ID: 928117572

View in Genome Browser
Species Human (GRCh38)
Location 2:28557949-28557971
Sequence CCACCCAGGTTTGCTTCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928117572 Original CRISPR CCACCCAGGTTTGCTTCATC TGG Intronic
902603662 1:17556546-17556568 CCACCAAGGCTTGCCCCATCAGG + Intronic
902686328 1:18079983-18080005 CCACCCAGGTCTGCTGGTTCGGG + Intergenic
902791682 1:18773092-18773114 GGACCCAGGTTTGCTTCACATGG + Intergenic
904046666 1:27613204-27613226 CTACCCAGGTTTGCCTCGCCAGG - Exonic
907858963 1:58332344-58332366 TCCCCCAGGTTTCCTTCTTCAGG + Intronic
908218505 1:61979737-61979759 CCACACAGGTTTGTTTCCTTGGG - Intronic
908444275 1:64187066-64187088 CCACCCAGGTTTCCTTCCACTGG - Intergenic
909533281 1:76705458-76705480 CCACTGAGGTTTGCATCATATGG + Intergenic
913684543 1:121219173-121219195 CCAGCCAGGTTGGCTGCTTCAGG - Intronic
914036380 1:144006789-144006811 CCAGCCAGGTTGGCTGCTTCAGG - Intergenic
914153075 1:145061157-145061179 CCAGCCAGGTTGGCTGCTTCAGG + Intronic
915404603 1:155650075-155650097 CCCCCCAAGTTTCCTTCATTGGG + Intergenic
920304442 1:205009584-205009606 CCACCCAGGGCTGGTTCATTGGG + Exonic
920471855 1:206237723-206237745 CCAGCCAGGTTGGCTGCTTCAGG - Intronic
923701495 1:236304075-236304097 CTACCCAGGGCTGCTTCCTCTGG - Intergenic
924627382 1:245706838-245706860 ACACCCAGCTTTGTTTCATTTGG - Intronic
1063732462 10:8713711-8713733 CCAGCCAGGTTTCCCACATCTGG + Intergenic
1067789920 10:49280070-49280092 CCACCCAGGCTTGTTCCATTTGG + Intergenic
1074654438 10:115568867-115568889 CCTTCCAGGTTTCCTTTATCAGG + Intronic
1078937977 11:15968845-15968867 GCACCTCGGTTTGCTTCATTAGG - Exonic
1082254751 11:50021311-50021333 TCTCCCAGGTTTGCTGCAGCAGG - Intergenic
1082796446 11:57381349-57381371 ACACCCTGGTTTGCTTCAGAAGG + Intergenic
1084698156 11:70768679-70768701 CCAGGCAGGTTTCCCTCATCAGG + Intronic
1088746091 11:112806231-112806253 CCACCCATGTTAGCCTCATGGGG + Intergenic
1090034272 11:123234855-123234877 CTACCCACGTTTGCTTCTCCAGG - Intergenic
1090258536 11:125302730-125302752 GCACCCAGTTTTGCCTCTTCTGG + Intronic
1092904146 12:13087002-13087024 CCACACAGGGCTGCATCATCAGG - Intronic
1095383445 12:41621887-41621909 CCACCTACGTTTTATTCATCAGG - Intergenic
1096503688 12:52080353-52080375 CCACCCAGGTGTGCGGGATCAGG + Intergenic
1099871500 12:88355303-88355325 ACACCCAGGTTTCTTTCATTTGG + Intergenic
1102694654 12:114789150-114789172 CCACCCTGGTGTGCATCAACAGG - Intergenic
1106962782 13:35019917-35019939 CCACACCTCTTTGCTTCATCGGG + Intronic
1113630566 13:111880309-111880331 CCACCCAGGTCTGCTCCCACAGG + Intergenic
1115298814 14:31860732-31860754 CAACCCAGATTTTCTTCATTGGG + Exonic
