ID: 928117332

View in Genome Browser
Species Human (GRCh38)
Location 2:28555682-28555704
Sequence TTAGTTCAGCAAATATTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1541
Summary {0: 1, 1: 3, 2: 58, 3: 319, 4: 1160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928117332_928117333 20 Left 928117332 2:28555682-28555704 CCAATAAATATTTGCTGAACTAA 0: 1
1: 3
2: 58
3: 319
4: 1160
Right 928117333 2:28555725-28555747 TCATCAGATGAACAATCCCTAGG 0: 1
1: 0
2: 0
3: 11
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928117332 Original CRISPR TTAGTTCAGCAAATATTTAT TGG (reversed) Intronic
900734940 1:4293611-4293633 TTAACTCATCAACTATTTATTGG - Intergenic
901442693 1:9288248-9288270 TTCATTCAGCAAGCATTTATTGG - Intergenic
901558303 1:10049178-10049200 TAATTTCAACAAATATTTTTGGG + Intronic
901690411 1:10969592-10969614 TTCATTCAACAAATATTTATTGG + Intronic
902140158 1:14346824-14346846 TTAAATTAACAAATATTTATTGG + Intergenic
902282150 1:15382554-15382576 TCCGTTCACCAAATATTTACTGG - Intronic
902371233 1:16008339-16008361 TTTATTCACCAAGTATTTATTGG + Exonic
902531694 1:17094673-17094695 GATGCTCAGCAAATATTTATGGG + Intronic
902692603 1:18119180-18119202 TTTATGCAGCAGATATTTATTGG + Intronic
902707822 1:18217973-18217995 TTCCTTCAACAATTATTTATTGG + Intronic
902819630 1:18936089-18936111 TTAATCCAGTGAATATTTATGGG - Intronic
902845793 1:19109933-19109955 TTAGTTCAGCAGATATGGGTTGG - Intronic
903072518 1:20733330-20733352 TAATGTCAGCTAATATTTATTGG - Intergenic
903163447 1:21505246-21505268 TTCATTCAACAAATGTTTATTGG - Intergenic
903312759 1:22472702-22472724 TCAGTTCAGCATATATTTATTGG + Intronic
903386032 1:22927291-22927313 TTTTCTGAGCAAATATTTATTGG + Intergenic
903977070 1:27157379-27157401 TTAGTTTAACAAATGTTTACTGG + Intronic
903988245 1:27245319-27245341 TTCATTCAGCAAATATTTATTGG + Intronic
904227775 1:29038548-29038570 CTTATTCAACAAATATTTATTGG + Intronic
904252565 1:29235718-29235740 TTCATTCAACAAATATTTATTGG - Intergenic
904268694 1:29333900-29333922 ATAATTCAGGGAATATTTATGGG + Intergenic
904390306 1:30180840-30180862 TTCATTCAGCAGATATTTTTTGG - Intergenic
904581815 1:31549249-31549271 TTCGTTCAATAAATATTTCTTGG + Intergenic
904799887 1:33085115-33085137 TTGATTCAGCAAATATTAATTGG + Intronic
904816558 1:33206323-33206345 TGAGTTGGGCAAAGATTTATTGG + Intergenic
904957001 1:34292970-34292992 TCAGTTCCACAAACATTTATTGG - Intergenic
905409375 1:37757730-37757752 TTCATTCAGCAAATATTTTTTGG + Intronic
905483744 1:38280877-38280899 TTGATTCAACAACTATTTATGGG + Intergenic
905616294 1:39402458-39402480 TCCATTCACCAAATATTTATTGG - Intronic
905677283 1:39835779-39835801 CTAGCTCAACAAATGTTTATGGG + Intergenic
905818146 1:40967929-40967951 TTCATTTACCAAATATTTATTGG - Intergenic
905897287 1:41557172-41557194 TTCATTCATCAAATATTAATTGG - Intronic
906014933 1:42567829-42567851 TTAATCCAATAAATATTTATAGG - Intronic
906332480 1:44898451-44898473 TTTATTCAACAACTATTTATTGG - Intronic
906410010 1:45570712-45570734 TTTGTTCAAGAAGTATTTATTGG + Intergenic
906649222 1:47500393-47500415 TTCATTCGACAAATATTTATGGG - Intergenic
906683284 1:47745571-47745593 TTTGTTTAGTCAATATTTATTGG + Intergenic
906836815 1:49092347-49092369 TTAGCTCAGCAAACATTTTCTGG - Intronic
906935369 1:50209768-50209790 TAGGGTCAGCAAGTATTTATTGG + Intergenic
907113495 1:51948919-51948941 TCCTTTCAACAAATATTTATTGG - Intronic
907156270 1:52337354-52337376 TTTATTTAGCAAACATTTATTGG + Intronic
907264618 1:53249860-53249882 TCTGTTCAACAAATATTTGTTGG + Intronic
907441520 1:54481509-54481531 TTCATTCAACAAACATTTATTGG - Intergenic
907660713 1:56390207-56390229 TTTATTCAACAAATATTTATTGG - Intergenic
907918478 1:58891967-58891989 TTATTTCAAAAAATATTTCTAGG + Intergenic
907928516 1:58977348-58977370 TTAATTTAACAAATAATTATTGG - Intergenic
907970421 1:59375523-59375545 GTAATTCAACAAATATTTGTGGG - Intronic
907993582 1:59607171-59607193 TAACATCAGCAAATATTTGTAGG - Intronic
907996730 1:59640404-59640426 CTCATTCAGCAAATATTAATTGG + Intronic
908026122 1:59953288-59953310 TGCATTCAACAAATATTTATTGG + Intergenic
908334407 1:63106000-63106022 TGAGTTCAGCAAATGAATATGGG + Intergenic
908677120 1:66617704-66617726 TCCATTTAGCAAATATTTATGGG + Intronic
908732345 1:67238997-67239019 TTCCTTCAGCAAATGTTTATTGG - Intronic
908776176 1:67642585-67642607 TTCATTCACCAAATATGTATTGG - Intergenic
909294279 1:73926986-73927008 TTAATTCAACAAACATTTACTGG + Intergenic
909356389 1:74714819-74714841 TTCCTTGAACAAATATTTATTGG + Intronic
909364517 1:74803658-74803680 CTTATTCAACAAATATTTATTGG - Intergenic
909388668 1:75091826-75091848 TTCATTCAACGAATATTTATAGG + Intergenic
909430796 1:75585333-75585355 TTTATTCAGCAAATACTTACTGG - Intronic
909548585 1:76874194-76874216 TTTGTTCAGTAATTATTCATTGG - Intronic
909579718 1:77220776-77220798 TTAATTCAACAGATATCTATTGG + Intergenic
909586223 1:77291660-77291682 CTAATTCAACAAATATTTATTGG + Intronic
909595403 1:77400544-77400566 TTAGCTCAGAGAATATTTTTTGG - Intronic
909598259 1:77431328-77431350 TTCCTTTAGCAAATGTTTATTGG + Intronic
909772317 1:79439570-79439592 TTTATTCAGCAAATATTTATTGG - Intergenic
909939923 1:81599332-81599354 TAAATTCAGCAAACATTTATTGG - Intronic
909941186 1:81613792-81613814 TTAGCTCAGAAAATGTTCATAGG - Intronic
909997653 1:82300511-82300533 TTTGTTCAACAAATATTACTTGG + Intergenic
910038238 1:82814748-82814770 TTGATTCAGTAAATATTTATTGG - Intergenic
910050670 1:82970373-82970395 TTTGTTTAGCAAATATCTGTAGG - Intergenic
910243232 1:85110937-85110959 TTATTTCAGCAAAGATGTGTGGG - Intronic
910268216 1:85363876-85363898 TCAGTTCAACAAATATTTGGTGG + Intronic
910278606 1:85474214-85474236 TTAGTCCAGAAAATAATTATTGG + Intronic
910389853 1:86730161-86730183 TTGATTCAGTAAATATGTATTGG + Intronic
910430794 1:87157745-87157767 TTCATTCAACAAACATTTATTGG - Intronic
910633119 1:89377687-89377709 TAAATTCAGCAAACACTTATAGG - Intronic
910725636 1:90335913-90335935 TTTATTCAACAAATATTTACTGG + Intergenic
911211345 1:95141697-95141719 TTAATTCAACATATGTTTATTGG - Intronic
911289196 1:96035791-96035813 CTCCTTCAACAAATATTTATTGG + Intergenic
911390574 1:97236155-97236177 TTAGTTCAGAAAATGCTTAAAGG - Intronic
911485032 1:98494802-98494824 TTTATTAAACAAATATTTATTGG + Intergenic
911542848 1:99179279-99179301 TTAATTTTGTAAATATTTATGGG + Intergenic
911604989 1:99894784-99894806 TTCAGTCATCAAATATTTATAGG + Intronic
911639192 1:100268693-100268715 TTAATTCAATGAATATTTATTGG - Intronic
911830823 1:102549633-102549655 TTTCTTCAGCAAATATTTTTTGG + Intergenic
911860856 1:102946355-102946377 TTATTTCATCTAATATCTATTGG - Intronic
911951482 1:104178466-104178488 TTTGTTCAATAAATACTTATTGG + Intergenic
911967703 1:104388131-104388153 TTAGGGCAGCAAAAATTTTTGGG - Intergenic
912260786 1:108110067-108110089 TTTGCTTAACAAATATTTATTGG - Intergenic
912305505 1:108562036-108562058 TTTATTCAGCAAATATGTGTTGG + Intronic
912331370 1:108823079-108823101 TTTGTTCAGCAAACATTTATGGG + Intronic
912529926 1:110312848-110312870 TTAATTCAGCAAATATTTACAGG - Intergenic
912531036 1:110322273-110322295 TCATTTCAACCAATATTTATTGG - Intergenic
912579603 1:110708239-110708261 TTAATTCAGAAAATATTTATTGG + Intergenic
913109667 1:115646656-115646678 TTCATTCAGCAGACATTTATAGG + Intronic
913709037 1:121461739-121461761 TTTATTCAGCAAGTACTTATTGG - Intergenic
914959109 1:152190241-152190263 TTCATTCAACAAATATTTATTGG + Intergenic
915073205 1:153289041-153289063 TTCATTCCACAAATATTTATGGG + Intergenic
915336154 1:155143338-155143360 CTAGTTCAACAAATATTTTTCGG - Intergenic
915358424 1:155270736-155270758 TTTGTTCAACAAATACTTATTGG - Intronic
915620270 1:157078298-157078320 TTAATTCAACAAGTATTTATGGG - Intergenic
916117563 1:161500248-161500270 TTCATTCAGCAAGTATCTATTGG - Intergenic
916184303 1:162115862-162115884 TCAGTTGATCAGATATTTATGGG + Intronic
916545110 1:165796765-165796787 TTAATTCAACAAGTATGTATGGG + Intronic
916626669 1:166565499-166565521 TTAATTTAATAAATATTTATTGG - Intergenic
916631135 1:166613653-166613675 TTCATTCAACAAATATTTTTTGG + Intergenic
916740766 1:167645309-167645331 TTTGTTCCACAAATATTTATTGG + Intronic
916778475 1:167995822-167995844 TTAACTCACCAAATATTTATTGG + Intronic
916812066 1:168314403-168314425 TCAGTTCAGCAAATGTTTATTGG - Exonic
916899586 1:169206284-169206306 TTAATTCATCAAATATTTTCTGG - Intronic
917238328 1:172918864-172918886 TTCGTTTATCAATTATTTATGGG - Intergenic
917644332 1:177015266-177015288 TTATTTCACCAAATATTTCTAGG + Intronic
917852186 1:179074415-179074437 TTAGTTCAACTAACATTTACAGG - Exonic
917935749 1:179865284-179865306 TTAGTTCAACCAATATTATTTGG + Intronic
917988567 1:180348107-180348129 TTCATTCAACAAATACTTATTGG - Intronic
918098097 1:181350818-181350840 TTAATTGAGCAAGTATTTGTTGG + Intergenic
918222437 1:182447855-182447877 TTCACTCAACAAATATTTATTGG - Intergenic
918678579 1:187322178-187322200 TTCATTCAGCAAATATTTACTGG - Intergenic
919047086 1:192465895-192465917 TTAATTCAACAAATATTTGTTGG + Intergenic
919119059 1:193316185-193316207 TTTATTCAACAAATATCTATTGG - Intergenic
919214920 1:194540863-194540885 TTTATTCAAGAAATATTTATTGG - Intergenic
919488643 1:198176141-198176163 GTTATTCAACAAATATTTATTGG + Intronic
919587528 1:199457300-199457322 TGATTTAAACAAATATTTATAGG - Intergenic
919733652 1:200930593-200930615 TTAATTCAGTAAAGATGTATTGG + Intergenic
919771336 1:201160987-201161009 TTAATACTGCAAATATTGATAGG - Intronic
920058693 1:203212829-203212851 TTCATTCAGTAACTATTTATTGG + Intronic
920097355 1:203495175-203495197 TTTGCTCAACAAACATTTATGGG - Intronic
920222733 1:204416119-204416141 TTCATTCAACAAACATTTATTGG - Intergenic
920267504 1:204734982-204735004 TTTGTTCAACAAACATTTGTTGG + Intergenic
920272201 1:204774351-204774373 TCAATTCAACAAACATTTATTGG - Intergenic
920530553 1:206699007-206699029 TAAGTTTATCCAATATTTATGGG + Intronic
920743405 1:208602622-208602644 TCAGTTCAACAAATATATACTGG + Intergenic
920811163 1:209287025-209287047 TTATTTCAGCATATAGTCATTGG - Intergenic
920895666 1:210047270-210047292 TTAATTCAATAAACATTTATTGG - Intronic
921029978 1:211327910-211327932 TTAATTCTGTAAATATTTATTGG + Intronic
921103265 1:211950177-211950199 TCAGTTCAACAAGTATTTATGGG - Intronic
921726493 1:218529718-218529740 TCAGTGCAGCAGATATTTTTGGG - Intergenic
921950602 1:220926236-220926258 TTAATTCAGCAAAGATTTACTGG - Intergenic
922111555 1:222562303-222562325 TTAATTGAGCAAATGCTTATTGG + Intronic
922112208 1:222571491-222571513 TTAGTTCAGTAAATTTTTAGTGG - Intronic
922283829 1:224151067-224151089 GTAGTTCAGTAAGTTTTTATTGG + Intronic
922892988 1:229075898-229075920 TTCATTCAGCAAAGATTTACTGG + Intergenic
923134706 1:231107671-231107693 TAAACTCAGCAAATATTTAAAGG - Intergenic
923143560 1:231182198-231182220 CTTATTCAACAAATATTTATGGG + Intronic
923342271 1:233017976-233017998 TTAGTTCATTAAATACTCATTGG - Intronic
923452953 1:234136963-234136985 TTCATTCTGCAAATATTTATTGG + Intronic
923767584 1:236906706-236906728 TTCATTCATCAAATATGTATTGG + Intergenic
924137021 1:240978768-240978790 ATAGTTCAGAAAATGTTGATTGG - Intronic
924308608 1:242717455-242717477 TTCATTCAACAAATATTTACTGG - Intergenic
924360814 1:243239899-243239921 AATGTTCAGCAAATATTAATAGG + Intronic
1063063959 10:2590226-2590248 TTATTTAAACAAATATTTGTTGG - Intergenic
1063261153 10:4390999-4391021 TTAGTTCATCAAATTTTCACTGG - Intergenic
1063602429 10:7494322-7494344 TTTGCTCAACAAATATTTATTGG - Intergenic
1063837033 10:10027159-10027181 TTAATTCAGCAAATATTTGTTGG + Intergenic
1063878896 10:10510551-10510573 TTCATTCATCAAATACTTATTGG + Intergenic
1063941658 10:11135985-11136007 TCCATTCAGCAAATATTTACTGG + Intronic
1064728745 10:18307631-18307653 TTCATGCAACAAATATTTATTGG - Intronic
1064744741 10:18467389-18467411 TGAGGTCCACAAATATTTATTGG + Intronic
1065152094 10:22832300-22832322 TCAATTCAGGAAATATTTATTGG + Intergenic
1065318308 10:24485638-24485660 TTCATTCAACAAATATTTCTTGG - Intronic
1065353547 10:24817102-24817124 TTTGTTTAAAAAATATTTATCGG - Intergenic
1065770886 10:29077334-29077356 CTAATTCAGCAAGTATTTATTGG - Intergenic
1066004219 10:31132733-31132755 TTGGCTCAACAAGTATTTATGGG + Intergenic
1066236226 10:33487530-33487552 TTTATTCAACAAATATTTAGTGG + Intergenic
1066314883 10:34234767-34234789 TTCATTGAGCAAATATATATTGG - Intronic
1066385157 10:34935614-34935636 TTCGTTCAACATATATTTATGGG + Intergenic
1066544737 10:36487539-36487561 GATGTTCAGCAAATATTTACTGG - Intergenic
1066987214 10:42478158-42478180 AGAGTTTAGAAAATATTTATTGG + Intergenic
1067051909 10:43026470-43026492 TTTATTCAGCAAATAGTTGTTGG - Intergenic
1067174266 10:43931449-43931471 TTCCCTCAACAAATATTTATTGG - Intergenic
1067366971 10:45641152-45641174 TCAGTTCATCAAACATTTATTGG - Intronic
1067817442 10:49492406-49492428 TTTATTCAGCAAATGCTTATGGG + Intronic
1067879956 10:50034693-50034715 TGAGATCAGCAGAGATTTATTGG + Intergenic
1067891927 10:50144687-50144709 TGAGATCAGCAGAGATTTATTGG - Intergenic
1068028736 10:51681468-51681490 TTAATTTAGCAAATACTTTTTGG - Intronic
1068080464 10:52313054-52313076 TTAATTCAACAAAAACTTATTGG - Intergenic
1068451486 10:57195540-57195562 TTCATTAAACAAATATTTATTGG + Intergenic
1068560588 10:58511250-58511272 TTCTATCAACAAATATTTATTGG - Intergenic
1068882700 10:62066992-62067014 TTAATTCACCAAAAATTTATTGG - Intronic
1068939141 10:62663922-62663944 TCAGTTCAGCAAATATGTCCTGG + Intronic
1068941144 10:62682656-62682678 TTAGATAAATAAATATTTATTGG - Intergenic
1069003075 10:63287221-63287243 TTCATTCAACAAATATTCATTGG + Intronic
1069444179 10:68457663-68457685 TTCATTTAGCAAATATTTATTGG - Intronic
1070350933 10:75591761-75591783 GTAATTTATCAAATATTTATAGG + Intronic
1071117139 10:82234575-82234597 TTCATTCAACAATTATTTATTGG - Intronic
1071155221 10:82680404-82680426 TTACTTCATCAAACATTGATTGG - Intronic
1071668353 10:87582806-87582828 TTTGTTCAGTAAATATTTATAGG - Intergenic
