ID: 928127842

View in Genome Browser
Species Human (GRCh38)
Location 2:28628511-28628533
Sequence TCTCTCAGAGCGGGCACCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 129}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928127831_928127842 5 Left 928127831 2:28628483-28628505 CCCCAGAGCCCTCCTATGCTCTT 0: 1
1: 0
2: 0
3: 59
4: 486
Right 928127842 2:28628511-28628533 TCTCTCAGAGCGGGCACCAGGGG 0: 1
1: 0
2: 2
3: 14
4: 129
928127834_928127842 -3 Left 928127834 2:28628491-28628513 CCCTCCTATGCTCTTGCCATTCT 0: 1
1: 0
2: 4
3: 25
4: 425
Right 928127842 2:28628511-28628533 TCTCTCAGAGCGGGCACCAGGGG 0: 1
1: 0
2: 2
3: 14
4: 129
928127833_928127842 3 Left 928127833 2:28628485-28628507 CCAGAGCCCTCCTATGCTCTTGC 0: 1
1: 0
2: 1
3: 16
4: 190
Right 928127842 2:28628511-28628533 TCTCTCAGAGCGGGCACCAGGGG 0: 1
1: 0
2: 2
3: 14
4: 129
928127835_928127842 -4 Left 928127835 2:28628492-28628514 CCTCCTATGCTCTTGCCATTCTC 0: 1
1: 1
2: 8
3: 396
4: 10770
Right 928127842 2:28628511-28628533 TCTCTCAGAGCGGGCACCAGGGG 0: 1
1: 0
2: 2
3: 14
4: 129
928127832_928127842 4 Left 928127832 2:28628484-28628506 CCCAGAGCCCTCCTATGCTCTTG 0: 1
1: 0
2: 2
3: 9
4: 137
Right 928127842 2:28628511-28628533 TCTCTCAGAGCGGGCACCAGGGG 0: 1
1: 0
2: 2
3: 14
4: 129
928127830_928127842 10 Left 928127830 2:28628478-28628500 CCAGGCCCCAGAGCCCTCCTATG 0: 1
1: 0
2: 6
3: 42
4: 385
Right 928127842 2:28628511-28628533 TCTCTCAGAGCGGGCACCAGGGG 0: 1
1: 0
2: 2
3: 14
4: 129
928127828_928127842 27 Left 928127828 2:28628461-28628483 CCACTCAGTCATTTAGCCCAGGC 0: 1
1: 0
2: 0
3: 13
4: 108
Right 928127842 2:28628511-28628533 TCTCTCAGAGCGGGCACCAGGGG 0: 1
1: 0
2: 2
3: 14
4: 129
928127826_928127842 28 Left 928127826 2:28628460-28628482 CCCACTCAGTCATTTAGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 163
Right 928127842 2:28628511-28628533 TCTCTCAGAGCGGGCACCAGGGG 0: 1
1: 0
2: 2
3: 14
4: 129
928127836_928127842 -7 Left 928127836 2:28628495-28628517 CCTATGCTCTTGCCATTCTCTCA 0: 1
1: 0
2: 5
3: 74
4: 789
Right 928127842 2:28628511-28628533 TCTCTCAGAGCGGGCACCAGGGG 0: 1
1: 0
2: 2
3: 14
4: 129
928127829_928127842 11 Left 928127829 2:28628477-28628499 CCCAGGCCCCAGAGCCCTCCTAT 0: 1
1: 0
2: 0
3: 47
4: 323
Right 928127842 2:28628511-28628533 TCTCTCAGAGCGGGCACCAGGGG 0: 1
1: 0
2: 2
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928127842 Original CRISPR TCTCTCAGAGCGGGCACCAG GGG Intronic