGG - Intergenic
1123624073 15:22215200-22215222 GGCCCCATCCTCTCCAGGGCAGG - Intergenic
1124618796 15:31262294-31262316 ATCCCCAGCCTCTCCATGTATGG + Intergenic
1125517450 15:40330367-40330389 GTCCCCTCCCTCTCCCGCGAAGG + Intergenic
1125744151 15:41987733-41987755 GTCACCCTCCCCTCCAGGCAGGG + Intronic
1127914765 15:63446316-63446338 GTCCCCAGCCTTTTCTGGGAAGG - Intergenic
1128156551 15:65395253-65395275 GTCCCCCGTGTCACCAGGCATGG - Exonic
1132021731 15:98368352-98368374 TTCCCCAGCGTCTCCCGGGAAGG - Intergenic
1132729567 16:1354857-1354879 GTCCCCCGCGTCTGTAGGGCTGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132879483 16:2155707-2155729 GTTCCCCGCCTCTCCGGGCCCGG - Intronic
1133103549 16:3493409-3493431 GTCCTGTGTCTCTCCAGGGATGG - Intergenic
1134683653 16:16143936-16143958 GTCAGCTGCCTCTCCAGGGTAGG + Intergenic
1135405392 16:22194069-22194091 GTGCCTCTCCTCTCCTGGGAGGG - Intergenic
1138334416 16:56241236-56241258 GTCCCACTGCTATCCAGGGAAGG + Intronic
1141140957 16:81496702-81496724 GACCCCCGCCTCTACTGGGATGG - Intronic
1141423904 16:83933433-83933455 CTCCCCCACCTCTACAGGGCCGG + Intronic
1141626992 16:85266645-85266667 ACCCCCTACCTCTCCAGGGAGGG + Intergenic
1141687817 16:85580345-85580367 GCCTCCCGCTTCTCCAGGAAGGG - Intergenic
1141696005 16:85619755-85619777 GTGCTCCTCCTCCCCAGGGAGGG + Intronic
1141899026 16:86978434-86978456 GTCCCCATCCTCTCCAGGCTGGG + Intergenic
1142095109 16:88235161-88235183 GCACCGGGCCTCTCCAGGGATGG + Intergenic
1142636422 17:1260334-1260356 CCCCCCCGCCTCTCCAGGAGTGG - Intergenic
1143492136 17:7290664-7290686 TTCCACTGCCTCTCCAGGGAGGG - Intronic
1143584404 17:7844136-7844158 GGCCCCCGCCCCCCAAGGGAGGG - Intronic
1143595757 17:7912572-7912594 CTCCCCGGCCCCTCCTGGGAGGG - Exonic
1143610104 17:8013138-8013160 GTTCCCCGGCGCTCCAGGGCTGG - Exonic
1143615517 17:8047085-8047107 AGCCCTCGGCTCTCCAGGGACGG - Intronic
1144201130 17:12943681-12943703 GGCCCTCCCTTCTCCAGGGAAGG - Intronic
1144762480 17:17715181-17715203 GTCCCCTGGCTCTCCAGGAGAGG - Intronic
1145271102 17:21405387-21405409 CTGCCAGGCCTCTCCAGGGAGGG + Intronic
1145309303 17:21692774-21692796 CTGCCAGGCCTCTCCAGGGAGGG + Intronic
1145833031 17:27932773-27932795 GTCTCCCTACCCTCCAGGGAAGG + Intergenic
1145998029 17:29115583-29115605 GTCCCCTCCCGCCCCAGGGATGG + Intronic
1146159221 17:30550927-30550949 GCCCCCAGCCTCTCCCAGGAAGG + Intergenic
1147186852 17:38717638-38717660 GTCCCCAACCTGCCCAGGGAAGG - Intronic
1147369764 17:39984228-39984250 GTCCCCCACCACTCCAGGCAAGG - Intronic
1151362373 17:73596353-73596375 GTCATGCCCCTCTCCAGGGAGGG - Intronic
1151472602 17:74327217-74327239 GTCCCCTACCTCTCAAGGGTGGG + Intronic
1151478351 17:74356051-74356073 GTCCCTGACCTCTCCTGGGAGGG - Intergenic
1151890525 17:76948421-76948443 GTCCCCAGCCCCTCCAGGCCAGG + Intronic
1152239239 17:79152938-79152960 CTCCCCTGCCTCACCAGAGAAGG - Intronic
