ID: 928120006

View in Genome Browser
Species Human (GRCh38)
Location 2:28577214-28577236
Sequence ACTGCTGGTGCCAGACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 304}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928120006_928120009 -7 Left 928120006 2:28577214-28577236 CCTGGCTGTCTGGCACCAGCAGT 0: 1
1: 0
2: 1
3: 37
4: 304
Right 928120009 2:28577230-28577252 CAGCAGTGGTTCCCATCTACTGG 0: 1
1: 0
2: 3
3: 21
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928120006 Original CRISPR ACTGCTGGTGCCAGACAGCC AGG (reversed) Intronic
900568999 1:3349191-3349213 AATGCTGCGCCCAGACAGCCTGG - Intronic
900954493 1:5878122-5878144 TCTGCTGGTGCCAGAGAGTGAGG - Intronic
901007279 1:6178230-6178252 ACTGCTTGGGCCAGAGAGGCGGG - Intronic
901310257 1:8263910-8263932 ATTTATGGCGCCAGACAGCCTGG - Intergenic
901666937 1:10831418-10831440 TTTGCTGGGGCCAGACAGCAAGG + Intergenic
901726633 1:11247956-11247978 ACTGCTGGGGCTGTACAGCCTGG + Exonic
901745363 1:11369402-11369424 AACGCTGGAGCCAGACTGCCTGG - Intergenic
902093869 1:13926276-13926298 ACTGGTGGTCTCAGCCAGCCAGG - Intergenic
902445912 1:16464165-16464187 GATGCTGGAGCCAGACTGCCTGG - Intergenic
902825841 1:18973656-18973678 AGTTCTGGAGCCAAACAGCCTGG + Intergenic
902834082 1:19035599-19035621 ACTGCAGGTGTCACACATCCAGG - Intergenic
902893968 1:19466043-19466065 GCTCCTGGGGCCAGACTGCCTGG - Intronic
903864977 1:26391472-26391494 CCTGCTGGTGCCACAAGGCCTGG + Intergenic
905452480 1:38065517-38065539 GGTGCTGGAGCCAGACTGCCTGG + Intergenic
906746828 1:48228108-48228130 GTTACTGGAGCCAGACAGCCAGG + Intronic
908313324 1:62907470-62907492 ACTGCTGGTCCCAAACAGGGAGG - Intergenic
910009374 1:82442008-82442030 CACGCTGGTGCCAGACAGACTGG - Intergenic
911183428 1:94881179-94881201 AGGCCTGGTGACAGACAGCCTGG - Intronic
914780194 1:150778774-150778796 AACTCTGGTGCCAGGCAGCCTGG - Intergenic
916173541 1:162019927-162019949 GCTGCGGGAGGCAGACAGCCAGG - Exonic
918240318 1:182615057-182615079 GCTGATGGTGCCACAGAGCCCGG - Intergenic
918311805 1:183290423-183290445 GATGCTGGTGCCAGTCTGCCTGG + Intronic
919822578 1:201482331-201482353 ACGGCTGGTTCCACACACCCAGG - Intergenic
920076619 1:203341961-203341983 AGTGCTGCTCACAGACAGCCAGG + Exonic
920607153 1:207399725-207399747 ACAGCTATTGACAGACAGCCTGG - Intergenic
920730652 1:208480751-208480773 ACTGGTGGAGCCTGAAAGCCTGG - Intergenic
921340163 1:214126643-214126665 TCTTCTGGAGCCAGACAGCTTGG - Intergenic
924412320 1:243819301-243819323 CCTGCTGGTGCCAGGGAGACTGG + Intronic
1062986212 10:1771656-1771678 CCTGCTGGGCCCAGACAGCCAGG + Intergenic
1067465758 10:46497674-46497696 ACCTCTGGACCCAGACAGCCTGG - Intergenic
1067574706 10:47401913-47401935 CCTGTTGGTCCCAGACAGACAGG + Intergenic
1067621429 10:47886932-47886954 ACCTCTGGACCCAGACAGCCTGG + Intergenic
1068947185 10:62741294-62741316 ACTGGTGGTGGCAGAAAGTCTGG - Intergenic
1069567755 10:69474860-69474882 ACTGCCAGGGCCAGACATCCAGG + Intronic
1070544665 10:77442889-77442911 ACAGCAGGTGTCAGACAGTCAGG - Intronic
1071059051 10:81548425-81548447 CCTGCTGGAGCCAGAGAGGCTGG + Intergenic