1071788215 10:88926709-88926731 CAACTTCAGCAAATATTTACCGG - Intronic
1072002066 10:91206122-91206144 ATAGTGCCACAAATATTTATCGG + Intronic
1072005618 10:91243955-91243977 TTCATTCAGCAAATATTTACTGG + Intronic
1072401323 10:95105217-95105239 TAACTACAGCTAATATTTATAGG + Intergenic
1072603914 10:96961324-96961346 TTAGTTAATCATAGATTTATTGG + Intronic
1072794281 10:98342558-98342580 TCAATTCAACAAATATTTATTGG - Intergenic
1072844587 10:98815705-98815727 TTCTTTCAGTAAATATTTACTGG - Intronic
1072868523 10:99090376-99090398 TTCGTTCAGAACATATTTATTGG - Intronic
1072917964 10:99551602-99551624 TCAGTTCAAAAAATATTCATGGG + Intergenic
1072941784 10:99771278-99771300 TTTGTTCAGCAAATTTTCTTGGG + Intergenic
1072950384 10:99841738-99841760 TTAGTTCAGCAAAGACCTCTAGG + Intronic
1072950857 10:99845577-99845599 TTAGTTCCACAAATAATTCTTGG - Intronic
1073324760 10:102636021-102636043 TTGATTCGACAAATATTTATTGG + Intergenic
1073785802 10:106888507-106888529 TTCATTCAAGAAATATTTATTGG - Intronic
1073885758 10:108037784-108037806 TTAATTCATCAAATTCTTATTGG + Intergenic
1073963499 10:108961267-108961289 TCAGTTTAGTAAGTATTTATTGG + Intergenic
1074538046 10:114342950-114342972 TTTAGTCAACAAATATTTATTGG - Intronic
1074941845 10:118244081-118244103 TTCATTCAACAAATATTTACTGG + Intergenic
1075198792 10:120383966-120383988 TTTGTTCAGGAAACATGTATGGG - Intergenic
1075202532 10:120417259-120417281 TTGGTTCAGCAAAGGTTTCTTGG + Intergenic
1075277993 10:121112730-121112752 TTAATTCAACAAATATTTACTGG + Intergenic
1075297214 10:121288275-121288297 TCAGGGCAGCAAATCTTTATAGG - Intergenic
1075380066 10:122011801-122011823 TTAATTGAACAAATATTTATTGG + Intronic
1075522582 10:123152015-123152037 TTACATCAGTAAATATTTACTGG + Intergenic
1075526367 10:123190562-123190584 TTTATTCATCAAATACTTATGGG + Intergenic
1075868940 10:125753891-125753913 TTAGTAGAGAAAATTTTTATAGG - Intronic
1075953029 10:126498375-126498397 TTCATTCAGCAAATATATATTGG - Intronic
1076034519 10:127188024-127188046 TTCGTTCAGTCAATATTTCTGGG - Intronic
1076628545 10:131838364-131838386 TGTTTTCAGCAAATATTTCTGGG + Intergenic
1077203229 11:1324774-1324796 TGAATTCATCAAATATTTATTGG - Intergenic
1077513770 11:2987897-2987919 TGAGTTAAGCAAAGATTTCTTGG - Intronic
1078078293 11:8181295-8181317 AGACTTCAGCAAATATTTATTGG + Intergenic
1078114371 11:8430771-8430793 ATAATTCAACAAATATTTATTGG - Intronic
1078128299 11:8590361-8590383 TTCATTCAATAAATATTTATGGG - Intronic
1078597403 11:12699734-12699756 TTCATTCAACAAATATGTATTGG - Intronic
1078661785 11:13293370-13293392 ATAATAAAGCAAATATTTATGGG - Intronic
1078728645 11:13955827-13955849 TTCATTCAGCAAACATGTATTGG - Intergenic
1078819188 11:14859752-14859774 TTCATTCAACAAGTATTTATTGG + Intronic
1078884197 11:15483726-15483748 TTCACTCAACAAATATTTATTGG - Intergenic
1078974968 11:16463268-16463290 TTCTTTCAACAAACATTTATTGG + Intronic
1079053045 11:17180090-17180112 TTTCCTCAGTAAATATTTATTGG + Intronic
1079154237 11:17929598-17929620 TTTGTTCAGCAAACATTTGTGGG + Intronic
1079373704 11:19873144-19873166 CTAGTTCAGCAAATGTTTCCTGG + Intronic
1079471277 11:20780446-20780468 TTAATTCAGTAAACCTTTATTGG + Intronic
1079534770 11:21500327-21500349 TTATTACAGAAAATATTTTTGGG - Intronic
1079979725 11:27137426-27137448 TTAGTTCATCAGATTTTTGTAGG + Intergenic
1080050795 11:27856932-27856954 TTCATTCAACAAATATTTATTGG - Intergenic
1080072333 11:28104762-28104784 TTTATTCAACAAGTATTTATTGG - Intronic
1080074002 11:28126478-28126500 TTATTTCAACAAATATTTATGGG - Intronic
1080479806 11:32635401-32635423 TCAGTTGATCAAATATATATGGG - Intronic
1080510118 11:32960780-32960802 ATAGTTAAGCAAACATTTTTAGG + Intronic
1080557511 11:33430840-33430862 TTGATTCAACAAATATTAATAGG - Intergenic
1080567971 11:33529738-33529760 TTTATTCCACAAATATTTATGGG - Intergenic
1080703477 11:34666225-34666247 TTTATTCTACAAATATTTATGGG - Intergenic
1080852428 11:36081380-36081402 TTTGTTCAGCACATTTTGATTGG + Intronic
1081202264 11:40231024-40231046 TTATTTAAACAAATATTTACTGG - Intronic
1081218083 11:40426755-40426777 TTCATTCAACAAATATTTCTTGG - Intronic
1081232257 11:40599702-40599724 TTATTCCAACAAATATTTATTGG - Intronic
1081270109 11:41072906-41072928 TTATTTCAGGAATTTTTTATTGG + Intronic
1081279355 11:41189079-41189101 TTTATTCAACAAAGATTTATAGG + Intronic
1081471596 11:43377654-43377676 TTAGTTCAGCAAAGATACAGAGG - Intronic
1081642952 11:44770066-44770088 TTTATTCAGCAAATATTTGTTGG + Intronic
1081683509 11:45025534-45025556 TGTGCTCAGTAAATATTTATTGG - Intergenic
1082113928 11:48307305-48307327 TTTATTCATTAAATATTTATTGG + Intergenic
1082133512 11:48519817-48519839 TAGGTTCACTAAATATTTATTGG + Intergenic
1082227069 11:49720575-49720597 TTCATTCAGAAAATATTTATTGG - Intergenic
1082566528 11:54686211-54686233 TAGGTTCACTAAATATTTATTGG + Intergenic
1082569267 11:54717913-54717935 TAAGTTCACTAAATATTTATTGG + Intergenic
1082618453 11:55392046-55392068 TAGGTTCATTAAATATTTATTGG + Intergenic
1083043879 11:59714457-59714479 TTTGTTCAGCAAATGCTTCTTGG - Intronic
1083161904 11:60859494-60859516 TCTGTTCAGCAAATATATGTTGG - Intergenic
1083168677 11:60908656-60908678 TAATTTCAGCAAATCTTTAGAGG - Intergenic
1083693172 11:64424126-64424148 TTCATTCAACAAACATTTATTGG - Intergenic
1083775090 11:64890686-64890708 TTGGTTCAGCAAACATTTATTGG + Intergenic
1083982974 11:66189401-66189423 TTTATTCAACAAATATTTATTGG + Intronic
1084131703 11:67140820-67140842 TTAATTCACCAGTTATTTATTGG + Intronic
1085020422 11:73203575-73203597 ATGTTTCAGCAAATATTTAGAGG - Intergenic
1085084745 11:73659480-73659502 TTAATTCAGCACATAGTTCTTGG + Intronic
1085100034 11:73792971-73792993 TTTGATCAGCAGATATTTATTGG + Intronic
1085262115 11:75212183-75212205 TGATTACAGCTAATATTTATTGG + Intergenic
1085502445 11:77036536-77036558 GTCTTTCAGCAAATATTTATCGG + Intronic
1085887117 11:80533883-80533905 TTAGTGAAGCAAATATTTATTGG + Intergenic
1085983544 11:81755487-81755509 TTTATTCAGCAAATATTTCTTGG + Intergenic
1086005987 11:82036450-82036472 TCAATTCGGCAAATATTTATTGG - Intergenic
1086489835 11:87348224-87348246 TGGGTTCAGCAAACATTTAGTGG + Intergenic
1086517436 11:87629079-87629101 TTCATTCAGTAAATATTTACTGG - Intergenic
1086598970 11:88608884-88608906 TTCATTCACCAAATATTTATTGG - Intronic
1086622357 11:88902511-88902533 TTCATTCAGAAAATATTTATTGG + Intronic
1086676980 11:89620392-89620414 TTCTTTCAGCATATATTTGTTGG + Intergenic
1086878445 11:92126244-92126266 GTAGTTCAGCAAACATTTTGAGG - Intergenic
1086975663 11:93129763-93129785 TCAATTCATCAAATGTTTATTGG + Intergenic
1087102759 11:94381039-94381061 TTTATTCAACAAATATGTATTGG - Intronic
1087137656 11:94736924-94736946 TTAATTAAACAAACATTTATTGG - Intronic
1087216275 11:95498609-95498631 TTATTTTAACAAATATTTATTGG + Intergenic
1087294471 11:96354552-96354574 ATAGTTCAGCAACTAGTTATGGG + Intronic
1087398117 11:97628500-97628522 TTAGTTCAGCATATATAGAATGG + Intergenic
1087519348 11:99210934-99210956 TTAATTTGACAAATATTTATTGG - Intronic
1087644737 11:100795460-100795482 CTAATTCAGCAAACATTTAGAGG + Intronic
1087748811 11:101982246-101982268 TTAATTCAATAAATATTTACTGG - Intronic
1087882371 11:103432875-103432897 TTTTTTAAGCTAATATTTATTGG - Intronic
1087904476 11:103679842-103679864 TTAATTAATCAAATATTTATTGG + Intergenic
1087961163 11:104351364-104351386 GTAATTCAGTAAATATATATTGG - Intergenic
1087992533 11:104763163-104763185 TTAGAGCAAAAAATATTTATAGG - Intergenic
1088090535 11:106033872-106033894 TTTATTCAACAAAAATTTATTGG + Intergenic
1088100399 11:106148160-106148182 TTTGTTCAAAATATATTTATTGG + Intergenic
1088377371 11:109157544-109157566 TAAATTCATCAAACATTTATTGG + Intergenic
1088451974 11:109991699-109991721 TTCATTCAATAAATATTTATTGG + Intergenic
1088543727 11:110939148-110939170 TCAGCTCACTAAATATTTATGGG - Intergenic
1089064842 11:115654730-115654752 TTTATTCAGAAAATATTTATTGG - Intergenic
1089256613 11:117197599-117197621 TTAATTCAGTAAACATTTACCGG + Intergenic
1089449349 11:118581651-118581673 TTTATTCAGCAGACATTTATTGG + Intronic
1089772240 11:120811885-120811907 GTGGTTCAGCAACTGTTTATAGG + Intronic
1089802797 11:121050298-121050320 TTATTTCAGCCAGTATTGATAGG + Intronic
1089977515 11:122745351-122745373 TTCATTCAGCAAGTATTTATGGG + Intronic
1090155675 11:124436074-124436096 GGAATTTAGCAAATATTTATTGG - Intergenic
1090281746 11:125462246-125462268 TTTAGTCAACAAATATTTATGGG - Intronic
1090514176 11:127407487-127407509 TTAGTTCAGCATCTATTTGGGGG + Intergenic
1090539564 11:127686416-127686438 TTAGTTCAGGTAATATTAGTTGG + Intergenic
1090642640 11:128742335-128742357 TTAATTTAGCAAATATTTATTGG - Intronic
1090695492 11:129237335-129237357 TCAGTTAAACAAATATTTACTGG + Intronic
1091020121 11:132091885-132091907 TTTTCTCAACAAATATTTATTGG - Intronic
1091158638 11:133398468-133398490 TTCATTCAGCAAATATTAACTGG - Intronic
1091887707 12:4028717-4028739 CTTATTCAGCAAATATTTACTGG - Intergenic
1091941235 12:4484540-4484562 TAATAGCAGCAAATATTTATAGG + Intergenic
1092065341 12:5585592-5585614 TTATTTCAGTAAATATTTACTGG - Intronic
1092098715 12:5865197-5865219 TCAATTCAACAAGTATTTATTGG + Intronic
1092140234 12:6178728-6178750 TTGATTCAATAAATATTTATGGG - Intergenic
1092165394 12:6339334-6339356 TTCCTTCAGCAAATAGTTAAGGG + Intronic
1092210424 12:6642707-6642729 TTTGTTCAACAAATACTGATTGG - Intronic
1092292572 12:7171273-7171295 TTAGTTAATCTAATATCTATAGG - Intergenic
1092398681 12:8152519-8152541 TTAAATCAACAAAGATTTATAGG - Intronic
1092642457 12:10530013-10530035 TTAGTCCATAACATATTTATAGG + Intergenic
1092754997 12:11755065-11755087 TGTGTTTAGTAAATATTTATTGG + Intronic
1092824958 12:12390168-12390190 TTTGTTCAGCAAATATTTGAGGG + Intronic
1093249566 12:16784836-16784858 TTTCTTCATCAAATATTTAATGG - Intergenic
1093378837 12:18465372-18465394 TTTATTTAGTAAATATTTATAGG + Intronic
1093515139 12:19976722-19976744 TTATTTCAATAAATATGTATTGG - Intergenic
1093530607 12:20157826-20157848 TTCATTCAACAAATATTTATTGG - Intergenic
1093876814 12:24358069-24358091 TCCATTCAACAAATATTTATTGG - Intergenic
1093950629 12:25162204-25162226 TTAGCTTATAAAATATTTATTGG - Intronic
1094154281 12:27321234-27321256 TTTTTTCAACAAATATTTATTGG - Intronic
1094253726 12:28397562-28397584 TTAGGTAAGCAAATATTTTGAGG + Intronic
1094386625 12:29901372-29901394 ATTATTCAGCAAATATTTATTGG - Intergenic
1095213808 12:39525737-39525759 TTACTTCCACAAATATTTTTGGG - Intergenic
1095223260 12:39645252-39645274 TTTCTTCAGCATATTTTTATTGG + Intronic
1095239086 12:39835729-39835751 TTAATTCAATAAATATATATTGG - Intronic
1095405858 12:41866550-41866572 TTCGTTCAACAAATATTTAGTGG - Intergenic
1095774222 12:45994489-45994511 TTATTTCAGCAACAATTAATTGG + Intergenic
1095821160 12:46479908-46479930 TTCATCCAGCAAATATTAATTGG - Intergenic
1095834807 12:46625966-46625988 TTTCTTCAACAAATATTTACTGG + Intergenic
1096243347 12:49971194-49971216 TTCATTCAACAAATATTTATTGG + Intronic
1096322413 12:50626865-50626887 TTCATTCAACAAATATTTACAGG - Intronic
1096330406 12:50707523-50707545 TTCATTCAACAAATATTCATTGG + Intronic
1096753033 12:53774997-53775019 TTCATTCAACAAATATTTACCGG - Intergenic
1097307564 12:58086379-58086401 ATAGTTCAGTAAATATTTGTTGG - Intergenic
1097372993 12:58807057-58807079 CCAATTCAGCAAATATTTGTTGG + Intronic
1097414248 12:59295048-59295070 TTTATCCAGAAAATATTTATTGG + Intergenic
1097499559 12:60385440-60385462 TGATTTCAGAAAATATATATAGG + Intergenic
1097520689 12:60666688-60666710 TTAGTTTAGCTAATAGTTTTTGG + Intergenic
1097572064 12:61346245-61346267 TTCATTCAACAAAAATTTATTGG - Intergenic
1097687075 12:62701096-62701118 TTGCTTAACCAAATATTTATTGG - Intronic
1097748668 12:63328376-63328398 TTATTTCAACCAATAGTTATTGG + Intergenic
1097813379 12:64043894-64043916 TTAATTCAAAATATATTTATTGG + Intronic
1097867685 12:64572642-64572664 TTAATTTAGTAAATATTTATTGG - Intergenic
1098008287 12:66022045-66022067 TTAATTCCACAAATATTTACCGG - Intergenic
1098393131 12:69990682-69990704 GTTATTCAACAAATATTTATGGG - Intergenic
1098427799 12:70385174-70385196 TTAGTTCAACAAATGTTTATTGG + Intronic
1098574148 12:72021930-72021952 TTTATTCAACAAATATTCATTGG - Intronic
1098862356 12:75724344-75724366 TATTTTTAGCAAATATTTATAGG - Intergenic
1098935742 12:76477275-76477297 TTAATTCAGAAAATATTACTAGG - Intronic
1099130215 12:78819345-78819367 TTAATTCAGCACATGCTTATAGG - Intergenic
1099182872 12:79487560-79487582 TTAGTTTGGCAGATATTTAAAGG + Intergenic
1099395101 12:82128745-82128767 TCTAATCAGCAAATATTTATTGG - Intergenic
1099445444 12:82746409-82746431 TTAATTGAACACATATTTATGGG + Intronic
1099483941 12:83204066-83204088 TTACTTATGCAAAGATTTATAGG + Intergenic
1099506897 12:83489137-83489159 TTTATTCATCTAATATTTATTGG - Intergenic
1099511461 12:83544114-83544136 TTTATTCAGCAAATATGTTTTGG - Intergenic
1099628836 12:85113541-85113563 TTTGTTCAACAAATATTTTGGGG - Intronic
1099819068 12:87686490-87686512 TTCATTTAACAAATATTTATTGG + Intergenic
1100049126 12:90423851-90423873 TCAGTTCTGCAAGTAATTATTGG - Intergenic
1100352543 12:93798257-93798279 TTCATCCAGCAAATATTTGTGGG - Intronic
1100593757 12:96053976-96053998 TGACTTGAGCAATTATTTATTGG - Intergenic
1100775527 12:97969062-97969084 ATAGCCCAGCAAATATATATTGG - Intergenic
1100796819 12:98190896-98190918 TTAGCTCACCAAACATTTAAAGG - Intergenic
1100886749 12:99079411-99079433 TCAGTTTAACCAATATTTATTGG - Intronic
1100924640 12:99530839-99530861 TTTATTCAACAAATATTTATTGG - Intronic
1101091207 12:101287752-101287774 TTTGCTCAGTCAATATTTATTGG + Intronic
1101181271 12:102220899-102220921 TTAGTTCAGAAAATAGTTCTAGG - Intergenic
1101235171 12:102781328-102781350 TTAGGTCAGCAAATATGCAAGGG - Intergenic
1101451277 12:104781271-104781293 TTTATTCAACAAATATTTAAAGG + Intergenic
1101551532 12:105766934-105766956 TTTTATCAGCAAATATTTATGGG - Intergenic