1152711092 17:81870923-81870945 GCCCCCCGCGTCCCCAAGGAGGG + Intronic
1155284288 18:24272115-24272137 GTCCCCGACCTCTCCTCGGAGGG - Intronic
1156346030 18:36257908-36257930 CTCGTCCGCCTCTGCAGGGATGG + Intronic
1157399257 18:47373396-47373418 GTCCAGGGCATCTCCAGGGAAGG - Intergenic
1157524842 18:48372932-48372954 GGCCCCAGCATGTCCAGGGAGGG - Intronic
1160184063 18:76660908-76660930 GTCCCCAGCCCCTCCAGGGCGGG - Intergenic
1160234880 18:77077994-77078016 TGCCCCGGCCTCTCCAGGGAGGG + Intronic
1160720799 19:596125-596147 GGTCCCCGTCTCTCCAGGGCTGG - Intronic
1160985293 19:1835852-1835874 TTCCCCAGCCTCTCCAGCCAGGG + Intronic
1161561246 19:4973733-4973755 GTTCCCCGCCCCAACAGGGAAGG - Intronic
1162376689 19:10309376-10309398 GTCCTCGGCTTCTCCTGGGAGGG + Exonic
1162900878 19:13795117-13795139 CTCCCCCGCCTCTCTTGGGCTGG - Intergenic
1163700850 19:18785845-18785867 GTCTCCCACCTCTCAGGGGACGG - Exonic
1163804276 19:19386434-19386456 GGACCCCGTCTCTCCAGGCAGGG + Intronic
1165067855 19:33239447-33239469 GGCCCCAGCCTATCAAGGGAGGG - Intergenic
1165389979 19:35533324-35533346 GTCCCATGCCTCTACGGGGATGG + Intergenic
1165396942 19:35569613-35569635 TTCTCCCGCCTCTCCAGGCCAGG + Intergenic
1165738587 19:38192821-38192843 GACCCCAGCCTCCCCAGGGTTGG + Intronic
1166371250 19:42302464-42302486 CGCCGCCTCCTCTCCAGGGACGG + Exonic
1167250594 19:48396671-48396693 GGCCCCTGTCTCCCCAGGGAAGG - Intronic
1167753455 19:51394891-51394913 GACCCCAGAATCTCCAGGGACGG - Intergenic
1168334931 19:55592296-55592318 GGCCCCCACCTCTCCAGTCAGGG + Exonic
925880809 2:8350789-8350811 TTCCCCAGCCTGTCCAGGAATGG - Intergenic
926268086 2:11344348-11344370 GTTCCCCGCCGCTCCCGGCAGGG - Exonic
927673578 2:25089037-25089059 GTCCACAGGCCCTCCAGGGAAGG - Intronic
928114415 2:28536943-28536965 GTCCCCCGCCTCTCCAGGGACGG + Intronic
930198336 2:48530256-48530278 GGACCCCCCCTCTCCAGGGTGGG + Intronic
933686234 2:85143711-85143733 CTCCTCCTCCTCTCCAGAGAAGG + Intronic
937368666 2:121283347-121283369 GTCCCCTGACTCTAGAGGGAGGG - Intronic
937482130 2:122272760-122272782 GACACCCACCTCCCCAGGGAGGG + Intergenic
940628319 2:156205338-156205360 GTCCCCCGCCACTTCCAGGAGGG - Intergenic
1169116856 20:3071793-3071815 GTCCCGCGGCGCTCCGGGGAGGG + Intronic
1169919668 20:10721301-10721323 GTCTCATGCCTCTCCTGGGAGGG + Intergenic
1173428259 20:42961655-42961677 GCCCCCACACTCTCCAGGGAGGG + Intronic
1174236257 20:49094942-49094964 GTCTACCGCCTGTCCAGGAAGGG + Exonic
1174376309 20:50128854-50128876 GCTCCCAGCTTCTCCAGGGATGG - Intronic
1175318590 20:58069822-58069844 GTCCCCTGCCCCACCAGGGATGG + Intergenic
1175591120 20:60192976-60192998 GTCCCCCTCCCCTCAAAGGATGG - Intergenic
1176416031 21:6475239-6475261 GTCACACTCCTCTCCAGGGAAGG - Intergenic
1178310972 21:31529805-31529827 GCCCCCTTCCTCTCGAGGGAAGG + Intronic
1178350937 21:31872961-31872983 GGCCCTCCCCTCTCCAGCGAGGG + Intergenic