1071134586 10:82438386-82438408 CCTGCTGGAGCCAGAAAGGCTGG - Intronic
1072232577 10:93425728-93425750 ACTCCTTGAGCCAAACAGCCTGG + Intronic
1073308000 10:102518306-102518328 ACTACTGGATCCAGACTGCCTGG - Intronic
1076139425 10:128067967-128067989 CCTGCCTGAGCCAGACAGCCTGG - Intronic
1076494371 10:130887266-130887288 ACCTCTGGAGCCAGAGAGCCAGG + Intergenic
1078064342 11:8068184-8068206 ACAACTGAGGCCAGACAGCCTGG - Intronic
1078524834 11:12092349-12092371 ACAGCTGGTGCCTGAATGCCTGG - Intergenic
1079108187 11:17587711-17587733 ACTTCTGGGGTCAGACAGCCAGG - Intronic
1079559632 11:21805743-21805765 ACTGCTGCTGCCCTCCAGCCTGG + Intergenic
1079752121 11:24212768-24212790 GCTGCTGGTGCCAGTGAGACTGG + Intergenic
1080442515 11:32308057-32308079 ACTGCTGGTGCCACACAAAGGGG + Intergenic
1080883905 11:36348037-36348059 ACTGATTGTGCCAGACATACTGG - Intronic
1080895047 11:36441913-36441935 ACTGCTGGAGCCAGAGAAACTGG + Intronic
1082011745 11:47454391-47454413 TCTGCTGGTCCTAGACAGCTGGG + Intergenic
1083516420 11:63263179-63263201 CCTGCTGGTGCCAGGAAGACTGG - Intronic
1083603286 11:63961889-63961911 ACAGCTGTTGCCAGGCATCCAGG - Intergenic
1084345262 11:68542740-68542762 AGTTCTGGTTCCAGACAGGCTGG - Intronic
1084525727 11:69696914-69696936 TCTCCTGGAGCCACACAGCCTGG - Intergenic
1086949302 11:92875390-92875412 ACTGCAGGAGCCAGACTTCCTGG + Intronic
1089572606 11:119420378-119420400 ACTGCTGGTGCCAGTCTTGCAGG - Exonic
1089760355 11:120718276-120718298 TCTGCTGTTTCCAGAAAGCCTGG - Intronic
1091037015 11:132243754-132243776 ACTGGTGGAGCCAGGAAGCCTGG + Intronic
1091165308 11:133470480-133470502 ACAGCTGGTCCCAGACAATCTGG + Intronic
1091198123 11:133749103-133749125 AGTGCTGTTCCCAGCCAGCCTGG - Intergenic
1091644041 12:2260051-2260073 ACTGCTGGACCCAGGCTGCCAGG - Intronic
1092462131 12:8696664-8696686 ACTTCTGGATCCAGACTGCCCGG - Intronic
1092859977 12:12712039-12712061 TCTGCTTGTCCAAGACAGCCTGG + Intergenic
1092949640 12:13489487-13489509 ACTGCAGCTCCCAGTCAGCCAGG + Intergenic
1095196360 12:39323251-39323273 AATGTTGGAGGCAGACAGCCTGG - Intronic
1096112407 12:49037385-49037407 CTTGCAGGTGCCCGACAGCCAGG - Exonic
1096250994 12:50032684-50032706 AGAGCTGGTGCCAGAAAGCTTGG + Intronic
1097144227 12:56929066-56929088 GCTGCTGGAGCCGGACTGCCTGG - Intronic
1098353755 12:69590236-69590258 TCTGCTGGTTCCAGTCAGCCTGG + Intronic
1098366906 12:69713018-69713040 CCTGGTTGTGCCAGTCAGCCTGG - Intergenic
1099589999 12:84575130-84575152 CCTGCTGGTGCCAGGGAGACTGG + Intergenic
1100654395 12:96625316-96625338 ACTGCTGGAGCCAGACTGGCTGG - Intronic
1101062704 12:100988466-100988488 ACTGCTGGAGCAAGAGGGCCTGG - Intronic
1101331827 12:103763200-103763222 CCTGCTGGTGCCTGCCACCCAGG - Intronic
1102029981 12:109734747-109734769 AGTGCTGGAGCCAGACCACCTGG - Intronic
1102406801 12:112680562-112680584 GATGCTGGGGCCAGACTGCCTGG - Intronic
1102427361 12:112854573-112854595 AATTCTGGAGCCAGCCAGCCCGG - Intronic
1102905284 12:116669951-116669973 ACAGCTGGTGCCAGAAAGGCAGG - Intergenic
1103734376 12:123049836-123049858 ACAGCAGGTGCTAGGCAGCCAGG + Intronic
1104017699 12:124971623-124971645 ACAGCAGGTGCCACACAGACAGG + Intronic