1101590106 12:106117938-106117960 TAAGCTCAACAAATATTTATTGG - Intronic
1101624988 12:106431134-106431156 TTAATTCAGCATATATTCATGGG - Intronic
1101709821 12:107254960-107254982 TATGTTCAATAAATATTTATTGG + Intergenic
1101752042 12:107589815-107589837 TTCATTCAACAATTATTTATTGG - Intronic
1101931924 12:109021727-109021749 TTTATTCAACAAATATTTATGGG - Intergenic
1102227914 12:111242025-111242047 TCATTTCAACAAATATTTATTGG + Intronic
1102245848 12:111355286-111355308 TTAACTATGCAAATATTTATTGG + Intergenic
1102408334 12:112693941-112693963 TTCAATCAGCAAATATTTATTGG - Intronic
1102925687 12:116824319-116824341 CTCATTCAGCAAATATTTCTTGG + Intronic
1102927475 12:116837192-116837214 TCAATTCAGCAAATGTGTATTGG + Intronic
1103145166 12:118589345-118589367 CTCATTGAGCAAATATTTATTGG + Intergenic
1103199710 12:119077763-119077785 TTCATTGAACAAATATTTATGGG - Intronic
1103238410 12:119394032-119394054 TTAGTTCCACAAATATTTTCTGG - Intronic
1103325876 12:120120203-120120225 TTAATTCAGTAAATATTAAGTGG + Intergenic
1103491283 12:121322511-121322533 TTCATTCAACAAATATTCATTGG - Intronic
1103778761 12:123385158-123385180 TTCATTCAGTAAATATCTATTGG + Intronic
1103848498 12:123915908-123915930 TTAGCTCAGCAAAAAGTGATTGG - Intronic
1103960226 12:124604715-124604737 TTCGTTCAGCAAATATGCAGAGG - Intergenic
1104059811 12:125258079-125258101 TTTGTTCAGGAAATATTTACAGG + Intronic
1104108042 12:125681840-125681862 TTGTTCCAACAAATATTTATTGG + Intergenic
1104144692 12:126021527-126021549 TTAGTTTTGCATGTATTTATTGG + Intergenic
1105390283 13:19970662-19970684 TTCATTCAGTAAATATTTATTGG + Intronic
1105458653 13:20564268-20564290 TTAATTCAACAAATATTTCTTGG + Intergenic
1105478021 13:20745974-20745996 TATATTCAGTAAATATTTATTGG - Intronic
1105561034 13:21491063-21491085 TCTGTTCAACAAATATTTGTTGG + Intergenic
1105644232 13:22299832-22299854 TTCATTCAACAAATATTTTTGGG + Intergenic
1105958127 13:25302955-25302977 TTCGTGGAACAAATATTTATTGG + Intronic
1106058261 13:26259784-26259806 TTCATTCAACAAGTATTTATTGG + Intronic
1106207653 13:27614734-27614756 TGGGTTCAGTAATTATTTATTGG + Intronic
1106381039 13:29239519-29239541 TAAATTCAGCAAATACTTATTGG + Intronic
1106512794 13:30425720-30425742 TTCACTCATCAAATATTTATAGG + Intergenic
1106630786 13:31470383-31470405 TTATTTCAACCAATATTTATTGG + Intergenic
1106915950 13:34514716-34514738 TGAATTTAGCAAATATTTACTGG - Intergenic
1107006877 13:35621651-35621673 TTCACTCAGCAAATATTGATTGG - Intronic
1107687247 13:42915079-42915101 TTCATTCCGCAAATATTTATTGG - Intronic
1107706233 13:43109144-43109166 TTCACTCAACAAATATTTATTGG - Exonic
1107725744 13:43297429-43297451 TTTTTTCAGAAAATATTGATTGG + Intronic
1107745544 13:43503776-43503798 TGACTTCAGCAATGATTTATTGG + Intronic
1107816265 13:44247262-44247284 TTGGTTCAATAAATATTTATTGG - Intergenic
1107932586 13:45318646-45318668 TTTATTCAACAAACATTTATTGG + Intergenic
1108067176 13:46590068-46590090 TTAGTTCAGTTAATCTTTTTTGG + Intronic
1108684975 13:52811349-52811371 TCAGTTCAACATACATTTATTGG - Intergenic
1108983031 13:56544461-56544483 TTAGCTAATAAAATATTTATTGG + Intergenic
1109006583 13:56885340-56885362 TTAGTTCAACAAACATTTATTGG - Intergenic
1109021840 13:57106182-57106204 TTAGTGAAGCAAATATTTACTGG + Intergenic
1109375996 13:61493853-61493875 TTTTTTCAAGAAATATTTATTGG - Intergenic
1109580185 13:64320649-64320671 TTCATTTAGCAGATATTTATTGG - Intergenic
1109735187 13:66474454-66474476 TTAATTTGGCAGATATTTATTGG - Intronic
1109922763 13:69090708-69090730 TTTCTTCATCAAATATTTATTGG + Intergenic
1110015180 13:70391145-70391167 TTTTTTCAGCAAGTATTTATTGG + Intergenic
1110072837 13:71199339-71199361 TTTGTTCAACAAGTATTTTTTGG - Intergenic
1110081853 13:71323284-71323306 TCAATTCAACACATATTTATTGG - Intergenic
1110121160 13:71883400-71883422 TTAGGTAAGCAAATAAATATTGG - Intergenic
1110123353 13:71910288-71910310 TGAATTCAAAAAATATTTATTGG + Intergenic
1110248133 13:73351126-73351148 TTTGTTTAACATATATTTATGGG - Intergenic
1110344967 13:74435541-74435563 TTCCTTAAGCAAGTATTTATTGG + Intergenic
1110354218 13:74547896-74547918 TTACTTCATTATATATTTATAGG + Intergenic
1110504188 13:76266115-76266137 TTACTGCAGAAAAAATTTATAGG + Intergenic
1110582085 13:77142324-77142346 TTAGTTCAGCAAATGTTTTTTGG - Intronic
1110644462 13:77866418-77866440 TTCATTCAGCTAGTATTTATCGG + Intergenic
1110790928 13:79585881-79585903 CTTGTTCAACAAGTATTTATTGG + Intergenic
1111139948 13:84103759-84103781 TCAGTTCAACTTATATTTATTGG + Intergenic
1111258415 13:85702985-85703007 TTTTTACAGCAAATATTCATTGG + Intergenic
1111547064 13:89752554-89752576 TTTACTCATCAAATATTTATTGG - Intergenic
1111908898 13:94288020-94288042 TTCATTCATCAAATATTTTTTGG + Intronic
1111918450 13:94385705-94385727 TTAATTCAGCAAGTCTTTATTGG - Intronic
1111954216 13:94739484-94739506 TTAATTCAACAAATATTTCTAGG + Intergenic
1112035766 13:95495345-95495367 TATATTTAGCAAATATTTATTGG + Intronic
1112908806 13:104456490-104456512 TTCATTCAGCAAACATTTATTGG + Intergenic
1112991092 13:105514751-105514773 TTATTCCAGAAAATATTTAAAGG - Intergenic
1113036865 13:106060178-106060200 AATCTTCAGCAAATATTTATTGG - Intergenic
1113640309 13:111952585-111952607 TTGGCTCAGCATATATTTATGGG - Intergenic
1113646567 13:112001289-112001311 TTAATACAGTAAATATTTATAGG - Intergenic
1114320707 14:21545060-21545082 TTTATTCAACAAATATTTTTTGG + Intergenic
1114415535 14:22540841-22540863 TGTATTCAACAAATATTTATTGG + Intergenic
1114544005 14:23485067-23485089 TCACTGCAACAAATATTTATTGG - Intronic
1114660611 14:24341289-24341311 TCAATTCAACAAATATTTATTGG - Intergenic
1115193470 14:30771491-30771513 ATAATTCAGCTAATATTTGTTGG - Intergenic
1115318351 14:32050570-32050592 TTTATTCAGTAAATATTTACTGG - Intergenic
1115654152 14:35427162-35427184 TTCATCTAGCAAATATTTATTGG + Intergenic
1116072797 14:40070765-40070787 TTAATTCAGTAAGTATTCATTGG + Intergenic
1116092257 14:40324343-40324365 TTAATGTGGCAAATATTTATTGG - Intergenic
1116328589 14:43566892-43566914 TTAATTCAGCATGTAATTATAGG - Intergenic
1116376741 14:44211833-44211855 TTAGTGCAGAAAATAGCTATGGG - Intergenic
1116884353 14:50205040-50205062 TTCTTTCAACAAATATTTATAGG - Intronic
1117127203 14:52641887-52641909 TTCATCCAACAAATATTTATTGG + Exonic
1117391089 14:55263632-55263654 TTAATTCAACAGATATTTATTGG + Intergenic
1117478958 14:56124413-56124435 TGCATTCAGCAAATATTTATTGG + Intronic
1117545108 14:56787193-56787215 TTCATTCAGCAAATATTTGAGGG - Intergenic
1117572807 14:57065018-57065040 TTCATTCAACGAATATTTATTGG + Intergenic
1118111627 14:62727675-62727697 ATAATTCATCAAACATTTATAGG + Intronic
1118390809 14:65293777-65293799 TTAATTCAATAAATATCTATAGG + Intergenic
1118517287 14:66544529-66544551 TTCATTCAACAAATATTCATTGG - Intronic
1118579205 14:67276517-67276539 TGAGTTGAACAGATATTTATTGG + Intronic
1118777420 14:68981533-68981555 GGTGCTCAGCAAATATTTATTGG - Intergenic
1119341359 14:73881575-73881597 TTAATTTAACAAATATTTATGGG + Intronic
1119515921 14:75248212-75248234 TTCATTCATTAAATATTTATAGG + Intronic
1120191251 14:81441722-81441744 TTTGTTGCACAAATATTTATTGG + Intergenic
1120356935 14:83446011-83446033 TAATTTCAGCAAATTTTGATGGG + Intergenic
1120361588 14:83510974-83510996 GAAGTTCAATAAATATTTATAGG - Intergenic
1120563183 14:86021884-86021906 TTAATTCAGAAAATATTTATTGG - Intergenic
1120728340 14:87972078-87972100 TTTGTTCAGGAGATATTTCTTGG - Intronic
1120773239 14:88404822-88404844 TTTATTCAGCATATATTTATTGG + Intronic
1121035491 14:90699973-90699995 TTCATTCAACAAATATTAATTGG - Intronic
1121079852 14:91098899-91098921 TTCAATCAGCCAATATTTATAGG - Intronic
1121163829 14:91772419-91772441 TATTTTCAACAAATATTTATTGG - Intronic
1121364895 14:93300213-93300235 TTAGTTTAGGAAATATGGATGGG + Intronic
1121455146 14:94033825-94033847 CTAATACAGCAAATATTCATAGG - Intronic
1121665833 14:95671422-95671444 TTTCTTCAATAAATATTTATCGG - Intergenic
1121781721 14:96626291-96626313 CTCATTCAGCAGATATTTATTGG + Intergenic
1121836614 14:97098133-97098155 TTATTTCAGCAAACATTTCTTGG - Intergenic
1122238981 14:100349413-100349435 TTTGTTCTACAAATATTTATTGG - Intronic
1122259224 14:100502592-100502614 TTAATTCAGCAAGTGTCTATAGG - Intronic
1122441113 14:101732586-101732608 TTAGTTAAGCAGATATTATTAGG - Intergenic
1122580492 14:102768742-102768764 GAAGTTCAACAGATATTTATTGG + Intergenic
1124469960 15:29975545-29975567 CAAGTTCAACAAATATTTATTGG - Intergenic
1124550511 15:30676633-30676655 TTCATTCAGCAGATATTTGTGGG - Intronic
1124576143 15:30910051-30910073 TCCATTCAGCAAATATTTATTGG - Intronic
1124681333 15:31733668-31733690 TTTATTCAGCAGATATTTGTCGG - Intronic
1124783089 15:32654790-32654812 TTGTTTCAACAAATATTTAGTGG - Intronic
1124811275 15:32941241-32941263 ATAGTTCAGAAAACATTTACTGG + Intronic
1125094282 15:35832915-35832937 TATGTGCAGCAAATAATTATAGG - Intergenic
1125188366 15:36959470-36959492 TTAGTTCAACACGTATTTATTGG - Intronic
1125794624 15:42395132-42395154 TTCGTTTAGCAAATGTTTCTTGG + Intronic
1125823147 15:42650847-42650869 TTAAATCAAGAAATATTTATTGG - Intronic
1125882410 15:43206158-43206180 TTCATTCAACACATATTTATTGG - Intronic
1126577167 15:50208607-50208629 TTCATTCAACAAATATGTATGGG - Intronic
1126670272 15:51109981-51110003 TTAAGTCAGCAAATAGTTATTGG + Intergenic
1126824768 15:52538103-52538125 TTTGTCCAGAAAGTATTTATTGG + Intergenic
1127185750 15:56478766-56478788 TTAGTTCGGCAATGATTTCTTGG + Intergenic
1127201715 15:56661017-56661039 TTGATTTAGCAAATATTTTTTGG - Intronic
1127288379 15:57549599-57549621 TTCATTTAGCACATATTTATTGG + Exonic
1127407690 15:58668783-58668805 TAAATTCAACAAGTATTTATTGG - Intronic
1127442454 15:59023336-59023358 TCAGTTACGCAAAAATTTATGGG - Intronic
1127536412 15:59893895-59893917 TTAATTCAACAACTATTTACAGG + Intergenic
1127788524 15:62377672-62377694 CTCATTCAGCATATATTTATTGG - Intergenic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1128428833 15:67571837-67571859 TTCATGCAGCAAATGTTTATTGG + Intronic
1128594788 15:68933966-68933988 TTAAGTCATCAAATATTCATGGG + Intronic
1128828102 15:70740093-70740115 TTAGATTAACAAATATTTCTTGG - Intronic
1128911395 15:71518815-71518837 TTTATTCAGCAAATGTTTATTGG + Intronic
1129481341 15:75828933-75828955 TTCATTCACCAAATATTTGTTGG + Intergenic
1129820895 15:78601196-78601218 TTCATTCAACAAATATTTATGGG - Intronic
1130116301 15:81007519-81007541 TTAATTCGGCAAATATTTACTGG + Intronic
1130527342 15:84718629-84718651 TAAATTCAACAAGTATTTATTGG - Intergenic
1130625957 15:85515180-85515202 TTATTTGAGCAGATATTTCTTGG + Intronic
1130735145 15:86540261-86540283 TTGATTCAACAAATATTTACTGG - Intronic
1131105564 15:89731714-89731736 TTTATTCAACAAACATTTATTGG + Intronic
1131351121 15:91700812-91700834 TAATTTTAGTAAATATTTATTGG - Intergenic
1131854337 15:96577278-96577300 TTCATTCAGAAAATATTTATTGG - Intergenic
1131883316 15:96881797-96881819 TGTATTCAGCAACTATTTATTGG - Intergenic
1132050844 15:98606551-98606573 TTTACTCAGCAAACATTTATTGG - Intergenic
1132312234 15:100865675-100865697 CTCGTTCAGCAAACATTTACAGG - Intergenic
1132812410 16:1807662-1807684 ATTGTTCAGCAAATATTCTTAGG - Exonic
1133593916 16:7272535-7272557 TTCATTCATCAAATATTTATAGG + Intronic
1133974035 16:10587570-10587592 CTCATTCATCAAATATTTATTGG - Intergenic
1134380819 16:13724077-13724099 TAAGTCTAGCAAATATTTATTGG - Intergenic
1134743042 16:16565096-16565118 TGCATTCAGCAAATATTGATCGG - Intergenic
1134907627 16:17994425-17994447 TTCATTCAGCAAACATTTATTGG - Intergenic
1134908169 16:17999963-17999985 TTCATTCAACAAATGTTTATTGG + Intergenic
1134914380 16:18057726-18057748 TAAATTCAGCAAATACATATGGG + Intergenic
1134924518 16:18147364-18147386 TGCATTCAGCAAATATTGATTGG + Intergenic
1135054097 16:19216213-19216235 TTAGTCCAGCAAATATTGCAGGG - Intronic
1135078171 16:19411785-19411807 TTCATTCAACAAGTATTTATAGG - Intronic
1135671089 16:24376192-24376214 TTAATTCAGCAACTGTTTATTGG + Intergenic
1135701417 16:24635972-24635994 TTAATTCATTACATATTTATTGG + Intergenic
1135863871 16:26082412-26082434 TTAGATCATCACATATTTAAGGG + Intronic
1135874174 16:26182154-26182176 CCAGTTCAGCAGATATTTATTGG + Intergenic
1138012111 16:53391201-53391223 TTTGTTCAGCAAACATTTATTGG + Intergenic
1138037144 16:53620306-53620328 TTACTTCATCAAATATTGAGAGG - Intronic
1138490709 16:57374648-57374670 TTCATTCAACAAATAGTTATTGG + Intronic
1138580578 16:57938293-57938315 TAACTTCAACACATATTTATAGG - Intronic
1138929715 16:61638132-61638154 CTTATTCAGCAAATGTTTATTGG - Intergenic
1139089072 16:63621576-63621598 TTAGTCAAGCAAATATTTTCTGG + Intergenic
1139198602 16:64949913-64949935 TCAATTCAGCAAATAGTTACTGG - Intronic
1139403366 16:66699130-66699152 CTAAATCAACAAATATTTATTGG + Intergenic
1139472547 16:67185921-67185943 TTCGTCCAGCAAATATTTCAAGG - Intronic
1139604950 16:68011540-68011562 TTTATTCAACAAGTATTTATTGG - Intronic
1139646837 16:68337805-68337827 TAAGTTCAGCAAATATTCTCAGG + Intronic
1139690253 16:68636739-68636761 TTCTTCCAGCAAATATTTATGGG + Intronic
1139872720 16:70120351-70120373 TTCATTCAGCAAATATTTGAGGG - Intronic
1139996901 16:70989800-70989822 TTAATTCAGCTGATATTTACTGG + Intronic
1140095219 16:71869408-71869430 TTCATTCAGCAAACATTCATTGG + Intronic
1140254722 16:73325248-73325270 TAAGTTTAACTAATATTTATGGG + Intergenic
1140301053 16:73757529-73757551 TTAATTCAGTAAATATTTATTGG + Intergenic
1140305787 16:73801327-73801349 TTCGTTCAGAAAATATGTATTGG - Intergenic
1140363056 16:74360979-74361001 TTCATTCAGCAAATATTTGAGGG + Intergenic
1140911106 16:79453763-79453785 TTCATTCAGCCCATATTTATTGG + Intergenic
1141116027 16:81310027-81310049 TTCCTTCAGCAAATATTTATTGG + Intergenic
1141288051 16:82691064-82691086 CACATTCAGCAAATATTTATTGG + Intronic
1141356795 16:83354380-83354402 TTCATTCAACAAGTATTTATCGG + Intronic
1141944411 16:87299414-87299436 TTCAATCAGCACATATTTATTGG - Intronic
