ID: 928138873

View in Genome Browser
Species Human (GRCh38)
Location 2:28710275-28710297
Sequence GGCCACAAAAATAATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928138873_928138889 23 Left 928138873 2:28710275-28710297 CCATCCCCATTATTTTTGTGGCC No data
Right 928138889 2:28710321-28710343 AGGTCTGAGAAGACTGAGGAGGG No data
928138873_928138888 22 Left 928138873 2:28710275-28710297 CCATCCCCATTATTTTTGTGGCC No data
Right 928138888 2:28710320-28710342 CAGGTCTGAGAAGACTGAGGAGG No data
928138873_928138885 19 Left 928138873 2:28710275-28710297 CCATCCCCATTATTTTTGTGGCC No data
Right 928138885 2:28710317-28710339 CCCCAGGTCTGAGAAGACTGAGG No data
928138873_928138880 3 Left 928138873 2:28710275-28710297 CCATCCCCATTATTTTTGTGGCC No data
Right 928138880 2:28710301-28710323 AAGGCAGTACCTCCTCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928138873 Original CRISPR GGCCACAAAAATAATGGGGA TGG (reversed) Intergenic
No off target data available for this crispr