1104490120 12:129186583-129186605 AATCCTGGAGCCAGACTGCCTGG + Intronic
1104680550 12:130748262-130748284 AGGGCTGGTGCGAGCCAGCCTGG - Intergenic
1104958525 12:132477334-132477356 ACTGCAGCTGTCACACAGCCTGG + Intergenic
1106185695 13:27407923-27407945 AATGCTGGAGTCAGACTGCCTGG - Intergenic
1106287138 13:28327977-28327999 ACTGCTGGCGAGAGACGGCCAGG - Intronic
1108586585 13:51875298-51875320 AGTTCTGGAGCCAAACAGCCTGG - Intergenic
1109968747 13:69737546-69737568 GCTGCTGGTGCCAGCAAGACTGG + Intronic
1110046640 13:70841189-70841211 ACAGCTGGTGCCAGGCTGCTTGG - Intergenic
1112590622 13:100760875-100760897 GATTCTGGAGCCAGACAGCCTGG - Intergenic
1114064943 14:19053008-19053030 AGGGCTGGTCCCAGACAGCCTGG + Intergenic
1114097318 14:19346994-19347016 AGGGCTGGTCCCAGACAGCCTGG - Intergenic
1114680096 14:24477038-24477060 ACTGCTGGGCCCTGACATCCAGG - Intergenic
1115292384 14:31786922-31786944 AGTGCTGGAGCCAGAGAGGCTGG + Intronic
1115964748 14:38875316-38875338 AATTCTGGAGCCAGACTGCCTGG - Intergenic
1118775694 14:68972714-68972736 AATGCTGGAGCCCGACTGCCTGG + Intronic
1119392094 14:74297841-74297863 ACTGCTGGTGGCAGACACCAAGG - Intronic
1119435745 14:74596761-74596783 ACTGCTCGAGCCAGCCACCCAGG - Intronic
1120719470 14:87874819-87874841 CATTCTGGAGCCAGACAGCCTGG - Intronic
1120848875 14:89150646-89150668 AGAGCTGGTGCCAGGCAGCAAGG + Intronic
1121319604 14:92983649-92983671 CCTGATGGTGCCAGTCTGCCTGG - Intronic
1122372418 14:101235953-101235975 GCTGCTGGAGCCAGCCACCCGGG + Intergenic
1122585512 14:102803366-102803388 AGTGCTGGTGGCAGGCTGCCTGG + Intronic
1122890909 14:104731843-104731865 TCTGCTTGTTCCAGGCAGCCCGG - Intronic
1122983331 14:105201334-105201356 ACTGCAGGTGCCACAGAACCTGG - Intergenic
1123491671 15:20786146-20786168 AGGGCTGGTCCCAGACAGCCTGG - Intergenic
1123548173 15:21355240-21355262 AGGGCTGGTCCCAGACAGCCTGG - Intergenic
1124046545 15:26155843-26155865 CCTGCTGGAACCAGACAGGCTGG - Intergenic
1124129871 15:26974044-26974066 ATTGCTAGTGCCAGACCACCAGG - Intronic
1124552029 15:30690378-30690400 AGTGCTGGTTCTGGACAGCCAGG + Intronic
1124679214 15:31715294-31715316 AGTGCTGGTTCTGGACAGCCAGG - Intronic
1124821023 15:33045357-33045379 ACTGCAGGTCCCACTCAGCCTGG - Intronic
1124962304 15:34408089-34408111 ACTGCAGGTGACAGGCAGACCGG - Intronic
1124978928 15:34554311-34554333 ACTGCAGGTGACAGGCAGACCGG - Intronic
1125469613 15:39990124-39990146 ATTGCAGAGGCCAGACAGCCTGG + Intronic
1126219609 15:46197475-46197497 GCTGCTGGTGCCAGTGAGACTGG - Intergenic
1126709796 15:51443353-51443375 GCTGCTGGTGCCAGCCAGCCAGG + Intergenic
1130229749 15:82087566-82087588 ACTGCTGGTACCTGTCAGCTTGG + Intergenic
1131382318 15:91974192-91974214 ACAGCAGGTTCCAGAAAGCCAGG + Intronic
1131487773 15:92836417-92836439 GATTCTGGAGCCAGACAGCCTGG - Intergenic
1132178824 15:99736055-99736077 ACAGCTGGTGGCTGAGAGCCAGG - Intergenic
1132323101 15:100941833-100941855 CCAGCTTGTGCCAGGCAGCCTGG - Intronic
1202956505 15_KI270727v1_random:82470-82492 AGGGCTGGTCCCAGACAGCCTGG - Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133660242 16:7909503-7909525 ACTGTTGGATCCACACAGCCTGG - Intergenic