1143488199 17:7267135-7267157 TTCATTCCTCAAATATTTATTGG - Intergenic
1143629111 17:8127029-8127051 TTCGGTCAGCCCATATTTATGGG + Intergenic
1143630109 17:8134041-8134063 ATTCTTCAGCACATATTTATAGG + Intergenic
1143706430 17:8700817-8700839 TTCATTCAACAAATATTTATGGG - Intergenic
1144567484 17:16372058-16372080 TTCGTTCAATAAATATTTACTGG + Intergenic
1144587795 17:16498527-16498549 TTCATTCAGCAAGTATTTATGGG - Intergenic
1144757833 17:17690931-17690953 TTCCTTCAGCAAATAGCTATGGG + Intronic
1145070263 17:19799708-19799730 TTAGTTCAACTAACATTTACTGG + Intronic
1145168826 17:20637290-20637312 AGAGTTTAGCAAATGTTTATTGG + Intergenic
1145855987 17:28157901-28157923 TTCATTCATCAAATATTTATAGG + Intronic
1145873044 17:28291988-28292010 TTAGGTCAGTAAATATTTGTTGG + Intergenic
1145876946 17:28326194-28326216 TTTGTTCAGTAATTATATATAGG - Intronic
1146164742 17:30578695-30578717 AGAGTTTAGCAAATGTTTATTGG + Intergenic
1146638415 17:34522631-34522653 TTCATTCCACAAATATTTATGGG + Intergenic
1146767089 17:35533323-35533345 TTTACTCAACAAATATTTATTGG + Intronic
1147429069 17:40360777-40360799 TTCATTCAACAAATATTTGTAGG - Exonic
1147466310 17:40613763-40613785 GGAGCTCAGTAAATATTTATTGG + Intergenic
1147469544 17:40647170-40647192 TTTCTTGAACAAATATTTATCGG - Intronic
1147600069 17:41739918-41739940 TTCATTCAACAAATATTTATTGG - Intergenic
1147997843 17:44370871-44370893 TGGGTTCAATAAATATTTATTGG - Intergenic
1148009019 17:44459846-44459868 TTAGGTCAGTAAATATGTGTTGG + Intronic
1148249678 17:46065425-46065447 TTCTTTCAACAAATATTTATTGG - Intronic
1148994491 17:51697725-51697747 TTCATTCAGTGAATATTTATGGG - Intronic
1149146478 17:53499534-53499556 TTGGTTCAGTAGACATTTATTGG - Intergenic
1149185849 17:53996813-53996835 CTTGTTTAACAAATATTTATTGG - Intergenic
1149306713 17:55354872-55354894 TAAATTCAGCAAATATTTATTGG - Intergenic
1149415513 17:56455826-56455848 TTAATTGGACAAATATTTATTGG - Intronic
1149984650 17:61338091-61338113 TTCATCCAACAAATATTTATGGG - Intronic
1150438863 17:65175632-65175654 CTTGATCAGCAAATATCTATGGG - Intronic
1150600840 17:66649669-66649691 TGGGTTCAGCAAATATTTATGGG - Intronic
1150674815 17:67235655-67235677 TCAGTTCAGCAAGTATTTATTGG - Intronic
1150940693 17:69690414-69690436 TCAGTTGAGCAAATATTGATGGG + Intergenic
1151040215 17:70850684-70850706 TTTATTCAATAAATATTTATTGG - Intergenic
1151069607 17:71193714-71193736 TTCATTCAACAAATATTTATTGG + Intergenic
1151151327 17:72090056-72090078 TTCATTCAACAAATATTTATCGG - Intergenic
1151245258 17:72789579-72789601 TCACTTCAGCAAACACTTATTGG + Intronic
1152495245 17:80666656-80666678 TTCATTCAGCAAATGTTTATTGG + Intronic
1153100875 18:1468206-1468228 TTAGTTGACCAAATAATTACTGG - Intergenic
1153243887 18:3054919-3054941 TTTCTTCAAAAAATATTTATTGG - Intergenic
1153252082 18:3133008-3133030 TTGCTTCAGCAAAGATTTATTGG + Intronic
1153412170 18:4805706-4805728 TTCATTTAACAAATATTTATTGG + Intergenic
1153596643 18:6732212-6732234 TTTACTCAACAAATATTTATTGG - Intronic
1153676956 18:7464273-7464295 TTTATTCATCAAATATTTACTGG + Intergenic
1153684932 18:7536243-7536265 TGATTTCAGAAAATATGTATGGG - Intergenic
1153740086 18:8115866-8115888 TTAGCTCAACAAATATTTCTTGG + Intronic
1154113131 18:11587419-11587441 TTTTTTCAGCAAATCTTTAGGGG - Intergenic
1154144240 18:11853523-11853545 TTGTTTCAGAAAATAATTATAGG + Exonic
1155036773 18:22031088-22031110 TTCATTCAACAAATATTTACAGG - Intergenic
1155222583 18:23698738-23698760 TATATTTAGCAAATATTTATTGG + Intronic
1155817409 18:30330909-30330931 TTAGTTAAACAAATATTGGTTGG + Intergenic
1156146667 18:34189483-34189505 TTTATTCAGCAAAAATTCATTGG + Intronic
1156233673 18:35180160-35180182 TTTGCTCAACAAATATTTGTTGG + Intergenic
1156506377 18:37597689-37597711 TTATTTCCTCAAATGTTTATTGG + Intergenic
1156701492 18:39830836-39830858 TTTATTCACCAAATATTTATTGG - Intergenic
1156853266 18:41753128-41753150 TTAATTCAGCAAATATCTACTGG - Intergenic
1156982911 18:43313110-43313132 TTCATTAAGCAAATATTTACTGG - Intergenic
1157221974 18:45834741-45834763 TCAATTCAGCAAACATGTATTGG - Intronic
1157285914 18:46377308-46377330 TTCCTTCAACAAGTATTTATGGG + Intronic
1157877065 18:51283557-51283579 ATATTTCAGAAAATAGTTATAGG - Intergenic
1158167448 18:54556414-54556436 TTAATTCAAGAAATATTTATTGG - Intergenic
1158185385 18:54765448-54765470 TTTGTTAAGCAAATATGCATTGG + Intronic
1158267131 18:55672051-55672073 TTACTTCAAAAAATATTTAAAGG - Intergenic
1158315323 18:56205763-56205785 TTAGTTCTGCAAATATCTATGGG - Intergenic
1158376705 18:56878490-56878512 TTAATTTAACAAATATTTATTGG - Intronic
1158816851 18:61110357-61110379 ATAGTTCAGAAAATAATTACAGG + Intergenic
1158911926 18:62073051-62073073 TCAGTACAGTAAATATTTGTTGG - Intronic
1158962109 18:62596122-62596144 TTTGTTCAACAAATATGTGTTGG + Intergenic
1159233328 18:65637138-65637160 TTCGTTCAACAAATATTTATTGG + Intergenic
1159235178 18:65662322-65662344 TTCATTCAACAAATATTTAGTGG + Intergenic
1159296816 18:66501191-66501213 TTAATTCCAGAAATATTTATTGG + Exonic
1159408145 18:68033403-68033425 TTAACTCAGCAAATATTTGTTGG + Intergenic
1159573487 18:70146804-70146826 TTGATTCAGGAAGTATTTATTGG - Intronic
1159618382 18:70608734-70608756 TCAGGTCAGTAAATATTTTTAGG + Intergenic
1161645839 19:5452867-5452889 TTCATTCAACAAATATGTATTGG + Intergenic
1162147757 19:8623353-8623375 TTGATTCAACAAACATTTATTGG + Intergenic
1162180266 19:8863987-8864009 TTCATTCAGCAAACATATATGGG - Intronic
1162860136 19:13500230-13500252 TTTGCTCAGCAAACGTTTATAGG + Intronic
1163174368 19:15553824-15553846 TTAATTTACCAAATATTTCTTGG + Intergenic
1164050115 19:21578783-21578805 TTGGTTCAGCAAATATCTTAGGG - Intergenic
1165198531 19:34126516-34126538 TTCATTCAACAAATATTGATAGG + Intergenic
1165295220 19:34921256-34921278 ATACTTAAGCAAATATTTAAAGG - Intergenic
1165707172 19:37984908-37984930 TTCCTTCAACAAATATTTCTGGG + Intronic
1165789842 19:38484669-38484691 TTCATTCAACAAATATTTATGGG + Intronic
1166045219 19:40226087-40226109 TTTGTTTAACAAATATTTAATGG - Intronic
1166134740 19:40769186-40769208 TAAGTTCAGCAAATATTTGCTGG + Intergenic
1167039647 19:47015480-47015502 TTCATTCAACAAATATTTATCGG - Intergenic
1167210232 19:48129552-48129574 TTCGTTCAGCAAGTATTTACTGG - Intronic
1167474780 19:49693552-49693574 TTCATTCACCATATATTTATGGG + Intronic
1168443447 19:56391707-56391729 TAAGGAAAGCAAATATTTATGGG + Intronic
925156524 2:1652450-1652472 TTATTTCAACAAGTATTTATTGG - Intronic
925296682 2:2781621-2781643 TGAGTTCAGCAAATCTTTGTGGG - Intergenic
925742037 2:7014269-7014291 TTCATTCAACAACTATTTATGGG - Intronic
925807233 2:7662460-7662482 TTAATCCAACAAACATTTATCGG - Intergenic
925935554 2:8755486-8755508 TTCCTTCTACAAATATTTATTGG - Intronic
926660662 2:15462551-15462573 TTCAGTCAACAAATATTTATTGG - Intronic
926717675 2:15938126-15938148 AAAATTCAACAAATATTTATTGG - Intergenic
926760090 2:16270842-16270864 TTCCTTCTCCAAATATTTATTGG + Intergenic
926882106 2:17557331-17557353 TTCTTTCAACAAATATTTATTGG + Intronic
926976837 2:18524005-18524027 TTAGTTCGACACATATTTACAGG + Intergenic
927092455 2:19722414-19722436 TTTGTTAAACACATATTTATGGG - Intergenic
927198032 2:20561355-20561377 TTTGTTCTGCAAATGTGTATTGG - Intronic
927279214 2:21288894-21288916 TTAGGTCACCTTATATTTATAGG - Intergenic
927346353 2:22047254-22047276 TCAATTAAGTAAATATTTATGGG - Intergenic
927529676 2:23783837-23783859 TTAGTCCAGGAAAGATTTCTGGG + Intronic
927587817 2:24324534-24324556 TTCATTCAGTAAATGTTTATGGG + Intronic
927734625 2:25508244-25508266 GTCATTCAGCAAATATTTATTGG - Intronic
927772940 2:25879213-25879235 ATCATTCAGCAAATATTTACTGG - Intergenic
927830348 2:26344958-26344980 TTCGTTTAACAACTATTTATTGG - Intronic
928117332 2:28555682-28555704 TTAGTTCAGCAAATATTTATTGG - Intronic
928276600 2:29906390-29906412 TTAATTCAACAAATAATTATTGG - Intronic
928519089 2:32070489-32070511 TTATTAAAGCAAATATTAATTGG + Intronic
928604103 2:32928197-32928219 TTTGGTCAACAAATATTTTTTGG + Intergenic
929160768 2:38830064-38830086 TTAATCCCACAAATATTTATTGG + Intronic
929315548 2:40473593-40473615 TTTGTTCAACAAATATTTATGGG - Intronic
929368509 2:41192161-41192183 TTCATTCAACAACTATTTATTGG - Intergenic
929925250 2:46202150-46202172 TCAGTTCTTCAAACATTTATGGG - Intergenic
930175326 2:48295616-48295638 TTGATTCAACAAATATTTGTTGG + Intergenic
930338978 2:50087290-50087312 TTAAATCAACAAATATTTAAAGG - Intronic
930464205 2:51724663-51724685 TTATTTCATTAAATATTTATTGG + Intergenic
930589205 2:53307292-53307314 TTCCTTCAATAAATATTTATTGG + Intergenic
930689614 2:54347423-54347445 CCAGTTCATCAAATTTTTATTGG - Intronic
930885142 2:56316748-56316770 TTTATTCAGCAAACATTTATGGG - Intronic
931009964 2:57899456-57899478 TAAATTCAGCAGGTATTTATTGG + Intergenic
931226041 2:60333161-60333183 CTAGGTAAGAAAATATTTATTGG - Intergenic
931598046 2:63971954-63971976 TTAGTTCAACAAATATTGATTGG - Intronic
931680477 2:64743361-64743383 TTAATTCAACAGATATTTATTGG - Intronic
931859468 2:66339297-66339319 TTCATTCAACAAATATTTAAGGG + Intergenic
931915514 2:66950859-66950881 GAAATTCAGCAAATATTTATTGG - Intergenic
933184422 2:79262864-79262886 TTTACTCAGAAAATATTTATGGG + Intronic
933435739 2:82247413-82247435 TTGATTCAGCAAATATTTAAGGG + Intergenic
935237066 2:101148353-101148375 TTTGTTCAGGAAACATTTGTAGG - Intronic
935482871 2:103615338-103615360 TTAATTCAACAAATATTTTGAGG + Intergenic
935843179 2:107136295-107136317 TTACATCAGGAAATATTTGTTGG - Intergenic
936142371 2:109951352-109951374 TTATTTCTGTAAATTTTTATTGG - Intergenic
936179061 2:110249311-110249333 TTATTTCTGTAAATTTTTATTGG - Intergenic
936202317 2:110420121-110420143 TTATTTCTGTAAATTTTTATTGG + Intronic
936746318 2:115580922-115580944 TTTATTCAACAAATATTTAAAGG - Intronic
936763521 2:115816068-115816090 TTAATTCAGTAACTATTTATTGG + Intronic
936842056 2:116781971-116781993 TTAATTCAGCAATTAGTTTTAGG - Intergenic
937011840 2:118569894-118569916 TTACTTGAGGAAATATTTTTGGG - Intergenic
937800943 2:126079621-126079643 TTATTTCAGGAGATATGTATGGG + Intergenic
938623538 2:133083280-133083302 TTGGCTTAGCAACTATTTATAGG + Intronic
939668430 2:144979306-144979328 TTAATTCAACAAATATTATTGGG + Intergenic
939819825 2:146944176-146944198 TTTATTCAACAAGTATTTATTGG + Intergenic
939855453 2:147353517-147353539 TTTCTTCAGCAAAGATTGATTGG + Intergenic
939922298 2:148131241-148131263 TTAGTTCAGGGAATATCTCTTGG + Intronic
939982757 2:148800479-148800501 ATATTTCACCAAATTTTTATTGG + Intergenic
940099974 2:150025699-150025721 ATTATTCAGCAAATAATTATTGG - Intergenic
940136734 2:150445580-150445602 TTAGATCAGCAAATAAATAAAGG - Intergenic
940375257 2:152950549-152950571 TGATTTCAGCAAATCTTTACAGG + Intergenic
940671224 2:156670639-156670661 TTATTTCTGCAAAAATTCATTGG + Intergenic
941006037 2:160248039-160248061 TTAGTCAATCAAATATTTATTGG + Intronic
941221268 2:162784839-162784861 AAATTTCAGCAAATATTTAATGG + Intronic
941444099 2:165579594-165579616 TTGGCTCAGCAAACATTTCTTGG - Intronic
941491737 2:166151028-166151050 TTCATTCAGCAAACACTTATTGG - Intergenic
941807445 2:169723148-169723170 TTCATTCAACAAATATTTTTGGG + Intronic
942145140 2:173019346-173019368 TTCGTTCATCACATATTTACTGG + Intronic
942216357 2:173723175-173723197 ATAGTTCAACATTTATTTATGGG - Intergenic
942538807 2:176994207-176994229 TTGATTCAACAAATATTTATTGG + Intergenic
942831402 2:180240560-180240582 TTCATTCAACAAATATTTACCGG + Intergenic
942941457 2:181623637-181623659 TTTGTTCAACGATTATTTATTGG - Intronic
943036865 2:182757911-182757933 TTAACCCAACAAATATTTATTGG + Intronic
943305295 2:186253917-186253939 ATTGTTAAACAAATATTTATTGG - Intergenic
943378991 2:187119622-187119644 TTTTTTCAGCAAAGATCTATTGG + Intergenic
943567129 2:189529329-189529351 TTCATTCAACAAATATTTATTGG + Intergenic
943567657 2:189535538-189535560 TTCATTCAACATATATTTATTGG + Intergenic
943602240 2:189935742-189935764 CTTTTTCAGCAAATATTAATAGG + Intronic
944158156 2:196630764-196630786 TTAGTAGACCAAATATGTATGGG - Intergenic
944172726 2:196797625-196797647 ATAACTCAACAAATATTTATTGG + Intronic
944245462 2:197525740-197525762 TTCAATCAGCAAATATTTATTGG + Intronic
944946087 2:204687523-204687545 TTAATTCAGTAAGTATTTTTGGG - Intronic
944969992 2:204981557-204981579 TGCATTAAGCAAATATTTATTGG + Intronic
945005949 2:205406467-205406489 TTAGTTCATCACATAAATATTGG + Intronic
945270688 2:207936378-207936400 TTTGTTCAACAAGTATTTATTGG - Intronic
945340249 2:208644174-208644196 TCAGTTCAACAAATATTTATTGG + Intronic
945411815 2:209518604-209518626 GTAATTCAACAAATATTTGTAGG - Intronic
945466225 2:210172674-210172696 TTAAATCAGTAAGTATTTATTGG + Intergenic
945671515 2:212807743-212807765 TTCATTCAACAAATATTTGTTGG - Intergenic
945693448 2:213071475-213071497 TTCACTCAACAAATATTTATGGG + Intronic
945698374 2:213138554-213138576 TTCATTCAACAAATATTTACAGG + Intronic
945858924 2:215098569-215098591 TTTGTTCAACAAATATTTGTTGG + Intronic
946046154 2:216822754-216822776 TCAATTGAACAAATATTTATTGG + Intergenic
946490445 2:220144308-220144330 CTCGTTCACCAAATATTTATTGG - Intergenic
946700849 2:222411759-222411781 TTAGTGCAGCAGATACTGATTGG + Intergenic
946712054 2:222516784-222516806 TTTATTAAACAAATATTTATTGG - Intronic
946813622 2:223553154-223553176 CTCATTCAGCACATATTTATTGG + Intergenic
946881162 2:224178549-224178571 TTCTTTCAGCAAATATTTATTGG + Intergenic
946993073 2:225358100-225358122 TTAATGCAGAAAATTTTTATAGG + Intergenic
947064388 2:226205395-226205417 TTTGTTCAGATCATATTTATTGG + Intergenic
947108899 2:226697567-226697589 TTCAGTCAACAAATATTTATTGG + Intergenic
947269335 2:228316687-228316709 TTAATTCAGTAAATGCTTATTGG - Intergenic
947329079 2:229009394-229009416 TTCTTTCAGAACATATTTATGGG + Intronic
947415589 2:229892044-229892066 TTCCTTCAGCAAATATTTGAAGG + Intronic
947817948 2:233050662-233050684 TTAATTCAACACATGTTTATTGG + Intergenic