1179553921 21:42160488-42160510 CTGCCCCGCGGCTCCAGGGAGGG - Intergenic
1179691531 21:43083573-43083595 GTCACACTCCTCTCCAGGGAAGG - Intergenic
1180178110 21:46099838-46099860 GTTCCCCGCCACTTCTGGGATGG - Intronic
1180866275 22:19121870-19121892 GGCCGCCGCCGCTCCCGGGAAGG + Intronic
1181771693 22:25130597-25130619 GTCCCCCGCCCCTCACAGGATGG - Intronic
1184521387 22:44996218-44996240 GTTCCCAGCCTCGGCAGGGATGG - Intronic
1185116149 22:48939551-48939573 GCTCCCCTCCGCTCCAGGGATGG + Intergenic
1185376272 22:50483874-50483896 GTCCCCCGTCCCCCCAGGGAAGG - Exonic
950673409 3:14540367-14540389 CTCCCTCCCCTCCCCAGGGAGGG + Exonic
952956976 3:38563486-38563508 GCCCCCCGACTCTCCAGGATTGG - Intronic
957034992 3:75285780-75285802 GTCCCTCACATGTCCAGGGAAGG - Intergenic
957560508 3:81814963-81814985 GTCCCCTGCCTCTAAAGGAAGGG + Intergenic
960873501 3:122274436-122274458 GTCCCACTCCACTCCAGAGATGG - Intronic
961016729 3:123474130-123474152 GACCCTCGACTCTCCAGTGAAGG + Intergenic
962254927 3:133864081-133864103 CGCACCAGCCTCTCCAGGGAAGG + Intronic
968521538 4:1036708-1036730 GGCCCCGGCCTCACCAGGGAAGG - Intergenic
969442920 4:7227864-7227886 GCCCACCGCACCTCCAGGGAGGG - Intronic
969533180 4:7740665-7740687 GGCCCCGGCCTCTGCGGGGAAGG - Exonic
970270798 4:14345341-14345363 CTCCCCCACCTGTCCAGGGAGGG + Intergenic
970824508 4:20254606-20254628 GCCCCCCACTTCTCCGGGGAGGG + Intronic
972247421 4:37259836-37259858 GTCTTCCTCCCCTCCAGGGAAGG + Intronic
981728747 4:147875319-147875341 GTACCCCCTCTCTCCAGGGCTGG - Intronic
987928001 5:24365893-24365915 CTCCCCAGCCACTCCAGGCAAGG + Intergenic
997472031 5:134122534-134122556 ATCCCCAGCCCCTCCAAGGAGGG + Intronic
998135086 5:139670206-139670228 CCCCCACGCCTCTGCAGGGAGGG + Intronic
998652875 5:144141018-144141040 GGCCCCCCCCACTCCTGGGAGGG - Intergenic
999113597 5:149142325-149142347 GCCGGCCGCCTCTCCTGGGAAGG + Intronic
1000618732 5:163459691-163459713 AGCCCCCGCCTCTTCAGGGCAGG - Intronic
1003555600 6:7137169-7137191 GTCCCCTGGCTTTCCTGGGAAGG + Intronic
1006338127 6:33431629-33431651 CTCCCCCTCCAGTCCAGGGAGGG + Intronic
1007220777 6:40277093-40277115 GACCCCCACCTCTCCATGGCAGG - Intergenic
1007428901 6:41764998-41765020 GGCTCCCGTTTCTCCAGGGATGG - Intergenic
1007528603 6:42520154-42520176 GTCCACCTCCTCTGCTGGGAAGG - Intergenic
1007736368 6:43984815-43984837 CTCCCCCGCCCCGCCAGGGCTGG + Intergenic
1007748739 6:44059008-44059030 CTCCCCCGCCTCCCTGGGGAGGG + Intergenic
1007849748 6:44791787-44791809 GTCCCCCGCTCCCCCAAGGAGGG + Intergenic
1007915419 6:45557073-45557095 GTACCCCTGCTCTCCAGGAAGGG - Intronic
1009718496 6:67431161-67431183 ATCCCTCGCCTTTCCAAGGAAGG - Intergenic
1010690956 6:78910651-78910673 ATCCGCCGCCACTCCAGGAAAGG - Intronic
1017028139 6:150198413-150198435 GTGACCATCCTCTCCAGGGAGGG + Intronic
1019362168 7:610439-610461 GTCCCTCATCTCCCCAGGGACGG + Intronic