1118464565 14:66019206-66019228 CAACCCAGGTGAGCTTCAACTGG + Intergenic
1120314604 14:82875463-82875485 GCAGCCAGGTTTAATTCATCAGG + Intergenic
1121954720 14:98203541-98203563 CCTGCCAGGTTTCCTTCATTAGG - Intergenic
1122113847 14:99518142-99518164 CCACCCAGGCCTGCATCATGGGG + Intronic
1124611735 15:31214320-31214342 GCACCCAGGCTTGCTTGACCAGG + Intergenic
1132075452 15:98816213-98816235 GCAGCCAGCTTTGCCTCATCAGG + Intronic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1136910318 16:34140348-34140370 CCAGCCTGGGTTGCTTCATCCGG - Intergenic
1138666095 16:58570112-58570134 CCAACCAGGAATCCTTCATCTGG + Intronic
1142045753 16:87924280-87924302 CCATTCACGGTTGCTTCATCAGG - Intronic
1142612411 17:1116518-1116540 CCAGCCAGGTGTGGTTCATCAGG + Intronic
1144947759 17:18978459-18978481 CCACCCAGGACTGCTTCACCTGG - Exonic
1146280842 17:31543297-31543319 CCAGGCAGTTCTGCTTCATCTGG - Intergenic
1148270610 17:46259471-46259493 CCACCCAGGTTTGCTGGGTTGGG + Intergenic
1148773470 17:50079924-50079946 CCACCCAGCTAGGCTTCAACCGG - Intronic
1156216384 18:35002338-35002360 CCACCCAGGTATCTTTCAACAGG - Intronic
1159362445 18:67423000-67423022 CCACCAAGGTGTCCTTCATTGGG - Intergenic
1159453510 18:68632347-68632369 CAACCCAGATTTCCTTCAACTGG + Intergenic
1161600982 19:5182560-5182582 CCACCCAGGTACCCTTCAACAGG - Intronic
1162376737 19:10309542-10309564 CCTCCCAGGTGGGTTTCATCGGG - Exonic
1163155072 19:15435515-15435537 CAACCAATGTTTGCTTTATCCGG - Intronic
1164837563 19:31367098-31367120 CCACCCAGGTTTGCCTCCCAGGG + Intergenic
925812594 2:7715269-7715291 CCACCCACCTTGGCTTTATCTGG - Intergenic
925844252 2:8020972-8020994 CCTCACATGTTTGCCTCATCAGG + Intergenic
926359246 2:12069829-12069851 CAACCCAGGTCTCCTTCACCTGG - Intergenic
928117572 2:28557949-28557971 CCACCCAGGTTTGCTTCATCTGG + Intronic
928661766 2:33509048-33509070 TCACCTAGGTTTGCTTGATATGG + Intronic
929570809 2:43021891-43021913 CCTCCCAGGCTTGCTGCAGCCGG + Intergenic
930059734 2:47277970-47277992 ACACCCAGGTTTGGTTCTTCTGG + Intergenic
930505895 2:52282587-52282609 CCATGCAGTTTTCCTTCATCTGG + Intergenic
935656538 2:105428439-105428461 CCAGCCAGGTTTGATCCACCAGG - Intronic
939562208 2:143745368-143745390 GCACACAGATTTGCTTCACCTGG - Intronic
940552029 2:155171458-155171480 TCCCCCTGGTTGGCTTCATCTGG + Intergenic
943144525 2:184025244-184025266 CTTCTCAGGTTTGCTTCCTCAGG - Intergenic
943513635 2:188857344-188857366 CAACCAAGGTGTTCTTCATCTGG + Intergenic
944501381 2:200363855-200363877 CCTCCCAGTTTTCCTTCCTCTGG - Intronic
948118823 2:235513789-235513811 CCACCCAGCTGTGCTTGATGGGG + Intronic