948029173 2:234802342-234802364 TTCATTCAACAAACATTTATTGG + Intergenic
948046282 2:234947785-234947807 TTTGTTCAAGAAATACTTATTGG - Intergenic
1169013865 20:2275256-2275278 TTCGTTCATCAATTATTTCTTGG + Intergenic
1169650066 20:7857176-7857198 TTAACTCAACAAATATTTATTGG - Intergenic
1169717537 20:8637325-8637347 TTCATTCAACAAATATTTACAGG + Intronic
1169907894 20:10621894-10621916 TAACTTCAGCATATATTTACAGG - Intronic
1170187584 20:13608401-13608423 TTAATTCAACAAATATTTATTGG + Intronic
1170257496 20:14361480-14361502 TTAATTCTGCAAAAATGTATGGG - Intronic
1170293244 20:14794714-14794736 TTAGTTTAACAAATGTTTACTGG + Intronic
1170296904 20:14836905-14836927 TTATTTCACCAAATAGTTCTTGG - Intronic
1170329234 20:15190474-15190496 TTCGTTTAGAAAATATGTATAGG + Intronic
1171147483 20:22798070-22798092 ATTGCTCAGCAAATATTGATAGG - Intergenic
1171537139 20:25904077-25904099 TTTCTTCAACAAATATTTTTGGG - Intergenic
1172064358 20:32208391-32208413 TTGATTCAGCAAATATTTATGGG + Intronic
1172115261 20:32569881-32569903 TTTGTTCAGCACATTTTGATTGG - Intronic
1172498386 20:35406187-35406209 TTATTTCTTCAAATATTTTTCGG - Intronic
1172601663 20:36188074-36188096 TTCATCCAGCAAATATTTAGTGG - Intronic
1172744896 20:37199295-37199317 TTGGTTCAGCAAATACTTTCTGG + Intronic
1172785512 20:37465864-37465886 TGATTTCAGCAAGTATTTACTGG + Intergenic
1172795314 20:37532861-37532883 TTCATTCATCAAATATTTTTTGG + Intergenic
1172847057 20:37935807-37935829 ATTATTCAACAAATATTTATTGG - Intronic
1173059730 20:39650166-39650188 TTAAATCAACAAATATTTATTGG + Intergenic
1173078653 20:39845125-39845147 TATATTCAGCAAATATTTATTGG + Intergenic
1173091568 20:39976961-39976983 CTTGTTCAGAAAATATTTGTTGG - Intergenic
1173147420 20:40536803-40536825 TTTATTCATCAAATATTTATTGG + Intergenic
1173151154 20:40567680-40567702 TTCATTCAACAAATAGTTATTGG - Intergenic
1173183744 20:40823291-40823313 TCAGTTCAACAAATATTCACTGG - Intergenic
1173591864 20:44231103-44231125 TGAAGTCAACAAATATTTATTGG + Intergenic
1173758250 20:45537405-45537427 TTCATTCAACAAATATTGATTGG - Exonic
1174375457 20:50123895-50123917 TTCCTTCAGCAAATATTCACTGG - Exonic
1174414095 20:50355858-50355880 TTAATTCAGCAGATATTTTATGG + Intergenic
1174415578 20:50364017-50364039 TCATTTTAGCAAATATGTATTGG - Intergenic
1174531771 20:51220022-51220044 TTCGTTCAACATATATTCATGGG + Intergenic
1174621015 20:51874671-51874693 TTCATTCAACAAATATTTACTGG - Intergenic
1174627424 20:51927278-51927300 TTCATTCAACAAATACTTATTGG + Intergenic
1174743505 20:53039448-53039470 TAAATTGAACAAATATTTATAGG + Intronic
1174952547 20:55058617-55058639 TTCATTCAGTACATATTTATTGG + Intergenic
1175026614 20:55909421-55909443 TGTATTCCGCAAATATTTATTGG + Intergenic
1175268616 20:57717982-57718004 TTCATTCAGCAAATATTTATTGG - Intergenic
1175482816 20:59323423-59323445 TTCGTTCAGCAAAGACTTGTTGG + Intronic
1176989016 21:15471958-15471980 TTCATTCAGCAAATATTCACTGG - Intergenic
1177200607 21:17950996-17951018 TTAGTTCATCAAAATTTGATTGG - Intronic
1177242413 21:18476558-18476580 CAAAATCAGCAAATATTTATTGG + Intronic
1177330440 21:19653064-19653086 TTATTTGCACAAATATTTATTGG - Intergenic
1177692483 21:24529375-24529397 TTATTTCTGAAAATGTTTATGGG - Intergenic
1177755291 21:25339448-25339470 TAAGTTCTGCAAATATTTCCTGG - Intergenic
1178692615 21:34761938-34761960 TGAGGTTAGCAAATATTTATTGG - Intergenic
1178692973 21:34765017-34765039 TTAATTCTACAAATCTTTATGGG - Intergenic
1178885500 21:36481840-36481862 TTCGTTCATCAAATAGTTATTGG + Intronic
1179023258 21:37658047-37658069 TTATTCCTGCAAATATTTACAGG + Intronic
1179142584 21:38739640-38739662 TTCATTCAGCAAATATTTACTGG + Intergenic
1181431020 22:22881895-22881917 CTTGATCAGTAAATATTTATTGG + Intronic
1181657466 22:24315413-24315435 TTTGCTCAGTAAATATTTATTGG + Intronic
1181743113 22:24936980-24937002 TTGACTCAGCAAATGTTTATTGG + Intronic
1181744146 22:24944113-24944135 CTCATTCAACAAATATTTATTGG + Intronic
1181784786 22:25219214-25219236 TTCATTCAACAAATATTTGTTGG - Intergenic
1181867058 22:25866894-25866916 TTTATTTAGCAAATATTTGTGGG + Intronic
1181900910 22:26155009-26155031 TTTGCTCAACAAGTATTTATTGG - Intergenic
1182051620 22:27316731-27316753 TTCATTCAACAAATATTTACTGG - Intergenic
1182249520 22:28989091-28989113 TTCACTCACCAAATATTTATTGG + Intronic
1182404645 22:30115560-30115582 TTCATTCAGCAAATATTAATTGG + Intronic
1182670007 22:31987839-31987861 TCAGTTCAACAAAGATGTATTGG - Intergenic
1182840865 22:33388894-33388916 TTAACTCAGCATATATTTACTGG + Intronic
1182861662 22:33565124-33565146 TTTATTCAACAAATTTTTATTGG - Intronic
1183240137 22:36651750-36651772 TTTGTTCAACAAATATTGACTGG - Intronic
1183795694 22:40115530-40115552 TCAGTTCAGCTTATGTTTATTGG + Intronic
1183797651 22:40133345-40133367 TTAATGCAACAAACATTTATTGG + Intronic
1183876203 22:40784216-40784238 TTTGTTCATCAAATATATATTGG - Intronic
1183967649 22:41452247-41452269 TTAATTTAGCAAATAATTGTTGG + Intergenic
1184597356 22:45522349-45522371 TTCATTCAACAAATCTTTATTGG + Intronic
1185382242 22:50515030-50515052 TGTGTTCATCAAATATTTACTGG + Intronic
949122208 3:400189-400211 TTTATCTAGCAAATATTTATTGG + Intronic
949197402 3:1328899-1328921 TTTGTTCAACATATATTTAGTGG + Intronic
949216062 3:1568499-1568521 TTTATTCAACAAATATTTATTGG - Intergenic
949380750 3:3443058-3443080 TTAATTGAGCAAACATTTACTGG + Intergenic
949446965 3:4145316-4145338 TTCATTCAGCAAATATTTACTGG - Intronic
949868113 3:8563414-8563436 TTCATTCAGCAACTATTGATGGG + Intronic
949978034 3:9478393-9478415 TTCATTCAGCAACTATTTATTGG + Intronic
950083042 3:10237169-10237191 TTAGATTGGCAAATATTTATTGG + Intronic
950908986 3:16567769-16567791 AATGTTCAGCAAATATTAATGGG - Intergenic
951218169 3:20043229-20043251 TTCATTCAGTAAATATTTAGAGG + Intronic
951353787 3:21639371-21639393 TTCATTCAACAAACATTTATTGG - Intronic
951369530 3:21828564-21828586 TTTGTTCTACAAATATTTATTGG + Intronic
951527736 3:23669975-23669997 TAAATTCAGCAAACATTTTTTGG - Intergenic
951556724 3:23928379-23928401 TCAGTTCACCAAAGAGTTATGGG - Intronic
951615002 3:24532668-24532690 TCAATTCAACAAACATTTATTGG + Intergenic
951772429 3:26273451-26273473 TTCATTCATCAAGTATTTATTGG + Intergenic
951782168 3:26376130-26376152 TAAATTCAGCAAATGTTTACTGG - Intergenic
951826196 3:26871925-26871947 TTATTTCAGCACAAAGTTATGGG - Intergenic
951987437 3:28636282-28636304 TTTATTTAGCAAATATTTATTGG + Intergenic
952494006 3:33900332-33900354 TTTTTTCAGCTAATATTCATTGG - Intergenic
952579366 3:34813529-34813551 TTAGTTCTAGAAATATTTTTTGG + Intergenic
952961837 3:38597124-38597146 TGAATTCAACAAATATTTATTGG + Intronic
953069992 3:39510126-39510148 TCAGTTGATCATATATTTATGGG + Intronic
953097874 3:39796528-39796550 TTTCTTCAGTAAGTATTTATTGG + Intergenic
953773125 3:45793962-45793984 TTCACTCAACAAATATTTATTGG + Intronic
953903405 3:46856239-46856261 ATAGTTGAGCAAAGATTTAAAGG - Intergenic
953953865 3:47215181-47215203 CTGGTTAAGGAAATATTTATAGG + Intergenic
953962413 3:47276774-47276796 TTCATTCAGCAAACAATTATGGG - Intronic
954243075 3:49309390-49309412 TTAATTCATCAAATATTTATTGG - Intronic
954663091 3:52236578-52236600 TGAGGTCAGAGAATATTTATAGG + Intronic
955006571 3:54974216-54974238 TCTGCTCAGCAAATGTTTATTGG - Intronic
955238807 3:57162740-57162762 TTGGTTCAGCCAATATTTACAGG + Intronic
955399923 3:58584323-58584345 TTCATCCAGCTAATATTTATTGG - Intronic
955422122 3:58749171-58749193 TTCACTCATCAAATATTTATGGG + Intronic
955607393 3:60720362-60720384 TTTATTCAACAAATATTTATGGG - Intronic
955610061 3:60747470-60747492 TTTATTCAGCAAAAATTTATTGG - Intronic
955776574 3:62440168-62440190 TCCATTCAGCAAATATTTACTGG - Intronic
955818382 3:62872207-62872229 TTAGCTCATCAACTATTTGTTGG + Intronic
955821684 3:62902426-62902448 TTGATTCAACATATATTTATGGG + Intergenic
955915228 3:63901002-63901024 TTCATTCAACAAACATTTATTGG + Intronic
956043938 3:65175194-65175216 TTATTCCAGAAAATATTTAATGG - Intergenic
956093963 3:65696487-65696509 TTCATTCAACAAATATTTAATGG - Intronic
956123910 3:65993494-65993516 TTCATTCAACAAATAGTTATGGG + Intronic
956153669 3:66270770-66270792 TTAAATAAGCAAATATTTTTAGG + Intronic
956422820 3:69102264-69102286 TTAATTCCACAAATATTTGTTGG + Intronic
956813488 3:72887652-72887674 TTTATTCAACAGATATTTATTGG + Intergenic
956950861 3:74280656-74280678 ATTGTTCAACAAATACTTATTGG + Intronic
957024720 3:75168318-75168340 TTAGGTAAGCAAATATTTATAGG + Intergenic
957231604 3:77524520-77524542 TTTAGTCAGCAAATATTTTTCGG - Intronic
957246002 3:77717114-77717136 ATAGTTCAGGTAATATTTATAGG - Intergenic
957566101 3:81886131-81886153 TGAGTTCAGTAAATAGTTGTTGG - Intergenic
957593995 3:82236934-82236956 TTCATTCAGCAAATACTGATTGG + Intergenic
957602526 3:82356470-82356492 TTAGTTTAGCAAATATTTATTGG + Intergenic
958033749 3:88147086-88147108 TTTATTCAACAAATATTCATTGG + Intronic
958044117 3:88262896-88262918 TTATTCCTGCAAATATTCATAGG + Intergenic
958104464 3:89054390-89054412 TTAGTTTACCAAATAATTTTTGG + Intergenic
958268641 3:91470571-91470593 TAAATTCAACAAATATTTACAGG + Intergenic
958612682 3:96447608-96447630 TAAGTTCAATAAATATTGATTGG - Intergenic
958854419 3:99367367-99367389 TTTGTTCAGCAACTACTCATTGG - Intergenic
959157424 3:102683959-102683981 TTATTTCCTCATATATTTATTGG + Intergenic
959313164 3:104767475-104767497 TTAGCTCAGAGAATTTTTATAGG - Intergenic
959431856 3:106263989-106264011 TTCATTCAGCAACTATATATTGG - Intergenic
959533636 3:107461571-107461593 TTAATTCAACTAACATTTATTGG - Intergenic
959693794 3:109227669-109227691 TTCATTTAGCAGATATTTATTGG + Intergenic
959796657 3:110439068-110439090 AGTGTTCAGCAAATATTTATTGG + Intergenic
959983065 3:112539716-112539738 TTTATTGAACAAATATTTATTGG - Intronic
960061638 3:113328996-113329018 TTAATTTAGCAAATATTTATTGG - Intronic
960130331 3:114048867-114048889 TTCCTTTAACAAATATTTATTGG - Intronic
960184220 3:114618556-114618578 TTAGTTTAAGAAATATTTTTGGG - Intronic
960212194 3:114983168-114983190 TTGTTTCAGCAAACAATTATTGG + Intronic
960399761 3:117181873-117181895 TTTATTTAACAAATATTTATTGG - Intergenic
960403081 3:117227695-117227717 TTCCTTCAATAAATATTTATTGG + Intergenic
960458507 3:117903274-117903296 TTCATTCAACAAATATTTATAGG - Intergenic
960692208 3:120358563-120358585 TTAATTCAACAAATACTTATTGG + Intergenic
960930875 3:122848207-122848229 TTAGGTTAACAAATATCTATGGG - Intronic
961099256 3:124184800-124184822 TTAATTCAACAATCATTTATTGG - Intronic
961821273 3:129576893-129576915 TTTACTCAGCAAATATGTATTGG - Intronic
961991393 3:131195941-131195963 TTCATTAAGCAAGTATTTATCGG - Intronic
962491772 3:135901511-135901533 TTCGTTCAACAAACACTTATTGG + Intergenic
962514553 3:136138230-136138252 TTATTTCAACAGATATTTACTGG + Intronic
962528328 3:136255531-136255553 TTAGTTCCACAAATACTTACTGG - Intronic
962747283 3:138406283-138406305 TTCTTTCCACAAATATTTATTGG + Intergenic
962927635 3:140010148-140010170 TTCATTCAACAAATATTTACGGG - Intronic
963175032 3:142289325-142289347 TCAGTTCAGCAACTATCTTTGGG + Intergenic
963622580 3:147630427-147630449 TTTATTAAGCAAATATTTAATGG + Intergenic
963654542 3:148028766-148028788 TTAATGCAGCAAATGTTTAGAGG + Intergenic
963857177 3:150266873-150266895 TTTATTCGGCAAATACTTATTGG + Intergenic
964449081 3:156792777-156792799 TTCATTCAACAAATATTTATTGG + Intergenic
964463103 3:156958662-156958684 TTTTTTCAGCAAGTATTTATTGG + Intronic
964997123 3:162895806-162895828 TTTTTTCAGCAAGTATATATTGG - Intergenic
965134816 3:164750239-164750261 TTGTCTCAGCAAATCTTTATTGG - Intergenic
965348641 3:167585139-167585161 TTTCTTTTGCAAATATTTATTGG - Intronic
965396821 3:168169694-168169716 TTAGTTAATCATATATGTATGGG + Intergenic
965619532 3:170629030-170629052 CTTAATCAGCAAATATTTATTGG + Intronic
965969442 3:174535759-174535781 TCAGTTCAACAAATACCTATTGG + Intronic
965988928 3:174791892-174791914 TTCACTCAACAAATATTTATTGG - Intronic
966009601 3:175058338-175058360 TTAATTTGTCAAATATTTATTGG + Intronic
966038626 3:175452026-175452048 GTAGTTACACAAATATTTATTGG + Intronic
966164237 3:176999146-176999168 TAAGTTCAACAAATATTTAATGG + Intergenic
966220577 3:177547317-177547339 TTCATTCACCAAATAGTTATGGG - Intergenic
966248581 3:177836643-177836665 CTAGTTCAGCCAACATTTCTTGG - Intergenic
966435874 3:179883407-179883429 TTAGTTCAGCTAATCTATTTTGG + Intronic
967190783 3:186983170-186983192 TTCATTCACCAAATATTTACTGG + Intronic
967222909 3:187263622-187263644 TTAATACAGAAACTATTTATTGG + Intronic
967332332 3:188303415-188303437 TTCATTCAACAAATATTTACTGG - Intronic
967671810 3:192245430-192245452 TTTACTCAGCAAACATTTATTGG + Intronic
968273982 3:197425912-197425934 GAAGCTCAGCAAATATTTTTTGG + Intergenic
969125237 4:4942800-4942822 TTCACTCAGCAAATATTCATTGG - Intergenic
969136631 4:5034456-5034478 TTCCTTCATCAAATATTTGTAGG - Intergenic
969226350 4:5800946-5800968 CCATTTCGGCAAATATTTATTGG - Intronic
969629112 4:8325174-8325196 TTCATTCAACAAATATTTATTGG - Intergenic
969987237 4:11225050-11225072 TTCATTCAGCAAATATTTAACGG - Intergenic
969993366 4:11287298-11287320 TTCATTCAGCAGAGATTTATTGG - Intergenic
969997267 4:11325749-11325771 TTTATTCAACAAATATTTATTGG + Intergenic
970226192 4:13859629-13859651 TTCATTCAAAAAATATTTATTGG - Intergenic
970285714 4:14511911-14511933 TTCATTTAGCAAATATTAATGGG - Intergenic
970408911 4:15788826-15788848 TTAGTTCAGAGAATATTTTGAGG + Intronic
970720747 4:18986062-18986084 AAAGTTCAGTAAATATTTCTGGG + Intergenic
970898957 4:21136449-21136471 TTAGTTCAGCAAATAGGCATTGG + Intronic
971082176 4:23226208-23226230 TTCAATCAGCAAATATTTAAGGG + Intergenic
971178174 4:24301894-24301916 TTCCTTCAGCAGACATTTATGGG - Intergenic
971348816 4:25838059-25838081 TTCATTCATCAAATATTTATGGG - Intronic
971557320 4:28030304-28030326 TTATATCACCAAACATTTATGGG - Intergenic
971748578 4:30616936-30616958 TGATTTCAGCAAATATATATTGG + Intergenic
