ID: 928114802

View in Genome Browser
Species Human (GRCh38)
Location 2:28539007-28539029
Sequence CACCCCAACGGGGCCCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 84}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928114797_928114802 -7 Left 928114797 2:28538991-28539013 CCATCACACTCAACCACACCCCA 0: 1
1: 0
2: 6
3: 68
4: 759
Right 928114802 2:28539007-28539029 CACCCCAACGGGGCCCAAGCAGG 0: 1
1: 0
2: 1
3: 4
4: 84
928114793_928114802 14 Left 928114793 2:28538970-28538992 CCCAGTTAACCAAGGGGAGGCCC 0: 1
1: 0
2: 0
3: 1
4: 66
Right 928114802 2:28539007-28539029 CACCCCAACGGGGCCCAAGCAGG 0: 1
1: 0
2: 1
3: 4
4: 84
928114794_928114802 13 Left 928114794 2:28538971-28538993 CCAGTTAACCAAGGGGAGGCCCA 0: 1
1: 0
2: 0
3: 5
4: 102
Right 928114802 2:28539007-28539029 CACCCCAACGGGGCCCAAGCAGG 0: 1
1: 0
2: 1
3: 4
4: 84
928114795_928114802 5 Left 928114795 2:28538979-28539001 CCAAGGGGAGGCCCATCACACTC 0: 1
1: 0
2: 0
3: 13
4: 193
Right 928114802 2:28539007-28539029 CACCCCAACGGGGCCCAAGCAGG 0: 1
1: 0
2: 1
3: 4
4: 84
928114787_928114802 28 Left 928114787 2:28538956-28538978 CCCAAAGGATCAGGCCCAGTTAA 0: 1
1: 0
2: 0
3: 8
4: 89
Right 928114802 2:28539007-28539029 CACCCCAACGGGGCCCAAGCAGG 0: 1
1: 0
2: 1
3: 4
4: 84
928114788_928114802 27 Left 928114788 2:28538957-28538979 CCAAAGGATCAGGCCCAGTTAAC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 928114802 2:28539007-28539029 CACCCCAACGGGGCCCAAGCAGG 0: 1
1: 0
2: 1
3: 4
4: 84
928114796_928114802 -6 Left 928114796 2:28538990-28539012 CCCATCACACTCAACCACACCCC 0: 1
1: 0
2: 1
3: 40
4: 409
Right 928114802 2:28539007-28539029 CACCCCAACGGGGCCCAAGCAGG 0: 1
1: 0
2: 1
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928114802 Original CRISPR CACCCCAACGGGGCCCAAGC AGG Intronic
900260244 1:1724255-1724277 CACCCCTACGGGGCCGCGGCCGG + Exonic
900409120 1:2504918-2504940 CTCCCCAGCCGGGCCCAGGCTGG - Exonic
901837528 1:11934181-11934203 CACCCCTACGTGGCCCACCCAGG - Intergenic
902036282 1:13460617-13460639 CACCCCAGCTGGGTCAAAGCAGG + Intergenic
906960583 1:50417276-50417298 CTCCGCAAGGGTGCCCAAGCTGG + Intergenic
913519452 1:119631585-119631607 GGCCCAAGCGGGGCCCAAGCGGG - Intronic
914250804 1:145919822-145919844 CACCTGAACGGGATCCAAGCGGG - Intergenic
920301968 1:204994451-204994473 TACCCCAACAGGGCCATAGCTGG - Intronic
920750169 1:208666807-208666829 CAGCCCAGCAGGCCCCAAGCTGG - Intergenic
922632111 1:227126027-227126049 CACACCCAAGGGGCTCAAGCAGG + Intronic
922808448 1:228402473-228402495 CACCCCATCTGTCCCCAAGCTGG + Intronic
1064048569 10:12041924-12041946 CACCCCAGCGTGGACCCAGCTGG + Intronic
1064452715 10:15457687-15457709 CACCCCAAGGGGGTTGAAGCGGG - Intergenic