1134108416 16:11499719-11499741 ACAGCTGGTGCCAGGCAGCTGGG - Intronic
1134272964 16:12750246-12750268 GCTTCTTGTGCCAAACAGCCAGG - Intronic
1135271168 16:21071084-21071106 TCTGCTGGTGCCCTCCAGCCTGG - Intronic
1137001225 16:35232789-35232811 ACTGCTGGTGCCACAGCTCCAGG + Intergenic
1138396780 16:56710466-56710488 ACTGCTGGTACCAGAATGTCTGG - Intronic
1139528851 16:67531831-67531853 AGTCCTGGGGTCAGACAGCCTGG + Intronic
1140819381 16:78648798-78648820 ACTGATGGTGGCTGACTGCCTGG + Intronic
1141405157 16:83786028-83786050 ACCGATGGTGCCAGAAAACCTGG + Intronic
1142363068 16:89636370-89636392 ACTGCTGGTGACATACAGGAAGG - Exonic
1143562047 17:7702207-7702229 CCTGCTTGTGACAGACAGCATGG + Intronic
1144150508 17:12439007-12439029 CCTGCTGTGGCCAGACACCCTGG + Intergenic
1144660481 17:17064928-17064950 ACTGCTGGTGTGAGACAGTTTGG - Intronic
1146165468 17:30584957-30584979 ACTGCTGGTGCAAGGGAGCAGGG + Intergenic
1146476198 17:33164536-33164558 ACAGCTGTTTCCAGAGAGCCTGG - Intronic
1147672337 17:42183950-42183972 AAGGCTGGTGCCCGACAGCCGGG + Intergenic
1147969948 17:44213891-44213913 GCTGGAGGGGCCAGACAGCCAGG - Intronic
1148339926 17:46867363-46867385 ATGGCTGGAGCCAGACTGCCTGG - Intronic
1149581302 17:57752189-57752211 ACTACTGGTGACAGACACCAGGG + Intergenic
1149642893 17:58215933-58215955 GCTGCTGCTGGCAGCCAGCCTGG - Intronic
1151787515 17:76282424-76282446 AGTGCTGCTGCCAGTTAGCCGGG + Intronic
1153002847 18:472226-472248 TATGCTGGAGCCAGACTGCCTGG - Intronic
1153220638 18:2857840-2857862 CCTGCTGGTGCCAGGAAGCAAGG + Intronic
1153233357 18:2961907-2961929 GCTGCTTATGGCAGACAGCCTGG - Intronic
1155072162 18:22325959-22325981 AATTCTGGAGCCAGACTGCCTGG + Intergenic
1156375120 18:36507445-36507467 ACTGCTGGTCCCAGACATTTTGG + Intronic
1156482587 18:37445511-37445533 AGTGCTGCCGCCAGACAGCCTGG + Intronic
1157211195 18:45743468-45743490 GACTCTGGTGCCAGACAGCCTGG + Intronic
1159954937 18:74512589-74512611 AATGCTGATGACAGACAGCCTGG - Intronic
1160277184 18:77447988-77448010 AGTGCTGATGCCACAGAGCCAGG + Intergenic
1160894751 19:1397182-1397204 GCTGCTGGTGACACACAGCTGGG + Intronic
1162476121 19:10900386-10900408 ACTGCTGGTGGCTGAGAGCTGGG - Intronic
1162832757 19:13297319-13297341 GCCTCTGGTGCCAGAGAGCCTGG + Intronic
1163235074 19:16025211-16025233 GCTGCTGGAGCTGGACAGCCTGG - Intergenic
1163360715 19:16844414-16844436 ACTGGTGGTGCCAATGAGCCTGG + Intronic
1163474326 19:17516190-17516212 ACTGCCGATCCCAGAAAGCCAGG + Exonic
1164283429 19:23789295-23789317 GCTGCTGGTGGCAGGCAGACTGG - Intronic
1166068491 19:40374223-40374245 AATTCTGGAACCAGACAGCCTGG + Intronic
1167443040 19:49520811-49520833 ACTGCTGATGGCCGTCAGCCCGG + Intronic
1167632275 19:50632506-50632528 GCTGCTGGAGCCAGGCAGCCTGG - Exonic
925083688 2:1091157-1091179 ACTGCTCTTGCCAGTCAGCTGGG - Intronic
925262701 2:2542352-2542374 ACTGCTGGAGACAGACATGCAGG - Intergenic
925921070 2:8638300-8638322 TGTGCTCGTGCAAGACAGCCCGG - Intergenic
925958443 2:8992922-8992944 TCTGCTGCTGCCAAAAAGCCAGG + Intronic
925964330 2:9049874-9049896 ACTCCAGCTGCCAGGCAGCCTGG + Intergenic
