ID: 928133535

View in Genome Browser
Species Human (GRCh38)
Location 2:28670905-28670927
Sequence CCTTTGTTATCAAAACAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928133535_928133539 18 Left 928133535 2:28670905-28670927 CCAAATTGTTTTGATAACAAAGG No data
Right 928133539 2:28670946-28670968 GAGTGCAAGGCTGAAACTGCAGG No data
928133535_928133538 5 Left 928133535 2:28670905-28670927 CCAAATTGTTTTGATAACAAAGG No data
Right 928133538 2:28670933-28670955 CTGAGTTAGCACTGAGTGCAAGG No data
928133535_928133540 21 Left 928133535 2:28670905-28670927 CCAAATTGTTTTGATAACAAAGG No data
Right 928133540 2:28670949-28670971 TGCAAGGCTGAAACTGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928133535 Original CRISPR CCTTTGTTATCAAAACAATT TGG (reversed) Intergenic
No off target data available for this crispr