1070147627 10:73786122-73786144 CTCCCGAGCGAGGCCCAAGCAGG - Intronic
1072549781 10:96468756-96468778 CACCCCACCGTGGCCCCAGGTGG + Intronic
1077282747 11:1753040-1753062 GAGCCCAGCTGGGCCCAAGCTGG + Exonic
1077460231 11:2705447-2705469 CACCCAACCAGGCCCCAAGCAGG - Intronic
1097262196 12:57726209-57726231 CGCCCCTAGGGGGCACAAGCGGG + Intronic
1107465292 13:40644331-40644353 CACCCCAAGGGGAGCCAAGTAGG + Intronic
1111496842 13:89062001-89062023 CTCCCCACCGGGGCCTAAGAGGG - Intergenic
1113739048 13:112698307-112698329 CACCCCACCCGGTCCCAAGGAGG + Intronic
1115186669 14:30696727-30696749 CACCTCACCTAGGCCCAAGCTGG - Intronic
1116430096 14:44836142-44836164 CACCCCGGCGGGGCCCAGGTTGG + Intergenic
1129057029 15:72827332-72827354 CATCCCAGCTGGGCCTAAGCAGG + Intergenic
1129198601 15:73985402-73985424 CAGCCCAGCTGGGCCCAACCTGG - Exonic
1131060404 15:89400487-89400509 CACCCCACCGGAGGCCCAGCGGG - Intergenic
1132607855 16:800935-800957 CTCTCCACCAGGGCCCAAGCTGG - Intergenic
1135167685 16:20155357-20155379 CACCACATCGAGGCACAAGCTGG + Intergenic
1139391712 16:66609614-66609636 GACCCCAGGGGGGCCCCAGCAGG - Intronic
1141158289 16:81611936-81611958 CACACCAACTGGACCCACGCTGG - Intronic
1143774112 17:9186523-9186545 CACCCCATCGGGGCCTTACCTGG + Intronic
1146593938 17:34153631-34153653 CAGCCCAACGAGGCTCCAGCAGG - Intronic
1146952426 17:36916218-36916240 CACCCCAACTGGCCAGAAGCAGG + Intergenic
1151722124 17:75863161-75863183 CACCCCACCGGGGCCTCAGATGG - Intergenic
1152710325 17:81867998-81868020 CACCCCACCTGGGCCCAGCCAGG - Exonic
1154299643 18:13182029-13182051 CACCCCACCTGGGACCGAGCGGG + Intergenic
1158270148 18:55704224-55704246 CACCCCAAAGGGACCCATGCAGG + Intergenic
1158441478 18:57478295-57478317 CACCCCCACGTGGCCCCACCCGG - Exonic
1160511861 18:79457387-79457409 CACACCAGCGGGGCCCAGGCAGG - Intronic
1161221976 19:3122071-3122093 CACCCCACCGGAGCCCACGTGGG + Exonic
1163032125 19:14551645-14551667 TACCACAGCGGGGCCCAGGCAGG - Intronic
1167612039 19:50512386-50512408 CACCCCATCGAAGCCCAGGCTGG + Exonic
925451780 2:3975368-3975390 CACACCAAAGTGGCTCAAGCTGG + Intergenic
926001620 2:9338095-9338117 CACCCCAACAGGGTCCATCCTGG - Intronic
928114802 2:28539007-28539029 CACCCCAACGGGGCCCAAGCAGG + Intronic
928204076 2:29271697-29271719 CACCCCCACTGGGCCCTGGCTGG - Intronic
928428834 2:31201386-31201408 CGCCCCACAGGGACCCAAGCAGG + Intronic
930529179 2:52570768-52570790 ATCCGCAACTGGGCCCAAGCGGG + Intergenic
932257292 2:70298913-70298935 CACCCCCATGGGGCCGAATCCGG - Intronic
937269309 2:120637930-120637952 CACCCCAGTGGGGTCAAAGCAGG + Intergenic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
947589862 2:231379453-231379475 CATCCCAACAGGGCCCAGGTGGG - Intergenic
