ID: 928133538

View in Genome Browser
Species Human (GRCh38)
Location 2:28670933-28670955
Sequence CTGAGTTAGCACTGAGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928133535_928133538 5 Left 928133535 2:28670905-28670927 CCAAATTGTTTTGATAACAAAGG No data
Right 928133538 2:28670933-28670955 CTGAGTTAGCACTGAGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928133538 Original CRISPR CTGAGTTAGCACTGAGTGCA AGG Intergenic
No off target data available for this crispr