ID: 928124408

View in Genome Browser
Species Human (GRCh38)
Location 2:28605812-28605834
Sequence GAACCAATAGGATCTTGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928124400_928124408 4 Left 928124400 2:28605785-28605807 CCAAGTCCGCTGGTGGTGGCTCC 0: 1
1: 0
2: 0
3: 9
4: 88
Right 928124408 2:28605812-28605834 GAACCAATAGGATCTTGAGGGGG 0: 1
1: 0
2: 0
3: 8
4: 125
928124396_928124408 11 Left 928124396 2:28605778-28605800 CCCAGGGCCAAGTCCGCTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 112
Right 928124408 2:28605812-28605834 GAACCAATAGGATCTTGAGGGGG 0: 1
1: 0
2: 0
3: 8
4: 125
928124401_928124408 -2 Left 928124401 2:28605791-28605813 CCGCTGGTGGTGGCTCCCTCTGA 0: 1
1: 0
2: 2
3: 19
4: 187
Right 928124408 2:28605812-28605834 GAACCAATAGGATCTTGAGGGGG 0: 1
1: 0
2: 0
3: 8
4: 125
928124398_928124408 10 Left 928124398 2:28605779-28605801 CCAGGGCCAAGTCCGCTGGTGGT 0: 1
1: 0
2: 1
3: 4
4: 79
Right 928124408 2:28605812-28605834 GAACCAATAGGATCTTGAGGGGG 0: 1
1: 0
2: 0
3: 8
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928124408 Original CRISPR GAACCAATAGGATCTTGAGG GGG Intronic
903690958 1:25173282-25173304 GAACCAATAGGATGGATAGGTGG + Intergenic
905564823 1:38955760-38955782 GAACCTAAATGACCTTGAGGTGG - Intergenic
909810763 1:79929762-79929784 GAAGTAATTGGATCCTGAGGTGG + Intergenic
912342687 1:108932975-108932997 GAGGCAAGAGGATCGTGAGGTGG - Exonic
912488476 1:110047777-110047799 CAGCCAACAGGATCTTCAGGAGG - Exonic
912584437 1:110749689-110749711 GCAGCAATAGGAACTTGGGGTGG - Intergenic
913063619 1:115229948-115229970 GAACCAATAGGATGGAGAGAGGG - Intergenic
915210465 1:154304985-154305007 GAACCAATAGGATATACTGGAGG + Intergenic
917683928 1:177396621-177396643 GAAGGAATTGGATGTTGAGGGGG + Intergenic
919471345 1:197982796-197982818 GAAACAATAGGGTGTTGAGAAGG + Intergenic
920760944 1:208783231-208783253 GAACCAACAGGATTTGCAGGTGG - Intergenic
1063827352 10:9912283-9912305 GAACCAATAAGCTATTGAAGTGG - Intergenic
1071382512 10:85082227-85082249 GAGCCAAGAGGAGCCTGAGGAGG + Intergenic
1077746989 11:4917580-4917602 GAGCCTATATGATCTTCAGGTGG - Intronic
1088947779 11:114532336-114532358 GAACCAAAAGGTTCTTTTGGGGG - Intronic
1090348125 11:126087327-126087349 AAACCAATAGAAGATTGAGGGGG - Intergenic
1090474914 11:127011213-127011235 AAAACACTAGGCTCTTGAGGGGG + Intergenic
1091051496 11:132376928-132376950 GGAACAATTGGATCCTGAGGGGG + Intergenic
1093012518 12:14123976-14123998 CAACTTACAGGATCTTGAGGTGG - Intergenic
1095410008 12:41911378-41911400 GAAGCAATAGGATGTGCAGGAGG + Intergenic
1095533813 12:43222799-43222821 GCAACAATTGGATTTTGAGGGGG + Intergenic