948480836 2:238249490-238249512 CCACACAGGCATGGTTCATCTGG + Intronic
1170616791 20:17959706-17959728 CTACCCATGTTTGTCTCATCTGG - Intronic
1171771501 20:29326026-29326048 CCAGCCTGGGTTACTTCATCCGG + Intergenic
1171784072 20:29447648-29447670 CCAGCCTGGGTTGCTTCATCCGG - Intergenic
1171813449 20:29763257-29763279 CCAGCCTGGGTTACTTCATCCGG + Intergenic
1173408099 20:42784679-42784701 TCACCCAGCTTTGGTTCAACTGG - Intronic
1174207665 20:48852569-48852591 CAACCCAGATCTGCTCCATCAGG - Intergenic
1174592413 20:51656924-51656946 CTGCCCAGGTTTACCTCATCGGG + Exonic
1178347965 21:31848447-31848469 CCATCCAGTTTTGCCTCATCAGG + Intergenic
1180259292 21:46657404-46657426 CAACCCAAGTGTCCTTCATCTGG + Intronic
1180339203 22:11605180-11605202 CCAGCCTGGGTTACTTCATCCGG - Intergenic
1180980383 22:19875599-19875621 CCACCCAGGTCGTCATCATCTGG + Exonic
1180981183 22:19878742-19878764 CCACCCAGGTTTGCTGTGCCTGG - Intronic
1181987284 22:26808957-26808979 CCACCCAGTTTAGCTCCATGGGG - Intergenic
1182085617 22:27559230-27559252 CCACCCAGGTGCCCTTCAACAGG + Intergenic
1183368059 22:37417591-37417613 CCACCCAGCTTTCCTTCCACAGG - Intronic
1184526300 22:45025471-45025493 ACACCCAGGTTTGCTGCTTCTGG - Intergenic
951036491 3:17938605-17938627 CCTCAGAGGTCTGCTTCATCTGG - Intronic
951207285 3:19938110-19938132 CCACCTAGGTTCCCTTCACCTGG + Intronic
960309562 3:116104468-116104490 TCACCCAGGCTTTGTTCATCGGG + Intronic
961134759 3:124499913-124499935 ACATCCAGGTTGCCTTCATCTGG + Intronic
962594413 3:136925737-136925759 CCACCCAGATGTCCTTCAACAGG - Intronic
964444217 3:156741926-156741948 CCTTCAAGGTTTGCTTCACCAGG - Intergenic
968886548 4:3337461-3337483 CCACCCAGATGTCCATCATCAGG + Intronic
968961904 4:3749900-3749922 CCACCCAGATGTCCGTCATCAGG - Intergenic
969834385 4:9828185-9828207 CCACCCACATCTGCTCCATCAGG + Intronic
971808384 4:31390990-31391012 CCTCCCAGGTTTTCTCCATAGGG + Intergenic
974056603 4:56989544-56989566 CCTCCCATTTTGGCTTCATCAGG - Intronic
986410742 5:7476279-7476301 CCACCCATGTTAGCTTCCTGGGG - Intronic
988588599 5:32529606-32529628 CCACCCAAGTGTTATTCATCTGG - Intergenic
988879217 5:35482269-35482291 ACACCCAGATGTGCTTAATCTGG - Intergenic
988988079 5:36640508-36640530 CCATCCAGGTTTTCTTCAAAGGG + Intronic
990328344 5:54700036-54700058 CAGCCCAGGTTTGCATCAACTGG - Intergenic
990605324 5:57403775-57403797 CCCACCAGGTTTGCTTCTTGGGG + Intergenic
993167293 5:84373619-84373641 ACACCCATTTTTGCTTTATCTGG - Intronic
997291041 5:132735838-132735860 CCACCCACGTCTGCTTCACTGGG + Intronic
1000912588 5:167040291-167040313 ACATCAAGGTTTGCTTCTTCCGG - Intergenic