926905171 2:17798872-17798894 ACTGCTGGTGACAACCAGCTTGG - Intronic
928070260 2:28208184-28208206 AATGCAGGTGCAGGACAGCCTGG + Intronic
928120006 2:28577214-28577236 ACTGCTGGTGCCAGACAGCCAGG - Intronic
928838302 2:35575004-35575026 ACTGTTGGTGCCTGCCAACCAGG - Intergenic
929825818 2:45308958-45308980 GATGCTGGTGCCAGACTGCCTGG + Intergenic
931054503 2:58453973-58453995 ACTGCAGGTGCCTGCCACCCCGG + Intergenic
931457927 2:62426667-62426689 ACTGCTGGAGGCACAGAGCCTGG + Intergenic
932048912 2:68379936-68379958 ACTGATTGTGCCATACAACCTGG - Intronic
932260208 2:70320715-70320737 GCCTCTGGAGCCAGACAGCCTGG - Intergenic
932370604 2:71184393-71184415 ACTGCTGTTCCCAGTCAGTCTGG - Exonic
932446588 2:71785571-71785593 ACAGCTGGTGGCAGAGGGCCGGG + Intergenic
934118842 2:88821383-88821405 ACTGCTGGTTCCAGAAAGCTAGG - Intergenic
934123965 2:88867940-88867962 TCTGCTGGTTACAGACAGCTTGG + Intergenic
934614406 2:95762384-95762406 GGTGCTGGTGCCAGGCAGCGGGG + Intergenic
934878538 2:97951336-97951358 GCTTCTGGTGCCACACAGCGGGG + Intronic
935225079 2:101046246-101046268 TGTGCTGGCGCCTGACAGCCAGG - Intronic
935855984 2:107274595-107274617 GCTGCTGGTGCCTGCCAGCCTGG + Intergenic
938339845 2:130528087-130528109 AAAGCTGGAGCCAGAAAGCCTGG + Intronic
938349991 2:130592663-130592685 AAAGCTGGAGCCAGAAAGCCTGG - Intronic
938482207 2:131672011-131672033 AGGGCTGGTCCCAGACAGCCTGG + Intergenic
940655893 2:156487441-156487463 ACTGCTGATGCCAGAAAGGCAGG + Intronic
940788511 2:158007087-158007109 AGTGCTGCTGCCAGAGAGGCTGG - Intronic
944389538 2:199203303-199203325 AATGGTGGTGCCAGGCAGTCTGG - Intergenic
946095194 2:217268779-217268801 ACTGATGGTGTCAGTCTGCCAGG + Intergenic
946397072 2:219448526-219448548 ACTGCGGGCGCCAGGCAGCGTGG + Exonic
947634341 2:231672624-231672646 GCTGCGGGTGGCAGACAGCTGGG + Intergenic
948325193 2:237112763-237112785 ACAGCTTGTGCCAGAAAGCAAGG + Intergenic
948404305 2:237705841-237705863 CCTGCTGGCGTCAGTCAGCCAGG + Intronic
948418747 2:237838967-237838989 ATTGCTGCTCCCTGACAGCCTGG - Intronic
948830779 2:240597333-240597355 GCTGCTGTGGCCAGCCAGCCTGG - Intronic
948853548 2:240719787-240719809 CCTGCTGGTCCCTGACATCCAGG - Exonic
1168978560 20:1986267-1986289 AGCTCTGGAGCCAGACAGCCTGG - Intronic
1169980591 20:11379820-11379842 CCTGCTGGAGCCAGAGAGGCTGG + Intergenic
1170573989 20:17648937-17648959 ACGGCTGTGGTCAGACAGCCTGG - Intronic
1171024311 20:21614782-21614804 CCTGCTGGTGCCACAGAGCAGGG + Intergenic
1171958344 20:31476115-31476137 ACTCCTGATGACAGACAGGCAGG - Intronic
1171978201 20:31608638-31608660 GCTGCGGGCCCCAGACAGCCAGG - Intergenic
1172779201 20:37425801-37425823 GATTCTGGAGCCAGACAGCCTGG - Intergenic
1173579422 20:44136689-44136711 ACTACTGGAGTCAGACAACCTGG + Intronic
1174214618 20:48906647-48906669 GCTGCTGGAGCCTGACACCCTGG + Intergenic
1174288276 20:49487690-49487712 ACTGCTGGTGAGATGCAGCCTGG - Intergenic
1174681769 20:52415541-52415563 ACTGCTGTTGAGAGTCAGCCAGG - Intergenic
1175458274 20:59131495-59131517 ACTTCTGGAGCCAGACACACTGG - Intergenic
1175481627 20:59315261-59315283 ACTGCTGGTGCCTGGCAGCTGGG + Intronic