949010281 2:241674356-241674378 CACCTCACCGGGGACCCAGCAGG - Intergenic
1168828926 20:833816-833838 GACCCCAAAGGTGCCCACGCGGG + Exonic
1169074997 20:2754973-2754995 CCCCCCCACAGGGCCCAGGCTGG + Intronic
1181121456 22:20670403-20670425 CACCCAAGAGGGGACCAAGCCGG - Intergenic
1181334415 22:22117427-22117449 CACCCAAGAGGGGACCAAGCCGG - Intergenic
1184834171 22:47011206-47011228 CACCCCAAGGCTGCCCAAGTAGG - Intronic
1184880076 22:47299176-47299198 CACCCCACCAGGTCCCCAGCAGG + Intergenic
950040307 3:9915707-9915729 CGCCCCAAGGCGGCCCCAGCTGG - Exonic
958117525 3:89240071-89240093 AACCCCAGTGGGGCCAAAGCAGG + Intronic
964074797 3:152680733-152680755 CACACTAACTGGGGCCAAGCAGG - Intergenic
985231280 4:187820884-187820906 CACCCCAGCGTGGCTCAAGTGGG + Intergenic
985266793 4:188158528-188158550 AACCCAAACCGGGCCCAAACCGG + Intergenic
1003874324 6:10422976-10422998 CACGCCAAGGGGGACCAAGAAGG - Intergenic
1018612611 6:165660580-165660602 CACCCCAAAGGTGCCTGAGCGGG + Intronic
1019395836 7:817058-817080 CCCCGCAACGGGGTCCAGGCGGG - Intronic
1019432178 7:1004198-1004220 CACCTCACAGGGGCCCACGCTGG - Intronic
1019528701 7:1493180-1493202 CACCCCGACGCGGCCCGAGCAGG - Intronic
1022031062 7:26492322-26492344 CACCCCACCAGGATCCAAGCTGG - Intergenic
1023700523 7:42888210-42888232 CGCCCCAAAGGGCCCCAAGCAGG + Intergenic
1024959196 7:54957245-54957267 CTCCCCAGCGGGCCCCAAGTTGG + Intergenic
1027111142 7:75440899-75440921 CATCCCATAGGGGTCCAAGCGGG + Intronic
1029593871 7:101526376-101526398 CACCCCAACCAGGGCCCAGCTGG - Intronic
1036769019 8:11566081-11566103 CACCCCACAGGAGCCCCAGCAGG - Intergenic
1039429160 8:37512049-37512071 CACGCCAACAGGGCGAAAGCTGG + Intergenic
1041020549 8:53633852-53633874 CACCCCAAAGGGGCCCATGCAGG + Intergenic
1042519792 8:69699388-69699410 CTCCCCAGCAGGGCCCTAGCAGG + Intronic
1048011809 8:130463507-130463529 CACAGCACCGGGGACCAAGCTGG - Intergenic
1048585877 8:135773341-135773363 CACCCCACAGGGACCCAGGCAGG - Intergenic
1049299692 8:141862978-141863000 CAGCCCAACTGGGCCTCAGCTGG - Intergenic
1049747017 8:144267274-144267296 CTCCCCAACAGGGCACAGGCAGG + Intronic
1049798461 8:144507002-144507024 CACCCCAGCTGGGGCCAGGCTGG + Exonic
1061008347 9:127941254-127941276 CTCCCCAACAGCGCCAAAGCTGG + Exonic
1061301069 9:129705302-129705324 CTCCCCAGCGTGGCCCTAGCAGG - Intronic
1062465223 9:136677870-136677892 CACCCCACAGGGGACCCAGCCGG + Intronic
1189254958 X:39630779-39630801 CACCACAAAGGAGCCCAAGGAGG - Intergenic
1190297719 X:49038343-49038365 CACCACACTCGGGCCCAAGCTGG - Exonic
1194439961 X:93920291-93920313 CACCCCAAAGGGACCCTTGCTGG - Intergenic
1196580529 X:117374112-117374134 CACCTCAAAGGGTCCTAAGCAGG + Intergenic