971832050 4:31707106-31707128 TTAATTCAACAAATATGTATTGG - Intergenic
972149767 4:36074992-36075014 TTAGTTCCGCAAATCTATAATGG + Intronic
972207006 4:36785848-36785870 TTCATTCAGAAAATATTTAATGG + Intergenic
972209010 4:36814436-36814458 TTCATTCAGCAAATATTTATGGG - Intergenic
972337082 4:38116640-38116662 TTCATTCAACAAATACTTATGGG - Intronic
972394168 4:38644025-38644047 TTTACTCAACAAATATTTATTGG - Intergenic
972430850 4:38980438-38980460 TTTATTTGGCAAATATTTATTGG + Intronic
972439228 4:39069196-39069218 TCAGTTCTGCACATATTCATTGG + Intronic
972774687 4:42230101-42230123 TTTATTCTGCAAATATGTATTGG - Intergenic
972979751 4:44681964-44681986 TCAGTTCAGAAAGCATTTATTGG - Intronic
973111071 4:46398667-46398689 TTAGGCAAGCAAGTATTTATGGG - Intronic
973257182 4:48125334-48125356 CTCATTCAGCAACTATTTATTGG + Intronic
973269719 4:48250307-48250329 TAGGTTCAGGAAATATTTAGGGG - Intronic
973335738 4:48954745-48954767 TGATTTCAGCAAGAATTTATGGG + Intergenic
973622027 4:52736612-52736634 TTCGTTCAAAAAATATTAATTGG - Intronic
973635588 4:52859384-52859406 TGAATTCAATAAATATTTATTGG - Intergenic
973668580 4:53189916-53189938 ATTTTTCAGCAAAAATTTATTGG - Intronic
973671282 4:53220467-53220489 TTATTTCAACAAATAATTATTGG - Intronic
973738852 4:53900436-53900458 TTCATTCAGCAAATATGTGTTGG - Intronic
973793241 4:54397242-54397264 TTCATTCAACAAATACTTATGGG - Intergenic
973810937 4:54569652-54569674 TTTATTTAACAAATATTTATTGG + Intergenic
973913973 4:55614053-55614075 TTAGTTTAGCAGCTATTTCTAGG + Intronic
974647080 4:64708875-64708897 TTTATTCAGTAAACATTTATTGG + Intergenic
974708569 4:65557444-65557466 TTGATTCAGCAAATATTTATAGG + Intronic
974724025 4:65776431-65776453 TTAATTCAACATATAGTTATTGG - Intergenic
974734291 4:65909687-65909709 TTAATTCATCAAACATTCATTGG - Intergenic
974805616 4:66876549-66876571 TTCATTCAGTAAATTTTTATGGG + Intergenic
975171162 4:71233227-71233249 TTCATTCAGTAAATATTTACTGG - Intronic
975354170 4:73380959-73380981 TTAATTCAGCAAACACTTGTTGG + Intergenic
975400757 4:73936507-73936529 TGAGTCCAGCGAAAATTTATCGG + Intergenic
975457592 4:74610219-74610241 TCTGATCAACAAATATTTATTGG - Intergenic
975474204 4:74804127-74804149 TTAGTTCATCTACTATTTAAAGG - Intergenic
975482424 4:74895871-74895893 AAAATTCAGCAACTATTTATTGG + Intergenic
975544869 4:75550118-75550140 TTCATTCAACAACTATTTATTGG - Intronic
975788548 4:77921934-77921956 TTCGTTGAGCAAATAGTTATTGG + Intronic
975814823 4:78206588-78206610 TTAGTTCACGTAATATTTGTGGG + Intronic
976034948 4:80806471-80806493 TTCATTCAGCAAATATTTATTGG + Intronic
976133765 4:81912727-81912749 TTAATGCAACAATTATTTATTGG - Intronic
976708580 4:88044059-88044081 TTTATTCAGCAAACATTCATTGG + Intronic
976843759 4:89462875-89462897 TTAGCCCAACAAATATTTAAAGG - Intergenic
976923105 4:90462131-90462153 CTGGTTCAGTAAATATTTACTGG + Intronic
977078545 4:92491139-92491161 GTGATTCAGCAAATATTTATCGG - Intronic
977452289 4:97213914-97213936 TTTGTTCAATAAATACTTATTGG - Intronic
977456060 4:97260848-97260870 TTCATTCTGCTAATATTTATTGG - Intronic
977828542 4:101562566-101562588 TTCATTCAGCAAACATTTATTGG - Intronic
977839570 4:101686162-101686184 TTAATTCAACAAATATGTATTGG + Intronic
977853891 4:101864660-101864682 TTATTTAATCAAAGATTTATGGG + Intronic
977901283 4:102425127-102425149 TTAATTCAACAAAAATTGATTGG - Intronic
977911872 4:102546633-102546655 CTAGGTCAGCAAATATTTCCAGG - Intronic
978057759 4:104293623-104293645 TCATTTCAGCTACTATTTATTGG + Intergenic
978152989 4:105459041-105459063 TTTGCTCAGCAAGTATATATTGG - Intronic
978245470 4:106567048-106567070 TTCATTCAACAAGTATTTATTGG + Intergenic
978315437 4:107430666-107430688 TTCATTCAACAAATATTTATTGG - Intergenic
978387238 4:108188276-108188298 TTCATTCAACAAACATTTATTGG - Intergenic
978550818 4:109924473-109924495 TCAAGTCAGCAAGTATTTATTGG + Intronic
978640530 4:110866117-110866139 TTCCTTCAGCAAACATTTATTGG - Intergenic
978787546 4:112626632-112626654 TTTGTTCAACAAATATTTTTTGG - Intronic
978813258 4:112874882-112874904 GTAGCTCAGCAAATATTTGTCGG + Intronic
978901368 4:113953670-113953692 TTAAGGCAGCAAATGTTTATAGG + Intronic
978985312 4:115005059-115005081 TTAATTCTATAAATATTTATGGG + Intronic
979106358 4:116693644-116693666 GTTGTTCAGTAAATATTTGTAGG + Intergenic
979231631 4:118353498-118353520 TAATTTCAGCCAATGTTTATTGG - Intergenic
979301674 4:119093884-119093906 TAATTTCAGCATATATGTATGGG - Intergenic
979324304 4:119361211-119361233 ATAGTTTACTAAATATTTATGGG + Intergenic
979496971 4:121394537-121394559 TCTATTCAGCAATTATTTATTGG - Intergenic
979535033 4:121809958-121809980 TCATTTCAGAACATATTTATTGG + Exonic
980121030 4:128728131-128728153 TTCATTTAGCAAAGATTTATTGG + Intergenic
980164736 4:129211908-129211930 TTTATTCAACAAATATTTACTGG - Intergenic
980544840 4:134245424-134245446 TTTATTCAACAAATATTTATTGG - Intergenic
980750578 4:137081696-137081718 TTTATTTTGCAAATATTTATAGG + Intergenic
980997469 4:139793793-139793815 TTAGATCAGCAAACATCTATAGG + Intronic
981032042 4:140135486-140135508 TTTGTTCAACAAATATAAATTGG - Intronic
981177292 4:141696596-141696618 TTCGTTCAGAAAAGGTTTATAGG + Intronic
981294857 4:143120184-143120206 TAAATTTAACAAATATTTATGGG - Intergenic
981437142 4:144737672-144737694 CTTATTCAGCAAATATTTGTTGG + Intronic
981449232 4:144877015-144877037 TCAGTTATGAAAATATTTATAGG - Intergenic
981499040 4:145427367-145427389 AAAGTTCAGCAAACATTTAAAGG - Intergenic
981503286 4:145475017-145475039 TTCTTTCAGCAAATATTTGAGGG + Intergenic
981547775 4:145911845-145911867 TTCATTCAACAAATGTTTATTGG - Intronic
981585937 4:146302354-146302376 CTCTTTCAGCACATATTTATTGG + Intronic
981640988 4:146943673-146943695 TGAATGCAGCAAATATTTAAAGG + Intronic
981761227 4:148197390-148197412 TTAATTCAATAAGTATTTATGGG + Intronic
981762065 4:148205566-148205588 TTAATTCAACAAATAATTATCGG + Intronic
981773884 4:148342362-148342384 TTAATTCAACAAACATTTATAGG + Intronic
981887799 4:149698392-149698414 TTTATTCAGCAAACATTTATTGG - Intergenic
981949884 4:150393269-150393291 TTCATTCAGCAAATATGTATTGG - Intronic
982037618 4:151361958-151361980 TCAGTTCTGCCAATATTTATGGG - Intergenic
982369505 4:154619456-154619478 TTCACTCAACAAATATTTATTGG - Intergenic
982370774 4:154630586-154630608 TTAGTTCAGCACACATTGCTAGG + Intronic
982472253 4:155806716-155806738 TAAATTCAACAAATATTTATTGG - Exonic
982558937 4:156904923-156904945 TGTATTGAGCAAATATTTATTGG - Intronic
982703715 4:158685079-158685101 TAAATTAAGCATATATTTATAGG + Exonic
983024876 4:162723908-162723930 GTAGTTGAGTAAATTTTTATGGG - Intergenic
983242144 4:165245910-165245932 ATAGTTTACTAAATATTTATGGG + Intronic
983257565 4:165417530-165417552 TTCATTCCACAAATATTTATTGG + Intronic
983330006 4:166314151-166314173 TTACTTCAGCAAAAATGTATTGG - Intergenic
983465889 4:168089311-168089333 TGACTTCAGCAATTATTTCTTGG + Intergenic
983526353 4:168764002-168764024 TTACTGCAGTAAATATTTATAGG - Intronic
983706440 4:170665923-170665945 TTAATTCAATACATATTTATTGG + Intergenic
983803506 4:171965173-171965195 TTGATTCAACAAATATTTATGGG - Intronic
984059091 4:174969859-174969881 TAATTTAATCAAATATTTATGGG - Intronic
984085835 4:175310259-175310281 CTAATTCAGCTGATATTTATAGG - Intergenic
984119538 4:175724991-175725013 TTAGTTCAGGAGATATGTAAGGG - Intronic
984250419 4:177326336-177326358 TTAGTTGACCATATATGTATGGG + Intronic
984549589 4:181144738-181144760 TTATTTCAGAAAAGATTTATTGG + Intergenic
984570601 4:181388188-181388210 TTCATTCAACAAATATTTATTGG + Intergenic
984833335 4:183996990-183997012 TTCATTCAACAAATATTTGTTGG + Intronic
984848085 4:184124995-184125017 CTAGTTGAGTAAATATTTATTGG + Intronic
985019761 4:185675046-185675068 TTTATTCAAGAAATATTTATTGG - Intronic
985176180 4:187204591-187204613 TTCATTCAGCAAATATTTGCTGG + Intergenic
985291423 4:188391892-188391914 AGAGTTCAGCAAACATTTACTGG + Intergenic
985319477 4:188693729-188693751 TTAGGGTAGTAAATATTTATGGG + Intergenic
985356814 4:189129135-189129157 ATAGGCCAGCAAATATATATCGG - Intergenic
985365027 4:189220896-189220918 TTTGCTCACCAAATAATTATAGG - Intergenic
985372427 4:189300217-189300239 TTAATTCAATATATATTTATTGG - Intergenic
985476585 5:83015-83037 TTCATTCAACAAATCTTTATTGG + Intergenic
986201658 5:5584745-5584767 GTAAATCAGCAAATATTTCTAGG + Intergenic
986223635 5:5792990-5793012 TTAATTCAACAAATATTTATTGG - Intergenic
986278342 5:6301696-6301718 TTCATTCAGCAAATATTTATTGG + Intergenic
986639834 5:9861458-9861480 TTTATTGAACAAATATTTATTGG - Intergenic
986664700 5:10090801-10090823 CTTATTCAACAAATATTTATTGG + Intergenic
986683556 5:10255454-10255476 TTCATTCAACAAATATTTATTGG + Intronic
986714372 5:10512094-10512116 GTTGTTCAGCAAATATTTATTGG - Intronic
986724561 5:10584646-10584668 TTTATTTAGCAAATATTTATTGG + Intronic
986800633 5:11256690-11256712 TTAATTCAGCAAACATTTACGGG + Intronic
986932531 5:12844040-12844062 TTTATTCAACAAATATTTACAGG - Intergenic
986957002 5:13164493-13164515 TTTTTTCCCCAAATATTTATTGG - Intergenic
986972790 5:13356519-13356541 TTTATTCACCAAATACTTATTGG - Intergenic
987067111 5:14300846-14300868 TTAATTCTAAAAATATTTATGGG - Intronic
987483303 5:18488452-18488474 TTTAATGAGCAAATATTTATTGG + Intergenic
987552907 5:19407069-19407091 TTTCTTCAGCAAATAATTATGGG - Intergenic
987637793 5:20567907-20567929 CTTGTTCAGCAAATTTTTCTTGG + Intronic
987658651 5:20842707-20842729 TTAGTTAAGCAATAATTTACTGG - Intergenic
987945439 5:24602297-24602319 TCATTTCAGCAAGTATTTAGTGG + Intronic
987955500 5:24734475-24734497 TTAGCTCAATAAATATTAATTGG - Intergenic
988044446 5:25932131-25932153 TTTTTTCAGCAAATATTTGTGGG - Intergenic
988206306 5:28140286-28140308 ATATTTCAATAAATATTTATAGG + Intergenic
988269900 5:29000604-29000626 TTAGTTAAACAAGTATTTACAGG - Intergenic
988335786 5:29907455-29907477 ATCATTCAGTAAATATTTATTGG - Intergenic
988660311 5:33259325-33259347 TTCATTCAGCAAATATTTATTGG + Intergenic
988687260 5:33537148-33537170 TTAGTTTGGTAACTATTTATTGG + Intronic
988765032 5:34363227-34363249 TTAGTTAAGCAATAATTTACTGG + Intergenic
988773360 5:34453286-34453308 TTATTTCTGCAACTAGTTATAGG - Intergenic
989011102 5:36874711-36874733 TTCATTCAGCAAGTATTTATTGG - Intergenic
989038398 5:37199607-37199629 TTTATTCAACAAACATTTATTGG - Intronic
989156623 5:38350671-38350693 TTCATTCAGCAAATATCAATAGG + Intronic
989701377 5:44269113-44269135 TTCTTTCCTCAAATATTTATTGG + Intergenic
990025606 5:51183803-51183825 TTTATTCAGAAAATATTTATTGG + Intergenic
990894875 5:60688055-60688077 TTCATTCAGCAAATATTTCTAGG + Intronic
991010395 5:61876628-61876650 TTAATTCAGCAAATGTTTTGGGG - Intergenic
991126687 5:63077643-63077665 TTAGTTGAGCCAATAATTGTTGG + Intergenic
991205775 5:64048858-64048880 TTATTTCTGCAACTAGTTATAGG - Intergenic
991586394 5:68206453-68206475 TTAATTCAGAAAGTATTTATTGG + Intergenic
991627812 5:68622471-68622493 TTCATTCAACAAATATTTATTGG - Intergenic
992036928 5:72789027-72789049 TTCATTCCACAAATATTTATTGG - Intergenic
992265131 5:75011062-75011084 TTCATTCAGCAAATATTTACTGG + Intergenic
992516083 5:77493354-77493376 TTAATTCAGCAAACATGTATTGG + Intronic
992535438 5:77697332-77697354 TTACTTCAGTAAATATTTCATGG - Intronic
992775318 5:80083790-80083812 TTAATTCAGTAAACATTTACTGG - Intergenic
993391784 5:87327078-87327100 TTAATTAAGCTAATATTTACTGG + Intronic
993401274 5:87455674-87455696 TGAGTTCTAAAAATATTTATTGG - Intergenic
993459601 5:88166850-88166872 TTTGTCCAGCAAACATTTAGTGG - Intergenic
993493725 5:88584110-88584132 TTTTTTCAACAAATAATTATTGG - Intergenic
993507911 5:88733578-88733600 ATATTTCAGGAGATATTTATGGG + Intronic
993635990 5:90344143-90344165 TTCATCCAACAAATATTTATTGG - Intergenic
993788958 5:92182998-92183020 TTAGGTCAACAAATATTTATTGG + Intergenic
993992984 5:94683310-94683332 TTTATTCAGCAAAATTTTATTGG + Intronic
994056329 5:95420856-95420878 GCAGTTCAGCAAATATGTGTAGG + Intronic
994127313 5:96182671-96182693 TTTATTCAACAAATATGTATTGG + Intergenic
994384666 5:99116277-99116299 TTATTTCACCAAAAATTTACTGG - Intergenic
994668747 5:102740607-102740629 TTTATTCAACAAATATTTATTGG - Intergenic
994726901 5:103446763-103446785 TTAATGCACAAAATATTTATTGG - Intergenic
994798515 5:104338730-104338752 TTAATATAGCAATTATTTATTGG + Intergenic
994840520 5:104919467-104919489 TTAATTCAGTAAATACATATTGG - Intergenic
994880325 5:105484364-105484386 AAAGGTGAGCAAATATTTATGGG + Intergenic
994932841 5:106211357-106211379 TTTTCACAGCAAATATTTATAGG - Intergenic
994990756 5:106993950-106993972 TTACTTTAGCCTATATTTATTGG + Intergenic
995031586 5:107487842-107487864 TAAATTCAGCAAATATTTGTTGG - Intronic
995531098 5:113092602-113092624 TTCTTTCAGCAAAGATCTATAGG - Intronic
995608671 5:113886517-113886539 TTAATTCAGTAGACATTTATTGG + Intergenic
996328447 5:122303325-122303347 TTTATTCAGCAAATATTCTTGGG - Intergenic
996613032 5:125406850-125406872 TTAGGTCAACAAACATTTATTGG + Intergenic
996619508 5:125482981-125483003 TTATTTCAACAAATATTTCAGGG + Intergenic
996814239 5:127556882-127556904 TACATTCAACAAATATTTATAGG - Intergenic
996918520 5:128738502-128738524 TTCATTCAACAAATACTTATTGG - Intronic
996951687 5:129134380-129134402 TGAGTTCAGAAAACATTTGTGGG + Intergenic
997301681 5:132810800-132810822 TTATTTCAACAAACATCTATTGG - Intergenic
997828679 5:137130374-137130396 TTTATTCAACAAATACTTATGGG - Intronic
997919194 5:137962017-137962039 TTGATTCAACAAATATGTATAGG - Intronic
998366290 5:141634660-141634682 TTTATTCAATAAATATTTATTGG - Intronic
998408249 5:141886991-141887013 TTAAGTCATAAAATATTTATTGG + Intergenic
998538136 5:142953237-142953259 TTAATTCAGTGAATATTTATTGG + Intronic
998581657 5:143383474-143383496 TTAATTCAACAAACATTTACTGG + Intronic
998734314 5:145118052-145118074 TTAATTCATCAAATATTTAGTGG - Intergenic
998921204 5:147070247-147070269 TTTATTCAGTAAATATATATGGG - Intronic
998975645 5:147643620-147643642 ACAGTTCAACAAATATTTGTTGG - Intronic