1176446953 21:6829696-6829718 AGGGCTGGTCCCAGACAGCCTGG + Intergenic
1176825124 21:13694722-13694744 AGGGCTGGTCCCAGACAGCCTGG + Intergenic
1177435433 21:21045937-21045959 ACTTCTGGAGCCACACTGCCTGG + Intronic
1178074749 21:29004630-29004652 TCTGCTGCCACCAGACAGCCAGG - Exonic
1179975759 21:44865029-44865051 TCTGCTGCAGCCCGACAGCCTGG + Intronic
1180483432 22:15775628-15775650 AGGGCTGGTCCCAGACAGCCTGG + Intergenic
1181477690 22:23179054-23179076 ACTGCTGAGGTCACACAGCCAGG + Intergenic
1181865644 22:25852683-25852705 ACTCCTGAGGCCACACAGCCAGG + Intronic
1182482116 22:30615766-30615788 CCTCGTGGTGCCAGACAGTCTGG - Exonic
1183045137 22:35213309-35213331 GCTCCTGGTCACAGACAGCCTGG - Intergenic
1183352853 22:37343635-37343657 CCTGCTGGTGGCTGGCAGCCTGG - Intergenic
1183609522 22:38889790-38889812 GGTGCTGGAACCAGACAGCCTGG - Intergenic
1184692624 22:46124097-46124119 ACTGCTGGAGCCAGAGGGACTGG + Intergenic
949227000 3:1706113-1706135 GCTGCTGTGGCCAGACTGCCAGG + Intergenic
949783867 3:7719183-7719205 CCTGCTTGTCCTAGACAGCCTGG + Intronic
950526678 3:13528533-13528555 GCTTCTGCTGGCAGACAGCCCGG + Intergenic
952215757 3:31276857-31276879 CATGCTGGAGCCAGACTGCCTGG + Intergenic
953545809 3:43863004-43863026 AATGTTGGCGCCAGACAGTCTGG + Intergenic
953663433 3:44907597-44907619 TCTGCAGGGGCCAGAAAGCCAGG - Intronic
954364820 3:50140147-50140169 ACTGCTGGAGACTGCCAGCCTGG - Intergenic
955500028 3:59574369-59574391 AATTCTGGAGCCAGGCAGCCTGG + Intergenic
957434139 3:80152109-80152131 CCTGCTGGAGCCAGGGAGCCTGG - Intergenic
957638183 3:82814770-82814792 CCTGCTGGGGCCAATCAGCCTGG + Intergenic
958641126 3:96806531-96806553 GCTTCTGGAGCCAGACTGCCTGG + Intergenic
958762858 3:98329137-98329159 ACTGCTCCTTCCAGGCAGCCAGG - Intergenic
960660087 3:120048425-120048447 AACTCTGGAGCCAGACAGCCTGG + Intronic
962986693 3:140542883-140542905 CCTGGTGGTGCCAGGCAACCAGG - Intronic
963227477 3:142876970-142876992 ATTTCTGGAGCCAGACAGCCTGG - Intronic
964440547 3:156704267-156704289 GCCTCTGGTGCCAGACGGCCTGG - Intronic
967918461 3:194596915-194596937 TCTGCTGGTGCCAGAAAGTTTGG + Intronic
968565486 4:1310431-1310453 CTTGCTGGTGCCACGCAGCCTGG - Intronic
968669675 4:1842389-1842411 CCTGCTGGTGCCGGACAGAGTGG - Intronic
969654586 4:8489129-8489151 ACTGCAGGAGCCAGGCAGTCAGG - Intronic
971924357 4:32987706-32987728 AGTTCTGGAGCCAAACAGCCTGG + Intergenic
973333124 4:48930101-48930123 AGTGTTGGAGCCAGACAGCCTGG + Intergenic
976229272 4:82823913-82823935 AATTCTGGAGCCAGACAGTCTGG + Intronic
976247313 4:83016674-83016696 GCACCTGGAGCCAGACAGCCTGG + Intergenic
977509023 4:97938224-97938246 CCTGCTGGTGCCAGGGAGACTGG - Intronic
980185481 4:129455940-129455962 AATCATGGTACCAGACAGCCAGG - Intergenic
981099757 4:140817037-140817059 CCTGCTGGTGATAAACAGCCTGG + Intergenic
981273821 4:142874896-142874918 CCTGCTGGTGCCAGGGAGACTGG + Intergenic
983758079 4:171367339-171367361 ACTGCAGCTCCCAGTCAGCCAGG + Intergenic
983774927 4:171594877-171594899 CCTGCTGCTGCCAGGGAGCCTGG - Intergenic
984948451 4:184988565-184988587 AGTGCTGGTGACAGGGAGCCCGG + Intergenic