1098958591 12:76714329-76714351 GAACCAATAGGATATATATGGGG + Intergenic
1099673223 12:85721739-85721761 TAACCCATAGGATTTTGAGGTGG - Intergenic
1099902137 12:88724206-88724228 GAACAAATAAGACCATGAGGTGG - Intergenic
1100290893 12:93214285-93214307 GAACTAGTATGATTTTGAGGGGG + Intergenic
1102132725 12:110545069-110545091 AAACCAAAATGGTCTTGAGGTGG - Intronic
1103407545 12:120686757-120686779 GACCAAATAGGCTCTGGAGGGGG - Intergenic
1108036236 13:46293160-46293182 GAACCCATAGGATAGAGAGGAGG - Intergenic
1108544788 13:51481987-51482009 GAACCAATAGGATGTATATGTGG - Intergenic
1112231372 13:97591968-97591990 TAAATAATTGGATCTTGAGGTGG - Intergenic
1112693851 13:101926011-101926033 AAATCACTAGGATCTTGAAGAGG - Intronic
1113356966 13:109590102-109590124 GAAGAAATAGGTTCTTCAGGTGG + Intergenic
1114148987 14:20013300-20013322 AAATCAATAGGATCTTGAAATGG + Intergenic
1114756998 14:25270420-25270442 GACTCAGTAGGATCTTGAGATGG - Intergenic
1118292297 14:64538400-64538422 CAAGCAATAGGCTCTTCAGGTGG - Intronic
1120227799 14:81810307-81810329 GTGCCAATTGGATCATGAGGTGG - Intergenic
1124116740 15:26850562-26850584 GAACCAACAGTATGTTGAGTTGG - Intronic
1126688175 15:51266388-51266410 GAAGCAATCGCATCTTTAGGGGG - Intronic
1129646227 15:77436289-77436311 GAATCAATAGAATCTTGCAGTGG - Intronic
1131473452 15:92715991-92716013 GAAGTAATAGGATCCTGCGGCGG + Intronic
1133682745 16:8135595-8135617 GAACCCATAGGATGTTCTGGTGG - Intergenic
1135403321 16:22181176-22181198 GAACCAATTGGATTTGCAGGTGG + Intronic
1137020916 16:35426340-35426362 GATCCAATGGGATCTTGATTTGG + Intergenic
1142328497 16:89434207-89434229 GAATCCATAGTGTCTTGAGGAGG - Intronic
1143326473 17:6101740-6101762 GAGCCGATAGGATCCTGAAGGGG - Intronic
1148964239 17:51421407-51421429 GAACCAACAGCATCTTGAAAGGG + Intergenic
1149029630 17:52068174-52068196 GAAGTAATTGGATCTTGGGGTGG + Intronic
1150157588 17:62867094-62867116 AAAGCAATAGGAGCTTGAGTAGG - Intergenic
1152984451 18:308965-308987 GAGCAAAGAGGATCTTGAGCAGG + Intergenic
1153157789 18:2168509-2168531 GAACCAGTAGGATATTGTGGAGG - Intergenic
1153485876 18:5597197-5597219 AAACCAAAAGGCACTTGAGGAGG - Intronic
1162615697 19:11798776-11798798 GAACCAACAGGATCCTGCTGTGG + Intronic
1164815654 19:31200314-31200336 CAACCAATATGTTCTTGAGTAGG + Intergenic
1165705607 19:37974208-37974230 GTAACTATATGATCTTGAGGAGG - Intronic
1168099827 19:54135198-54135220 CAACTAAAACGATCTTGAGGTGG - Intergenic
926825830 2:16904173-16904195 GAAATAATTGGATCCTGAGGTGG - Intergenic
928124408 2:28605812-28605834 GAACCAATAGGATCTTGAGGGGG + Intronic
928782970 2:34847882-34847904 GAACCAGTATGATCTTTGGGGGG + Intergenic
928889505 2:36186921-36186943 GAACTAATAGGATTTTGATAAGG + Intergenic