999519021 5:152331223-152331245 TTATTTCATTAAATATTTACTGG - Intergenic
999577230 5:152992551-152992573 TTCCCTCAGCAAATATTTAATGG + Intergenic
999637805 5:153640805-153640827 TAAATTCAACAGATATTTATTGG - Intronic
999687484 5:154115990-154116012 CTCATTCAGTAAATATTTATGGG - Intronic
999690237 5:154140121-154140143 TTCATTCAACAAATATTTATTGG - Intronic
999812946 5:155145122-155145144 TTCATTCAGCAAATAGTTCTGGG + Intergenic
999981011 5:156957866-156957888 TTAATTTACCAAATATTCATAGG - Intronic
1000254263 5:159522993-159523015 ATAGTTTAGCAAATTTTTAATGG - Intergenic
1000257465 5:159553625-159553647 TATGTTCAACAAATACTTATTGG - Intergenic
1000338909 5:160261918-160261940 TTCATTTAACAAATATTTATTGG - Intronic
1000396106 5:160776235-160776257 TTAATTCTTCAAATATTTATGGG - Intronic
1000450101 5:161374932-161374954 TCTATTCAGCAAATCTTTATTGG - Intronic
1000564007 5:162825337-162825359 TAACTTGAGCAAATATTTAAAGG + Intergenic
1000666645 5:164006033-164006055 TTAATTTACTAAATATTTATTGG + Intergenic
1000729915 5:164821268-164821290 TTACTTAGACAAATATTTATGGG + Intergenic
1000731780 5:164843704-164843726 GTAGTTGAGAAAATATTCATGGG + Intergenic
1000997383 5:167973386-167973408 TTAATTCAGCCAACATTTGTAGG + Intronic
1001046250 5:168374131-168374153 TTCATTTAGCAAATGTTTATTGG + Intronic
1001168713 5:169395710-169395732 TTATTTTAAAAAATATTTATCGG + Intergenic
1001942447 5:175750387-175750409 TTCATTCAACAAACATTTATTGG + Intergenic
1002120814 5:177003015-177003037 TTCACTCAGCAAATATTTATAGG - Intronic
1002512847 5:179733797-179733819 TTTATTCTGCAAATGTTTATTGG + Intronic
1002615298 5:180450089-180450111 TTAGTTCTGCAAGTATATGTGGG - Intergenic
1003103707 6:3197278-3197300 TTTATTCAACAAATATTTATGGG - Intergenic
1003344052 6:5248899-5248921 TTCATTCAGCAAACATTTATTGG - Intronic
1003485008 6:6567914-6567936 TTAGTTCCCCAATTAGTTATGGG - Intergenic
1003646795 6:7919423-7919445 TTCACTCAACAAATATTTATTGG + Intronic
1003707478 6:8550004-8550026 TTCATTCAGCAACAATTTATTGG + Intergenic
1003808344 6:9752050-9752072 TTTGCTCAGCAAATATTTATCGG - Intronic
1003944455 6:11060983-11061005 TTAGTTGACCATATATGTATGGG + Intergenic
1003981035 6:11389957-11389979 TTTATTCATCAAATATTTGTTGG - Intergenic
1003983602 6:11413284-11413306 TTAGTTCAACAGTTATTCATGGG + Intergenic
1004066207 6:12246992-12247014 TCAATTCAACAAATGTTTATTGG - Intergenic
1004275479 6:14231945-14231967 TTGATTCAGCAAATATCTATTGG + Intergenic
1005079940 6:21946685-21946707 TTACTTCTTCAAATATTTAGTGG + Intergenic
1005123763 6:22421424-22421446 ATCATTCAGGAAATATTTATTGG + Intergenic
1005179606 6:23089599-23089621 TTCATTTAACAAATATTTATTGG - Intergenic
1005282878 6:24293327-24293349 CAAGTTCAGTAAATTTTTATGGG + Intronic
1005322080 6:24665574-24665596 TACATTCAGTAAATATTTATTGG + Intronic
1005455797 6:26018578-26018600 TTTATTCAACAAATATTTATGGG + Intergenic
1005664450 6:28037229-28037251 TTCTATCAGCAAATATTTATAGG - Intergenic
1006270398 6:32961075-32961097 TTTATTTAGCAAATATTTATTGG + Intronic
1007060321 6:38933899-38933921 TCAGTTTGACAAATATTTATTGG + Intronic
1007448088 6:41922080-41922102 TTGGTTTTGTAAATATTTATGGG + Intronic
1007855263 6:44849114-44849136 TTTATTCAACAAATATTTGTTGG - Intronic
1007856001 6:44858244-44858266 TTTGTTCAATGAATATTTATTGG - Intronic
1008310280 6:49960323-49960345 TCAGTGCAGCAAATTTTTCTTGG + Exonic
1008342120 6:50380001-50380023 TTATTTCAGCAAATATTATTGGG - Intergenic
1008464919 6:51819699-51819721 TTTATTCAGCAACTATTTACTGG - Intronic
1008485554 6:52031064-52031086 TCACTTCAACAAAGATTTATTGG + Intronic
1008869536 6:56256104-56256126 TTTGTTCAGCAACTATTTAATGG - Intronic
1008883440 6:56405828-56405850 TGTGTTCAGTAAATGTTTATTGG + Intergenic
1008886410 6:56435948-56435970 TTTATTCAGCAAATATTTGTTGG + Intergenic
1009440807 6:63676195-63676217 TTTATTCAGCAAATATTTTCTGG + Intronic
1009530395 6:64805005-64805027 TTAATTCAGCAAATATTTTTTGG - Intronic
1009730818 6:67603628-67603650 TTAATTCTGTAAATATTTATTGG - Intergenic
1009780580 6:68263981-68264003 CTCTTTCAGCAAATATTTACTGG + Intergenic
1009833298 6:68966816-68966838 TTCATTCAACAAATATTTACTGG - Intronic
1010059876 6:71610466-71610488 TTCAGTCAGCAAATATTTTTTGG + Intergenic
1010568374 6:77446958-77446980 TTGGTTTAGCCAATATATATAGG + Intergenic
1010581464 6:77602060-77602082 TTTATTCAACAAATATTTGTAGG + Intergenic
1010619042 6:78051524-78051546 ATATTTCTGCAAATATTCATAGG - Intergenic
1010985579 6:82420187-82420209 TTTATTCAACATATATTTATGGG + Intergenic
1011313909 6:86010570-86010592 TTCATTCAACAAATATTTGTTGG - Intergenic
1011363926 6:86559464-86559486 TTCATTTAACAAATATTTATTGG - Intergenic
1011631686 6:89332436-89332458 TTTATTCAACAATTATTTATTGG + Intronic
1012113888 6:95269097-95269119 TTAATTCATTAAATAATTATAGG + Intergenic
1012218866 6:96623567-96623589 TTAATTCAGAAAGTATTTATTGG - Intergenic
1012425595 6:99110819-99110841 TCAGTTCAGAAAGTATTTATTGG - Intergenic
1012532278 6:100252127-100252149 TTAGTTCAGTAAATTTTTTAAGG + Intergenic
1012627983 6:101427531-101427553 TTCATTCAGCAAATATTGACTGG - Intronic
1012695128 6:102371317-102371339 TTATTTCTGGAAATTTTTATTGG - Intergenic
1012949597 6:105503785-105503807 TTCCTTTAGTAAATATTTATTGG - Intergenic
1012981900 6:105839923-105839945 TTCTTTCAACAAATATTTATTGG + Intergenic
1013226444 6:108122185-108122207 TTGGTTCAGCAAATGTTTCTTGG - Intronic
1013381257 6:109573630-109573652 TGAAGTCAACAAATATTTATTGG + Intronic
1013462401 6:110387638-110387660 TTGTTTAAGCAAATATTTAGGGG + Intergenic
1013789500 6:113820901-113820923 TGATTTCAACAAAGATTTATTGG + Intergenic
1014221630 6:118804242-118804264 CTCATTCAACAAATATTTATCGG + Intergenic
1014506249 6:122261654-122261676 TTTGTTCAGTATATATTTATGGG - Intergenic
1014983366 6:127972742-127972764 TTACTGCAGCAAATATTTTTTGG + Intronic
1015095006 6:129405297-129405319 TTACTACAGCAAATTTTTATTGG - Intronic
1015108802 6:129568625-129568647 TTCATTCAACAAATATTTATTGG - Intergenic
1015210731 6:130695472-130695494 TTCATTCAACAAATATTTATTGG - Intergenic
1015335573 6:132033923-132033945 TTAATTCAACAAGTATATATTGG - Intergenic
1015436698 6:133197971-133197993 CTTATTCAGCAAGTATTTATTGG - Intergenic
1015511787 6:134044806-134044828 TTACTTCTGCAAATACATATTGG - Intronic
1015572029 6:134631983-134632005 TTCGTTTAACAAATATTTGTTGG + Intergenic
1015686862 6:135873885-135873907 TTCATTCAACAAATATTTATTGG + Intronic
1015981967 6:138848230-138848252 TCAATTCAACAAAAATTTATTGG - Intronic
1015998547 6:139019304-139019326 CTCATTCATCAAATATTTATTGG - Intergenic
1016048423 6:139504509-139504531 TAACTCCAGCAAAGATTTATTGG + Intergenic
1016080910 6:139854635-139854657 TTCATTCCACAAATATTTATGGG - Intergenic
1016432019 6:143995547-143995569 TTTATTCAACAAATATTTATAGG - Intronic
1016727924 6:147396676-147396698 TTTATTCAACAAATATTTGTTGG + Intergenic
1016827009 6:148397739-148397761 TGAATTCAACAAATACTTATTGG - Intronic
1016861344 6:148721700-148721722 TTCATTCACCAAATATTTATTGG + Intergenic
1016907340 6:149164685-149164707 TCAATTCAATAAATATTTATTGG - Intergenic
1017176665 6:151511480-151511502 TTCATTCACCAGATATTTATGGG + Intronic
1017537862 6:155367655-155367677 TTCATTCAGCGAATATTTATTGG + Intergenic
1017543546 6:155427399-155427421 TTAGTTTGACAAATATTTATTGG - Intronic
1017555542 6:155562627-155562649 TGAGTGGAGCAAATATTTCTTGG - Intergenic
1017628110 6:156368799-156368821 TTTATTCTGCAAATATTTTTAGG - Intergenic
1018801151 6:167223140-167223162 TGCATTCAGCAAATATTTGTTGG + Intergenic
1018889469 6:167973184-167973206 TTAATTCAGCAGATGTTTATGGG + Intergenic
1020368476 7:7406236-7406258 TTAATTCAACAAACAATTATTGG - Intronic
1020392515 7:7673832-7673854 TTCATTCAGCAAATATTTATTGG - Intronic
1020572120 7:9876960-9876982 TTCATTCAGCATATATTTATTGG - Intergenic
1020580796 7:9998074-9998096 TTAGTTCTTCAAATTTTTAATGG - Intergenic
1020613987 7:10435759-10435781 TTCATTCAGCAAATATTTGCTGG - Intergenic
1020674655 7:11167490-11167512 ATAGTTCAGAAAATATTGATTGG + Intronic
1021161355 7:17276980-17277002 TTTATTCAACAAATATTTATTGG + Intergenic
1021496860 7:21284525-21284547 TTTATTCAACAGATATTTATTGG + Intergenic
1021516985 7:21500281-21500303 TTAGGTCAGCTATAATTTATTGG + Intronic
1021640677 7:22733457-22733479 TTTGTTCAAAAAATATTTACTGG - Intergenic
1021824800 7:24538929-24538951 TTAGCTCAACAAGTATTTATTGG - Intergenic
1021845546 7:24758930-24758952 TTAATTCAACAATTATTTACTGG - Intergenic
1022328677 7:29356949-29356971 TTCTCTCAACAAATATTTATTGG - Intronic
1022628601 7:32063984-32064006 ATCGTTCAGCATATTTTTATTGG - Intronic
1022636051 7:32136554-32136576 TTCTTTCAGCAAATATTTATTGG - Intronic
1022656683 7:32325666-32325688 TTCTTTCAACAAATGTTTATTGG - Intergenic
1022702123 7:32771490-32771512 TTCATTAAGCTAATATTTATTGG - Intergenic
1022906360 7:34861631-34861653 TTCATTAAGCTAATATTTATTGG - Intronic
1022955684 7:35378031-35378053 TTTGTTCAGCAACTCTTTATTGG - Intergenic
1022965488 7:35467750-35467772 GTGATTCAGCAAATATTTACAGG - Intergenic
1023264400 7:38391298-38391320 TTAATTTACCAAATATTTATGGG + Intronic
1023525183 7:41095025-41095047 TTCTTGCAACAAATATTTATTGG + Intergenic
1023575713 7:41624093-41624115 TTAATTCAACATATATTTATTGG - Intergenic
1024657432 7:51463443-51463465 TTCATTTAGGAAATATTTATTGG - Intergenic
1024728412 7:52227755-52227777 TTTGTTCAACAAAGATTTACTGG - Intergenic
1024823122 7:53357431-53357453 ATAGTTTAGCTAATATATATTGG - Intergenic
1024966813 7:55030550-55030572 TTTTTTCTGCAAGTATTTATAGG - Intronic
1025102236 7:56145200-56145222 TTAGTTAATCAAATATTTATAGG + Intergenic
1025254983 7:57378748-57378770 TCATTTTAGCAAATATGTATTGG + Intergenic
1025256386 7:57386353-57386375 TTAATTCAGCAGATATTTTATGG - Intergenic
1026058109 7:67002697-67002719 TTAGTTCTGTTAATATTTCTTGG + Intronic
1026719979 7:72822328-72822350 TTAGTTCTGTTAATATTTCTTGG - Intronic
1027476267 7:78635505-78635527 TTTCTTTAGCAAATATGTATTGG - Intronic
1028487757 7:91378588-91378610 TTAATTTGACAAATATTTATTGG + Intergenic
1028928890 7:96390988-96391010 TTTATTCAACAAATATTTATTGG - Intergenic
1029055592 7:97738102-97738124 TTAGTTAAGGAAATATAAATAGG + Intronic
1029106617 7:98182184-98182206 TTTATTCAGCAGTTATTTATTGG + Intronic
1029294993 7:99533437-99533459 TATGGTCAACAAATATTTATTGG - Exonic
1029798221 7:102917869-102917891 TTAGTTCCGGAAACATTTAGAGG + Intronic
1030145912 7:106355416-106355438 TTCATTCAACAAATATTTAATGG - Intergenic
1030195705 7:106851508-106851530 TTATTTTAGCAAACATTTATTGG - Intergenic
1030581368 7:111359793-111359815 TTCATTCAATAAATATTTATTGG - Intronic
1030655062 7:112158340-112158362 TTTGTTCAAAAAGTATTTATTGG - Intronic
1030814848 7:114023262-114023284 TTAATTCAGCAGATTTTCATTGG + Intronic
1030876202 7:114816556-114816578 TTAATTCAACAAATATTTAGTGG - Intergenic
1030934892 7:115573472-115573494 TTAGTTCAACAAATATTGGTTGG + Intergenic
1030977146 7:116140795-116140817 ATCATTCAGCAAATGTTTATAGG + Intronic
1031269141 7:119623135-119623157 TTTATTCAACAAATATTTATAGG + Intergenic
1031344410 7:120647701-120647723 TTAATTTGGCAAATATTTAATGG - Intronic
1031345827 7:120665220-120665242 TTATTTCAGCAATTATTCAATGG - Intronic
1031373301 7:120994350-120994372 TTCATTTAGTAAATATTTATTGG + Intronic
1031943770 7:127816976-127816998 TTCATTCAGCAGATATTTTTTGG + Intronic
1032618679 7:133503675-133503697 TTATTTCCGCAAATGTTTATTGG - Intronic
1032635908 7:133708478-133708500 TTTATTCAATAAATATTTATTGG + Intronic
1032800174 7:135311470-135311492 TTAGATCAGCTAATATTGATGGG - Intergenic
1033242965 7:139695938-139695960 TTAATTCAGGAAACATTTATTGG - Intronic
1033414601 7:141151052-141151074 TTCCTTCAACAAATATTTAAGGG + Intronic
1033656027 7:143375098-143375120 TTTATTCAGCAAACATTTACTGG - Intergenic
1033949493 7:146766176-146766198 TTCATTCAATAAATATTTATTGG - Intronic
1034068258 7:148157337-148157359 TTTGCTCAGCAAATATTTATTGG - Intronic
1034082142 7:148288818-148288840 TAAATTTAGCAAATATTTCTTGG + Intronic
1034862513 7:154611388-154611410 GTGGTTCAGCAAATGTTTGTGGG + Intronic
1035084105 7:156241590-156241612 GTATCTCAGCAAACATTTATTGG + Intergenic
1035105400 7:156437802-156437824 TTTATTCTACAAATATTTATTGG + Intergenic
1035981856 8:4381400-4381422 TTACGTCAGGAAATATTCATGGG - Intronic
1036098168 8:5748258-5748280 TTCATTCGGCAAATGTTTATCGG + Intergenic
1036658656 8:10693471-10693493 TTAGGTCAGCAAATACTTATTGG - Intronic
1037075117 8:14705956-14705978 TTCATTCAACAAATAATTATGGG - Intronic
1037106586 8:15115930-15115952 ATAGTTCAGCAAACTTTAATAGG + Intronic
1037144063 8:15552286-15552308 TTTTGTCAACAAATATTTATTGG + Intronic
1037186210 8:16066586-16066608 TTTATTCAACACATATTTATTGG + Intergenic
1037243856 8:16808154-16808176 ATATTTCAGCAAAAGTTTATAGG + Intergenic
1037244162 8:16812706-16812728 TAAGTTCACAAAATATTTGTTGG + Intergenic
1037423415 8:18728019-18728041 TTCATTCAGCAAATATTTAAGGG - Intronic
1037495116 8:19432496-19432518 TTATTTCTTCAAATATTTTTAGG + Intronic
1037580527 8:20243331-20243353 TTTCTTCAATAAATATTTATTGG - Intergenic
1037790660 8:21937617-21937639 TTAGTTCATCAATTATTAAAAGG + Intronic
1038022566 8:23562488-23562510 TTCATTCAACAAATATTTATTGG + Intronic
1038146964 8:24906010-24906032 TTTGCACAACAAATATTTATTGG + Intergenic
1038292360 8:26261286-26261308 TTAGTTCAGAAGATTTTAATAGG - Intergenic
1038650026 8:29394184-29394206 TTCATTCAGCAAATATTTACTGG - Intergenic
1038698364 8:29826490-29826512 TAATTTCAACAAATATTTGTTGG + Intergenic
1038947557 8:32377927-32377949 TTAGTTTGGCAAATATTTACTGG - Intronic
1039073866 8:33671140-33671162 TTCCTTCAGGAAATATCTATCGG + Intergenic
1039155276 8:34548698-34548720 TTAGTTGACCACATATATATTGG + Intergenic
1039394036 8:37207600-37207622 TTAATTCAGCAAACATTTGTTGG + Intergenic
1039399580 8:37257910-37257932 TTCATTCAACAACTATTTATTGG - Intergenic
1039852973 8:41387308-41387330 GTTGTTCAGCCAATATTTGTTGG - Intergenic