984953607 4:185024320-185024342 GCTTCTGGAGTCAGACAGCCTGG + Intergenic
985043309 4:185914918-185914940 CCTGCTGGTGGGAGAAAGCCTGG + Intronic
985834425 5:2260305-2260327 ACTGCTTGTGACAGGCAGGCCGG - Intergenic
987293543 5:16530304-16530326 ACCCCTGGTGCCAGCCTGCCTGG + Intronic
993126936 5:83846859-83846881 ACTCCTGGAGCCAGACAGGCTGG - Intergenic
993421031 5:87701034-87701056 CCTGCTGGTGCCAGAGAGACTGG - Intergenic
994344523 5:98668901-98668923 CCTGCTGGAGCCAGGAAGCCTGG + Intergenic
995585158 5:113641271-113641293 ACTGCAAAGGCCAGACAGCCTGG - Intergenic
996346496 5:122493575-122493597 GCAGCTGGTACCAGACACCCAGG + Intergenic
997692593 5:135836863-135836885 GATTCTGGTGCCAGGCAGCCTGG - Intronic
998138708 5:139688136-139688158 ACTGCTGAAGACAGTCAGCCAGG + Intergenic
998157389 5:139794849-139794871 TCTGCAGGTGCCTCACAGCCAGG + Intergenic
999347393 5:150836413-150836435 AAGCATGGTGCCAGACAGCCAGG - Intergenic
999596887 5:153214841-153214863 CCTGCTGGAGCCAGAGAGGCTGG + Intergenic
1000062279 5:157668292-157668314 ACTGCCCCTGCCTGACAGCCTGG - Intronic
1001080515 5:168663987-168664009 AGTTCTGGAGTCAGACAGCCTGG + Intronic
1001199766 5:169705444-169705466 ACCCCTGGGGCCAGACAGCCAGG + Intronic
1002377094 5:178796590-178796612 ACAGCTGGTCACAGAGAGCCGGG + Intergenic
1004365148 6:15006507-15006529 AATTCTGGTGGTAGACAGCCAGG - Intergenic
1006360590 6:33584949-33584971 ACTGCTGGAGTCAGACTGCCTGG + Intergenic
1007337397 6:41163338-41163360 CCTGCTGGTGCCAGCCAGGGTGG + Intergenic
1008884279 6:56414922-56414944 AATGCTGGTGATGGACAGCCTGG + Intergenic
1010261568 6:73823233-73823255 ACTGCTGGTGGTAGACAGATTGG + Intronic
1010452254 6:76015933-76015955 AGTTCTGGTGCCAGGCTGCCTGG + Intronic
1010508753 6:76691527-76691549 ACTGCTGGTGGCTGACAGTTAGG + Intergenic
1015358183 6:132305172-132305194 CCTGCTGGAGCCAGAGAGGCTGG + Intronic
1015549086 6:134393415-134393437 GCTGCTGGGCCCAGGCAGCCAGG - Intergenic
1016164219 6:140920005-140920027 ACTGCTGCTGCCCGGCATCCTGG + Intergenic
1017160415 6:151360413-151360435 TCTGCTGGTCACAGACAACCTGG + Intergenic
1017893013 6:158654769-158654791 ACTTTTGGAGCCAGACAGTCTGG - Intronic
1018096498 6:160391577-160391599 AGTTCTGGAGCCAGACAGCCTGG - Intronic
1019113538 6:169738140-169738162 CCTGCTGGAGCCAGGCAGGCTGG - Intergenic
1019445934 7:1071364-1071386 AGTGCTAGTGCCACAGAGCCCGG - Intronic
1019675242 7:2307671-2307693 AATGCTGGAGACCGACAGCCAGG + Intronic
1021812351 7:24415246-24415268 GGTGCTGGAGCCAGACTGCCAGG - Intergenic
1023343386 7:39246494-39246516 ACACCTGATGCCAGACAGCTTGG - Intronic
1024619348 7:51144360-51144382 AGTGGTGGAGCCAGACAGGCTGG + Intronic
1025009251 7:55382693-55382715 CCAGCTGGTGCCATCCAGCCTGG - Intronic
1026466842 7:70661771-70661793 CCTGCTCGTGCAACACAGCCTGG - Intronic
1027192163 7:76003003-76003025 GCTGTTGGTGCCAGACAGGCAGG + Intronic
1028921699 7:96316902-96316924 GCTGCTGGAGCCAGACTGGCAGG + Intronic
1030779612 7:113583874-113583896 ACTCCTGCTGCAAGACAGCCAGG + Intergenic
1032490627 7:132321634-132321656 CCTGCAGGAGGCAGACAGCCAGG + Intronic
1032737146 7:134702889-134702911 CGTGCTGGAGCCAGACTGCCTGG + Intergenic