1022009087 7:26292980-26293002 CTCCCCCTCCTCTCCCAGGAGGG + Intronic
1024792708 7:52984968-52984990 GTTCCACACATCTCCAGGGAAGG - Intergenic
1027266693 7:76498585-76498607 GTGCCCGGCCTCACCAGGGCTGG + Intronic
1027318073 7:76996702-76996724 GTGCCCGGCCTCACCAGGGCTGG + Intergenic
1028424475 7:90671083-90671105 GTGCCCCGGCTCTCCTGGAATGG + Intronic
1030116321 7:106064870-106064892 GTCCCCAGCAGTTCCAGGGACGG - Intergenic
1034875833 7:154724225-154724247 CTCCCCCTCCTCCCCAGAGAGGG + Intronic
1034939772 7:155222928-155222950 GTCCCGAGCCGCTCCATGGAAGG - Intergenic
1035262772 7:157672164-157672186 GCCCCTCGCTTCTCCAGGGGGGG - Intronic
1035642415 8:1194145-1194167 TTCCCCCGCCCCTCAAGGGTAGG - Intergenic
1036688210 8:10925457-10925479 GTCCCCCTGATGTCCAGGGAGGG - Intronic
1036821164 8:11941329-11941351 GTCCCCCGCCTCACCAGCACAGG - Intergenic
1042491917 8:69409429-69409451 GTGCCCCACCTCTCTTGGGAAGG - Intergenic
1045269391 8:100649368-100649390 ATCCCTCGGCTCACCAGGGACGG - Intronic
1045505265 8:102773756-102773778 ATGCCCCACCTCTCCAAGGAGGG + Intergenic
1047728113 8:127702275-127702297 CTCCCCCATCTCCCCAGGGATGG - Intergenic
1049168410 8:141141434-141141456 GTCCCCCGGCTCACCAGGAGAGG - Intronic
1049238952 8:141526902-141526924 GTCCTCAGCATCTCCAGGGTGGG + Intergenic
1049300756 8:141868127-141868149 ATCCCCTGCCTCTCTAGGGGGGG + Intergenic
1049410898 8:142473592-142473614 GTCCCCCACCTCTCCTGGCATGG + Intronic
1049575451 8:143387744-143387766 GGCACCCACTTCTCCAGGGAAGG + Intergenic
1049762125 8:144336484-144336506 CTCCCCCGCCTGTCCAGGGGCGG - Intergenic
1049765395 8:144353020-144353042 GTTCCCAGCCTCTCTAGTGATGG + Intronic
1049841787 8:144777803-144777825 GTCCCCCGCCCTACCAGGGAGGG + Intronic
1056930507 9:90872293-90872315 GTCCCTCTCCTCACCAGTGATGG + Intronic
1059348751 9:113649753-113649775 ATCCCCTGCCACTCCAGGGAGGG + Intergenic
1059382124 9:113934839-113934861 GTCCCCAGCCTCTCCATGCTCGG - Intronic
1059441418 9:114309177-114309199 GTTCCCTGCCTCTCTATGGAGGG - Intronic
1060725041 9:126000923-126000945 GTTCCCCTCCCCTCCAGGGCAGG - Intergenic
1061347860 9:130042098-130042120 GCCCCTCGCCTTTCCGGGGACGG + Intronic
1061726145 9:132582944-132582966 TTCGCCAGCCTCTCCAGGAAGGG + Exonic
1062047500 9:134431300-134431322 GCCCCCAGCGTCTCCATGGAGGG + Intronic
1062055484 9:134467749-134467771 TTCCCTGGCCACTCCAGGGAGGG - Intergenic
1062170788 9:135133577-135133599 TTCCGCAGGCTCTCCAGGGAAGG - Intergenic
1062286651 9:135776042-135776064 GACCCCCGAGTTTCCAGGGAGGG - Intronic
1062300670 9:135866250-135866272 CTGCCCCGCCTCTCCTGGGAAGG - Intronic
1062501239 9:136852883-136852905 CTCCCCAGCCTCTTCAGGGCTGG + Intronic
1186191989 X:7075549-7075571 CTCCCCCTCATCTCCAGGGAGGG + Intronic
1190071181 X:47280748-47280770 GTCCCCTGTCTCTACAAGGAAGG + Intergenic
1199967791 X:152834176-152834198 TTCCTCCCCCTCCCCAGGGAAGG - Intronic