1039883764 8:41643867-41643889 TTAGCTCAGCAAATATCTCCTGG + Intergenic
1040522528 8:48190699-48190721 TTCATTCAGCCAATATTTATTGG + Intergenic
1041384850 8:57289951-57289973 TTATTTCAACAAAGATTTATTGG + Intergenic
1041425247 8:57713524-57713546 CTAATTCAGCAAATATTTTGAGG + Intergenic
1041596670 8:59662578-59662600 TTAATTCAGTAAATACTTACTGG + Intergenic
1041636876 8:60154897-60154919 GTAGTTAAGCAAATATTTGAAGG - Intergenic
1041823005 8:62061263-62061285 TTAGTTGTGCAAATATATTTAGG - Intergenic
1042214314 8:66414338-66414360 ATAGTTTAGAAAACATTTATAGG - Intergenic
1042262484 8:66873491-66873513 TTATTTCAACAAACATTTTTGGG + Intronic
1042411111 8:68466675-68466697 TTATTTTAGCAAATATTTCATGG - Intronic
1042451165 8:68948736-68948758 TCTATTCAGCAAATATTTATTGG + Intergenic
1042569141 8:70143570-70143592 TTCCTTCAGCAAATATTTATTGG - Intronic
1042640180 8:70925304-70925326 TTTATTCAACACATATTTATAGG - Intergenic
1042721359 8:71830233-71830255 TTAGTTCAGCACATATAAATTGG + Intronic
1043137582 8:76547851-76547873 TTCATTCAACAAATATTTGTTGG - Intergenic
1043288218 8:78561938-78561960 GTTCTTCAGCAAATATTTACTGG + Intronic
1043308767 8:78831819-78831841 TTAGTTCTTAGAATATTTATTGG + Intergenic
1043354952 8:79401430-79401452 TTCATTCAGCAAAGATTTAATGG + Intergenic
1043487673 8:80714301-80714323 TTCGTTCAACAAATATTTGTTGG - Intronic
1043691216 8:83154821-83154843 TTTATTCATCAAATATTTGTAGG - Intergenic
1043932865 8:86110458-86110480 ATAGTTCAGTAAAGGTTTATTGG + Intronic
1043973790 8:86562973-86562995 TTCTTTGAACAAATATTTATTGG + Intronic
1043999263 8:86858796-86858818 AGAATTCAGCCAATATTTATTGG - Intergenic
1044089061 8:87976931-87976953 TTAATCCAGCATATATTTATTGG + Intergenic
1044153218 8:88808866-88808888 TTATTTCAACAAATATTTATCGG - Intergenic
1044167058 8:88998506-88998528 CTAATTCTGCAAATATTGATTGG - Intergenic
1044261717 8:90132440-90132462 TTCATTCAACAGATATTTATTGG + Intergenic
1044684406 8:94813181-94813203 TTTATTTAGCAAATATTTACTGG + Intergenic
1044848562 8:96405973-96405995 TTCATTCAACAAATATTTTTTGG + Intergenic
1044876115 8:96668229-96668251 TTCAGTCAACAAATATTTATTGG + Intronic
1045332668 8:101169161-101169183 TTCATTCAGCAATGATTTATTGG + Intergenic
1045336722 8:101211209-101211231 TTCATTCAACAAATATTTATTGG - Intergenic
1045361905 8:101440725-101440747 TGGATTCAGCAAATATTTGTTGG - Intergenic
1045551430 8:103176280-103176302 TTAATTCAGCAAGTATGTACTGG + Intronic
1045710280 8:104975244-104975266 TTTCTTCAGAAAATGTTTATTGG + Intronic
1046054225 8:109060146-109060168 TTAATTCAACAAATATTTATTGG - Intergenic
1046089052 8:109476776-109476798 TCCATTCAGCAAACATTTATTGG - Intronic
1046303193 8:112325588-112325610 GTCATTCAGCAAATATTTATTGG - Intronic
1046314615 8:112483037-112483059 CTAATACAGCATATATTTATTGG - Intronic
1046341204 8:112857881-112857903 TCAATGCAACAAATATTTATTGG - Intronic
1046341801 8:112868704-112868726 TTAGTTGACTATATATTTATGGG - Intronic
1046351163 8:113014298-113014320 TTTGTTCTGCAAATAATTAGTGG + Intronic
1046504211 8:115116079-115116101 TTAGTTGAACAAATTTTGATAGG - Intergenic
1046824454 8:118671719-118671741 TTAGTTTAACAAACATTTGTTGG - Intergenic
1046842418 8:118874400-118874422 CTCATTCTGCAAATATTTATTGG + Intergenic
1047547322 8:125831402-125831424 TTTGTTCAACAAAGATTTATAGG - Intergenic
1047559862 8:125975099-125975121 TTCATTCAACAAATATTTATAGG - Intergenic
1048016342 8:130500869-130500891 GTTGTTCAACAAACATTTATTGG - Intergenic
1048037916 8:130694719-130694741 GTAGTGAAGCAAATATTCATTGG + Intergenic
1048352319 8:133626030-133626052 TTTGTTCAACAAATATTTATTGG - Intergenic
1048382537 8:133880085-133880107 TTCATCCAACAAATATTTATGGG - Intergenic
1048700791 8:137087084-137087106 TTGGTTCATCAAATATTCAGAGG + Intergenic
1050059921 9:1697086-1697108 TTAGTTAACCAAATATTTGAGGG - Intergenic
1050114643 9:2251083-2251105 TTCATTCAACAAATGTTTATTGG - Intergenic
1050267184 9:3903584-3903606 TTTGTCGAACAAATATTTATTGG + Intronic
1050290760 9:4151976-4151998 GTTATTCAACAAATATTTATGGG + Intronic
1050434849 9:5598101-5598123 CCAGTTCAGGAAATATTTGTGGG + Intergenic
1050606349 9:7305357-7305379 TTAATTCAATAAATATGTATAGG - Intergenic
1050616854 9:7410299-7410321 TTTTTTCAGCAAATATATATTGG - Intergenic
1051028329 9:12641828-12641850 TGAGTTTAGTAAATATTTATGGG - Intergenic
1051135895 9:13919960-13919982 TTCGGTCAGTAAATATATATTGG - Intergenic
1051407182 9:16750298-16750320 TAATTTCAGAAAATATTTTTAGG - Intronic
1052040570 9:23734216-23734238 TCAAGGCAGCAAATATTTATTGG + Intronic
1052194092 9:25691389-25691411 TTTATTCAGTGAATATTTATTGG - Intergenic
1052238927 9:26248700-26248722 TGTGTTCAGTAAATATTTGTTGG - Intergenic
1052334732 9:27307759-27307781 TTGGTTCAGCACAGATTTGTAGG - Intergenic
1052352398 9:27470816-27470838 TTTTCTCAGCAAATATTTATGGG + Intronic
1052716008 9:32118233-32118255 TTCATTCAACAAATGTTTATTGG + Intergenic
1052860145 9:33432918-33432940 TTATTTCATCAAACATTTATTGG - Intergenic
1053091612 9:35283307-35283329 TTTATTCAACTAATATTTATTGG - Intronic
1053295336 9:36908941-36908963 TTTATTCAACAAATATTTCTTGG + Intronic
1053380676 9:37647603-37647625 TTCATTCAATAAATATTTATGGG + Intronic
1054851167 9:69848327-69848349 TTCCTTCTACAAATATTTATTGG - Intronic
1054919281 9:70525850-70525872 TCAATTCAGGAAATATTTCTTGG - Intergenic
1054944895 9:70785151-70785173 TGAGTTCAGTAAACATTTGTTGG + Intronic
1054969064 9:71063325-71063347 TGAAATCAGTAAATATTTATTGG + Intronic
1055137756 9:72842732-72842754 TTACTTCAGGAAATCTTAATAGG + Intergenic
1055166279 9:73199284-73199306 TTAATTCAGAATATATTTTTTGG - Intergenic
1055255238 9:74362077-74362099 TTACTTCCGCAAATATAAATAGG - Intergenic
1055256597 9:74379092-74379114 TTATTTCAGAAAGTATTTAGAGG + Intergenic
1055301814 9:74890372-74890394 TATGTTCAGGAAATATTTGTTGG - Intergenic
1055475423 9:76658505-76658527 TCATTTCTGCAAATGTTTATGGG - Intronic
1055632788 9:78240633-78240655 TTTCTTCAAGAAATATTTATGGG + Intronic
1055634288 9:78259973-78259995 TTTATTCAGCAATTATTTATTGG + Intronic
1055882621 9:81019783-81019805 TTAATTCAATAAATATTTACTGG - Intergenic
1055929685 9:81547097-81547119 ATAATTAAGCAAATATTTAGTGG - Intergenic
1056046191 9:82719651-82719673 TTAATTCAACAAATATTTATTGG + Intergenic
1056244570 9:84681449-84681471 TTCTTTCAACAAATATTGATTGG + Intronic
1056418772 9:86403271-86403293 GGAGTTCAGCAAATATTGATGGG + Intergenic
1056477817 9:86969746-86969768 TTAGTTCAACAAACATTCAGTGG + Intergenic
1056487234 9:87071680-87071702 TTCATTCAACAAATATTTATTGG + Intergenic
1056890626 9:90488530-90488552 TTCCTTCAGCAGATATTGATTGG + Intergenic
1056896625 9:90556797-90556819 TTAATTCAGTGAATAGTTATAGG - Intergenic
1056944393 9:90981853-90981875 AGAGTTCAGAAAATATCTATGGG - Intergenic
1057610022 9:96533699-96533721 TTTATTCATCAAATATTTATTGG - Intronic
1057779182 9:98035877-98035899 CTCATTCAGAAAATATTTATTGG + Intergenic
1057919361 9:99084008-99084030 TTTATTCAGCACATATTTGTGGG - Intergenic
1058111246 9:101032603-101032625 TTCATTCAACAAATATTTATTGG - Intronic
1058507106 9:105677235-105677257 ACAATTCAACAAATATTTATTGG + Intergenic
1058762866 9:108152398-108152420 TTAATTCCGCAAATATTCAGTGG + Intergenic
1058795558 9:108495079-108495101 TTTCTTCATCAAAGATTTATAGG + Intergenic
1058811215 9:108641365-108641387 TTCATGCAACAAATATTTATTGG - Intergenic
1059203664 9:112443268-112443290 TTTATTCAACAAATATTTACTGG + Intronic
1059280521 9:113129647-113129669 TTTATTCAGCAAATATTAACTGG - Intergenic
1059536796 9:115088056-115088078 TCAGTTCAACAACTATTTCTTGG - Intronic
1059563077 9:115353914-115353936 TTATTTGAGTAAACATTTATTGG + Intronic
1059594251 9:115699394-115699416 TTAATTCAGCCAAGATTTAATGG + Intergenic
1059825306 9:118021662-118021684 TTTATTCAACAAATATTTATTGG - Intergenic
1059941448 9:119363967-119363989 TTTATTCAACAAATATTTATTGG - Intronic
1060309081 9:122443228-122443250 TTTTTTCAACAAATATTTAGTGG - Intergenic
1060321636 9:122567249-122567271 TTTGTTTAGGAAATATTCATGGG + Intergenic
1060716196 9:125931625-125931647 TTCCTTCCACAAATATTTATTGG + Intronic
1061347403 9:130037884-130037906 GGAGTTCAATAAATATTTATTGG - Intronic
1061392155 9:130323199-130323221 TCTATTCAGCAAATATTTATGGG + Intronic
1061629820 9:131865047-131865069 TTTATTCAGCAAATATGTATTGG - Intronic
1061647503 9:132017116-132017138 GTGGTTCAGTAAATATTTAATGG - Intronic
1061649764 9:132038136-132038158 TTCATTCAGCAAATATTTATGGG + Intronic
1062072160 9:134562058-134562080 TTAGTTTAACAAGTATTTACTGG + Intergenic
1186136641 X:6528559-6528581 TTCATTCAACAAACATTTATTGG - Intergenic
1186245693 X:7614420-7614442 TTCATTCAACAAATATTTACTGG - Intergenic
1186267700 X:7849870-7849892 TTCATTCAACAAACATTTATTGG + Intergenic
1186322673 X:8446734-8446756 TAAGCTCAGCAATTATTTATTGG + Intergenic
1186515486 X:10163719-10163741 TTCATTCAGCAAATATTCCTTGG + Intronic
1186537579 X:10365695-10365717 TTAGTTCAGCAAACATTTATTGG + Intergenic
1186669524 X:11755899-11755921 TTCATTCAGCAAATATTTATTGG - Intergenic
1186875564 X:13813470-13813492 TTATTTCAGCAACGATTCATAGG + Intronic
1186948477 X:14595953-14595975 ATATTTTGGCAAATATTTATTGG - Intronic
1186948783 X:14598764-14598786 TTTGTTCAATAAATATTTCTTGG + Intronic
1187286337 X:17907594-17907616 TTAATTCAACAAGCATTTATTGG - Intergenic
1187405127 X:18996834-18996856 TTCACTCAGCAAATATTTATTGG - Intronic
1187997315 X:24942027-24942049 TTTATTCAGCAAATATGTATTGG + Intronic
1188062156 X:25614505-25614527 TTCATACTGCAAATATTTATCGG + Intergenic
1188123698 X:26341394-26341416 CTGTTTCAGCAAATATTTCTTGG - Intergenic
1188282621 X:28289080-28289102 TTACATCAGCAAAGATTTCTTGG + Intergenic
1188595297 X:31893188-31893210 TTTGTTCAGCATTTATTTAGTGG - Intronic
1188642823 X:32527678-32527700 TTAGTTCTAAAAATATTTTTAGG + Intronic
1188887236 X:35565972-35565994 TTTGTTTATCTAATATTTATAGG - Intergenic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1189268298 X:39733043-39733065 CCAGTTCAGCAAATATTTACTGG - Intergenic
1189307186 X:39995642-39995664 TTCATTCAGTAAATATTTTTGGG - Intergenic
1189516934 X:41722054-41722076 TTCATTCAACAAATACTTATTGG - Intronic
1189739297 X:44101946-44101968 TTTGTTTATCAAATATTTTTTGG + Intergenic
1190407937 X:50106133-50106155 TGCCTCCAGCAAATATTTATTGG + Intergenic
1190746940 X:53329569-53329591 TCAGTTCAACAAACATTTATTGG + Intergenic
1191742484 X:64450547-64450569 TTCTTTCAACAAATATTTATTGG - Intergenic
1191912417 X:66164879-66164901 TTAGTTAAGCTATCATTTATTGG - Intronic
1192024794 X:67438065-67438087 TTAATTCCACAAATATTTATTGG - Intergenic
1192295223 X:69840454-69840476 TTCATTCAACAAATATATATTGG - Intronic
1192301302 X:69905922-69905944 TTCAGTCAGTAAATATTTATTGG - Intronic
1192372374 X:70525269-70525291 TTCTTTCAACAAATATTTATTGG + Intergenic
1192615856 X:72621344-72621366 TTTACTCAGCAAATATTTGTTGG + Intronic
1192699729 X:73455832-73455854 TTAGTTCTGAAAAGATTTAAGGG + Intergenic
1193666418 X:84324352-84324374 TTACATCATGAAATATTTATAGG - Intronic
1193711509 X:84885883-84885905 TTACTTGAGCAAAAATTTATAGG - Intergenic
1193824670 X:86208759-86208781 TTAATTGAGCAAGCATTTATTGG + Intronic
1193868758 X:86770335-86770357 TTAGTTCAGAACATATTTTGAGG + Intronic
1193872523 X:86818332-86818354 TTAGTTCTGATAATATTTGTAGG - Intronic
1194622621 X:96191853-96191875 TTCATTCAACAAATATTTATTGG + Intergenic
1194685830 X:96913465-96913487 TTGCTTCACAAAATATTTATTGG + Intronic
1194975030 X:100385999-100386021 TTAATTCAACAAACATTTATTGG + Intronic
1195155066 X:102114906-102114928 TTATTTCAACAGATATTTATTGG + Intergenic
1195427505 X:104751225-104751247 TTTGTTCAGCAAATATTTATTGG + Intronic
1195472421 X:105245985-105246007 TTCATTCAGCACATATGTATTGG + Intronic
1195513646 X:105746286-105746308 CAAGAACAGCAAATATTTATGGG - Intronic
1195755859 X:108198215-108198237 TCAGTTCAACAAGTATTTACTGG - Intronic
1196039810 X:111190002-111190024 TTCATTCAACAAATATTTATTGG + Intronic
1196135109 X:112200454-112200476 TTCATTCAACAAATATTTATTGG - Intergenic
1196199017 X:112864526-112864548 TTATTTCAGCAAATATTAACTGG - Intergenic
1196321252 X:114342590-114342612 TTTCTTCACCAAATATTAATTGG + Intergenic
1196344381 X:114635828-114635850 TTAATGCAACAAATATTTGTTGG - Intronic
1196436918 X:115683067-115683089 TGATTTCAGCAAGAATTTATGGG + Intergenic
1196776988 X:119347458-119347480 TTCATTCAGCAGATATTTATTGG + Intergenic
1197143514 X:123143620-123143642 TTCATTTAGCAAATCTTTATTGG + Intergenic
1197454607 X:126663184-126663206 TTTATTCAGAAAATATTAATTGG - Intergenic
1197612124 X:128651586-128651608 TAAGCTGAGGAAATATTTATAGG - Intergenic
1197891048 X:131270787-131270809 TTTATTCTACAAATATTTATTGG - Intergenic
1197896597 X:131322078-131322100 TTAGTTGAACAAACATTTATTGG + Intronic
1197969266 X:132097903-132097925 TTGATTCAGTAAATATTTGTTGG + Intronic
1198010238 X:132545092-132545114 TTCATTCAACAAATATTTAGTGG - Intergenic
1198118303 X:133566040-133566062 TTTGATCAACAAATACTTATTGG - Intronic
1198196321 X:134366415-134366437 AAAGCTCAGCAAATATTTATTGG + Intergenic
1198318779 X:135497739-135497761 TTCATTCGCCAAATATTTATTGG - Intergenic
1198385831 X:136128627-136128649 TTTATTCAACACATATTTATTGG - Intergenic
1198651796 X:138871297-138871319 TTCTTCCAACAAATATTTATTGG + Intronic
1198731562 X:139735906-139735928 GTGGTTCAACAAATGTTTATTGG + Intronic
1198732217 X:139744351-139744373 TAATTTCAGCAAACATTTAGAGG + Intronic
1198998068 X:142599075-142599097 TTTGTTCAGCAAATATATACCGG - Intergenic
1199191179 X:144972957-144972979 TTAATTCAACAAATATTTATTGG - Intergenic
1199399552 X:147381268-147381290 TTCGTTCAACAAATATTCATTGG + Intergenic
1200015474 X:153159188-153159210 TTACTTCAACAAATAATTACTGG - Intergenic
1200331929 X:155307045-155307067 TTTGTTCAGTGAATATTCATTGG - Intronic
1200617278 Y:5394849-5394871 TAAGTTCCAGAAATATTTATTGG + Intronic
1201464200 Y:14262278-14262300 TTAATTCAACAAATATTTACTGG - Intergenic