1002629092 5:180557142-180557164 CCACCCAGATTTCCTTCAGCAGG - Intronic
1003513209 6:6798881-6798903 CCACTCATGTTTTATTCATCTGG - Intergenic
1004301049 6:14457516-14457538 CCACTCAGGTTAGCTTCCACCGG + Intergenic
1005088410 6:22031236-22031258 CAACCAAGTCTTGCTTCATCTGG + Intergenic
1006169204 6:32083377-32083399 CCTCCCAGGTGTGCTTTATGGGG + Intronic
1007619660 6:43204211-43204233 TCACCAAGGTTTGTTTCAGCTGG - Intronic
1008160856 6:48073746-48073768 CCTCCCAGGTGTGCTTCTTCCGG - Intergenic
1018952138 6:168386145-168386167 CCACCCAGGTGTGCCTGCTCAGG + Intergenic
1019300800 7:302534-302556 CCACACTGGTTTGCTTCAACAGG + Intergenic
1020678530 7:11208246-11208268 CAAGCCAGGTTTGCTGCTTCTGG + Intergenic
1029699886 7:102239423-102239445 CCACCCGGGGTTTCTTCAGCTGG - Exonic
1030492891 7:110260796-110260818 CCACCCAAGTCTCCTTCAACAGG + Intergenic
1034165575 7:149022683-149022705 CCACGCGGGGTTCCTTCATCAGG - Intronic
1034846701 7:154452736-154452758 CCTTCCAGGTCTGCGTCATCAGG - Intronic
1038009126 8:23459939-23459961 CCATCCTGGTCTGGTTCATCAGG + Intergenic
1040576831 8:48659645-48659667 ACACCCAGAGATGCTTCATCAGG + Intergenic
1046377160 8:113398782-113398804 CCAGCCATGATTGCTTCAGCTGG + Intronic
1047102190 8:121689047-121689069 CTACCCAGGCTGGCTCCATCTGG + Intergenic
1051438512 9:17057559-17057581 CCTCCCAGGTTTGCTTCTTTGGG + Intergenic
1053419686 9:37969628-37969650 CCACCGAGGTCTGCTTCTACAGG + Intronic
1054775897 9:69123040-69123062 CCACCCAGATCTGCTGAATCAGG + Intronic
1055517417 9:77047275-77047297 CCACACAGGTTTGCCTCCTGGGG + Intergenic
1055809433 9:80134871-80134893 CCACCCACATTAGCTTGATCTGG + Intergenic
1056736405 9:89213708-89213730 CAACCCAGGTGTCCTTCAACAGG + Intergenic
1062417980 9:136463038-136463060 TCAATCAGGTTTGCTTCATTGGG + Exonic
1203444691 Un_GL000219v1:44561-44583 CCAGCCTGGATTACTTCATCCGG - Intergenic
1203365198 Un_KI270442v1:249816-249838 CCAGCCTGGGTTACTTCATCCGG + Intergenic
1186632707 X:11367385-11367407 CCATGCAGTTCTGCTTCATCAGG - Intronic
1189094750 X:38126369-38126391 CCACCCCGATTTGCCTCATATGG + Intronic
1189913107 X:45830696-45830718 CCACCCATTTTTGCCTCCTCTGG - Intergenic
1190032032 X:46983340-46983362 TCTCCCAGGTTTGCCTCTTCTGG + Intronic
1195740336 X:108058849-108058871 ATTCCCAGGTTTCCTTCATCAGG + Intronic
1197878054 X:131132635-131132657 CAACCCAGGTGTTCTTCAACAGG - Intergenic
1198672762 X:139099094-139099116 TCACCTCGGTTTGCTTCCTCTGG + Intronic
1198673917 X:139111346-139111368 TCTCCCAGCTTTGCCTCATCGGG - Intronic
1199738394 X:150707816-150707838 CCACCCAGATGTTCTTCATCAGG + Intronic
1201074212 Y:10175004-10175026 CCAGCCTGGGTTACTTCATCCGG - Intergenic