ID: 928133538 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:28670933-28670955 |
Sequence | CTGAGTTAGCACTGAGTGCA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
928133535_928133538 | 5 | Left | 928133535 | 2:28670905-28670927 | CCAAATTGTTTTGATAACAAAGG | No data | ||
Right | 928133538 | 2:28670933-28670955 | CTGAGTTAGCACTGAGTGCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
928133538 | Original CRISPR | CTGAGTTAGCACTGAGTGCA AGG | Intergenic | ||
No off target data available for this crispr |