ID: 928136918

View in Genome Browser
Species Human (GRCh38)
Location 2:28694760-28694782
Sequence GATCACTCTGGGCAGCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928136915_928136918 14 Left 928136915 2:28694723-28694745 CCATAGCAGGAAGCTTATCAGAA No data
Right 928136918 2:28694760-28694782 GATCACTCTGGGCAGCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928136918 Original CRISPR GATCACTCTGGGCAGCCCTG TGG Intergenic
No off target data available for this crispr