1037470369 8:19202598-19202620 TCTGCTTTTGGCAGACAGCCTGG - Intergenic
1039557144 8:38484726-38484748 ACAGCTGAAGCCAGCCAGCCAGG + Intergenic
1039618660 8:38976619-38976641 ACTGCTGGTTCCTGACAACATGG - Exonic
1039988421 8:42467512-42467534 GCTGCTGCTGCCAGGCAACCAGG - Intronic
1041474527 8:58248995-58249017 ACCGCTGGTGCCAGCAAGACTGG + Intergenic
1044081324 8:87888605-87888627 ACTGCAGGTGCCAGCCACCACGG - Intergenic
1044276681 8:90308699-90308721 ACTGTTGGTGACAGACAACAAGG - Intergenic
1046825523 8:118687209-118687231 TCTGCTGGTGCCACACTGTCTGG + Intergenic
1047964258 8:130034028-130034050 GCTGTTGGTGCCTGACGGCCAGG + Intergenic
1048000557 8:130376260-130376282 CCTGCTGGGTCCACACAGCCAGG + Intronic
1049418792 8:142507674-142507696 GCTGCTGGCCCCAGCCAGCCCGG + Intronic
1050063625 9:1736063-1736085 AATGATGGCTCCAGACAGCCAGG - Intergenic
1050618314 9:7426402-7426424 CCTGCTGGAGCCAGAGAGGCTGG - Intergenic
1051991346 9:23155940-23155962 CCTGTTGGTGCATGACAGCCAGG - Intergenic
1052206264 9:25844882-25844904 ACTGCTGGTTCTCCACAGCCTGG - Intergenic
1052206291 9:25845080-25845102 ACTGCTGGTTCTCCACAGCCTGG - Intergenic
1057122813 9:92592322-92592344 ACTGCTGGCTCCTGACAGCAGGG + Intronic
1057301909 9:93891456-93891478 AGGGCAGGTACCAGACAGCCAGG - Intergenic
1059004231 9:110383940-110383962 CCTGCTGGTGCCAGGGAGACTGG - Intronic
1059417353 9:114170167-114170189 CCTGCAGGTGCCAGGCAGGCAGG - Intronic
1060751856 9:126174734-126174756 GCTGCTGGAGCCACTCAGCCTGG + Intergenic
1061051873 9:128201535-128201557 CCTCCTGGTGCCAGTCATCCAGG + Intronic
1061211841 9:129198235-129198257 ACGGGTGGTGTCAGCCAGCCCGG - Intergenic
1061598273 9:131646910-131646932 GATGCTGCTGCCGGACAGCCTGG - Intronic
1062254640 9:135615169-135615191 CCTGCTGGGGCTACACAGCCGGG + Intergenic
1062374021 9:136253964-136253986 ACTGGAGGTGCCAGCCTGCCTGG + Intergenic
1203522237 Un_GL000213v1:54835-54857 AGGGCTGGTCCCAGACAGCCTGG - Intergenic
1186449145 X:9657487-9657509 ACTGATGGCCTCAGACAGCCGGG + Intronic
1188042792 X:25389371-25389393 ACTCCTCGTTCCAGACTGCCAGG + Intergenic
1188744860 X:33829614-33829636 ACTGCTGGTGCCAGCGAGACTGG - Intergenic
1188898041 X:35694437-35694459 ACTGCTTTTGCCAGAAAGCTTGG - Intergenic
1189423763 X:40880388-40880410 ACTCCTGGTGCCAGCATGCCTGG - Intergenic
1191034370 X:56008746-56008768 CCTGCTGGTGCCAGGGAGACTGG + Intergenic
1191225202 X:58035186-58035208 CCTGCTTGTGCCAGACAGACTGG - Intergenic
1192822024 X:74656209-74656231 GCTGCTGGTTCTAGAGAGCCAGG - Intergenic
1192930264 X:75799323-75799345 CCTGCTGGAGCCAGAGAGGCTGG - Intergenic
1193687161 X:84591757-84591779 CCTGCTGGTGCCAAAGAGACTGG + Intergenic
1194851948 X:98881110-98881132 ACTGCTGGAGCCAGGGAGGCTGG + Intergenic
1195109247 X:101629171-101629193 ACTGCTTGGTCCAGGCAGCCAGG + Intergenic
1197089868 X:122523644-122523666 CCTGCTTCTGCCAGACAGCTTGG + Intergenic
1197413839 X:126150748-126150770 GCTGCTGGTGCCAGTGAGACTGG - Intergenic
1198816261 X:140594282-140594304 AGTTCTTGAGCCAGACAGCCTGG - Intergenic
1199359263 X:146898623-146898645 ACCTCTTGTGCCAAACAGCCAGG + Intergenic