933909650 2:86928611-86928633 GAACCAATAGGATTTAGTGGTGG + Intronic
934023075 2:87974768-87974790 GAACCAGTAGGATTTAGTGGTGG - Intergenic
935564558 2:104592082-104592104 GGAATAATTGGATCTTGAGGTGG - Intergenic
936413468 2:112281549-112281571 GAACCAATAGGATTTACTGGTGG + Intronic
936920540 2:117684306-117684328 GAAGCAACAGGATCATAAGGGGG - Intergenic
938322255 2:130373054-130373076 GAACCAGGAGGACCTGGAGGCGG + Intronic
939283202 2:140091905-140091927 TAACCAATAGTATCTTGCAGTGG - Intergenic
939472148 2:142636661-142636683 GAACCAATAGGATCAACAGGAGG + Intergenic
946693113 2:222324685-222324707 GAGCCAAGAGGAGCCTGAGGAGG + Intergenic
947777802 2:232728226-232728248 GAAACAATAGGAGATTGAGTTGG + Intronic
947991612 2:234492432-234492454 GAACCAATAGAACCTTGAATGGG - Intergenic
948640373 2:239372105-239372127 GAACCCATAGGAACCTGATGGGG + Intronic
1169159095 20:3361157-3361179 GTGCAAAAAGGATCTTGAGGAGG + Intronic
1169833906 20:9856162-9856184 GAACCAATAGGATTTTAACAGGG - Intergenic
1171350282 20:24496919-24496941 GTACCAGGAGGATTTTGAGGGGG - Intronic
1175151944 20:56941782-56941804 TAACCAAAAGGATCTGGGGGTGG + Intergenic
1176960321 21:15152197-15152219 GAACCAAGAGGATGTGGAGAGGG - Intergenic
1181427007 22:22850247-22850269 GAACCCATAGGATCCTGAGCTGG + Intronic
1181672679 22:24433024-24433046 GAAACTATAGGGTCTTCAGGGGG + Intronic
1184603811 22:45560212-45560234 GAAATAATTGGATCCTGAGGTGG - Intronic
951551971 3:23883241-23883263 GAACCAAAAGTATCTTCTGGAGG + Intronic
951862549 3:27269905-27269927 GAAACAATAGGATTTTGCTGTGG - Intronic
955647981 3:61161287-61161309 GAATCACTTGGATCTGGAGGTGG - Intronic
957136899 3:76299784-76299806 GAGTCCATAGGATTTTGAGGTGG + Intronic
958173546 3:89966606-89966628 AAACCATTAAGATCTGGAGGTGG - Intergenic
958472434 3:94537785-94537807 GAAACAATAGCATCTTGAATGGG - Intergenic
964087251 3:152833651-152833673 GAACCATCTGGATCTTGTGGGGG + Intergenic
971101253 4:23468244-23468266 GAAGTAATTGGATCCTGAGGTGG - Intergenic
972024511 4:34360775-34360797 GACCCAACAGGATTTGGAGGAGG + Intergenic
972765396 4:42149281-42149303 GAACCAATCAGCTCTTCAGGTGG + Intronic
975879544 4:78887239-78887261 GAACCAAAAGGATCTTCTGGAGG - Exonic
977213486 4:94248571-94248593 GAAGCAACAGGATTTTGAGCAGG - Intronic
982089880 4:151871319-151871341 GAAGCGATAGGAGCCTGAGGGGG + Intergenic
982225781 4:153165146-153165168 CAAACAATAGCATCTTGGGGCGG - Intronic
982764179 4:159324325-159324347 GCACCAATAGGATTTTAATGTGG + Intronic
983501972 4:168509880-168509902 GAAGCAGTAGGCTCTTGAGCTGG + Intronic
984560916 4:181268936-181268958 GAAGAAATTGGAACTTGAGGTGG - Intergenic
984893338 4:184513274-184513296 GAACCAAGAGGTCCTTGACGGGG + Intergenic
985046497 4:185946173-185946195 GCACCCATAGGATGTTGGGGGGG + Intronic
986180998 5:5392895-5392917 GAACTTACAGGATATTGAGGGGG + Intergenic
986534422 5:8772185-8772207 GGATCAGTAGGATTTTGAGGAGG + Intergenic
988233523 5:28508901-28508923 GGAATAATTGGATCTTGAGGTGG - Intergenic
990790649 5:59474994-59475016 GAACCAATATAATTTTGAGTTGG + Intronic
991014058 5:61912731-61912753 GGAATAATTGGATCTTGAGGTGG - Intergenic
996495398 5:124149224-124149246 GAACCTATAGGTTCTTGAACGGG + Intergenic
998293404 5:140940243-140940265 GAACCCAGAAGATATTGAGGAGG - Intronic
999943198 5:156567265-156567287 GAACCAATAGAGTGTGGAGGGGG + Intronic
1007164645 6:39820816-39820838 GTCCCAATAGGAACTTTAGGAGG - Intronic
1007777524 6:44232135-44232157 GAACAGACAGGATCTTGAGTTGG + Intronic
1009021095 6:57948865-57948887 GAACTTACAGGATATTGAGGGGG + Intergenic
1015046434 6:128781491-128781513 GAACCAATCTGATCTTTTGGAGG - Intergenic
1016120142 6:140334473-140334495 GGAATAATTGGATCTTGAGGTGG - Intergenic
1021905901 7:25332806-25332828 GAACCACGAGGAGCTAGAGGTGG + Intergenic
1027957585 7:84900730-84900752 AAAACAATAAGATTTTGAGGAGG + Intergenic
1028141503 7:87280154-87280176 GAAATAATTGGATCCTGAGGTGG + Intergenic
1030267989 7:107640298-107640320 AAACCAATAGGGTCTTGGTGGGG - Intergenic
1032846926 7:135759031-135759053 GAACCAATAGTACCTAAAGGTGG + Intergenic
1036999875 8:13705377-13705399 AAACCACTAGGAACTGGAGGAGG + Intergenic
1037750832 8:21681164-21681186 GACCCAATAGGATTTGAAGGAGG - Intergenic
1037883886 8:22586197-22586219 GAACCCAGAGGCTCTGGAGGAGG + Intronic
1038590739 8:28835056-28835078 GGAACAATTGGCTCTTGAGGTGG - Intronic
1039110024 8:34031711-34031733 GAACCAACAGGATTTGAAGGAGG + Intergenic
1040895247 8:52361344-52361366 GAATCACTAGAGTCTTGAGGGGG + Intronic
1044150558 8:88771242-88771264 GGAATAATTGGATCTTGAGGTGG + Intergenic
1046586014 8:116149461-116149483 GGAATAATTGGATCTTGAGGTGG - Intergenic
1048654589 8:136522052-136522074 GGAACAATAGGATCCTGAGGTGG - Intergenic
1049759618 8:144326183-144326205 GACCCAAGAGGATCTGGATGCGG + Intronic
1052664338 9:31474953-31474975 GAACCAAGAGGCTGTTGTGGTGG - Intergenic
1055472915 9:76631532-76631554 GATACAATTGCATCTTGAGGAGG - Intronic
1056489544 9:87091800-87091822 GAACCAATAGGATACTGAGATGG + Intergenic
1060775151 9:126367520-126367542 GAACCAAAGGCATCTTCAGGTGG - Intronic
1062173161 9:135146542-135146564 GAACCACCAGGAGCTGGAGGGGG - Intergenic
1195217804 X:102717350-102717372 CAACCAAAATGATCCTGAGGTGG + Exonic
1195862406 X:109395953-109395975 CAACCAGGAGGATCTTGATGAGG - Intronic
1196174665 X:112627696-112627718 GAACCACTTAGATCTTGGGGAGG - Intergenic