ID: 928142871

View in Genome Browser
Species Human (GRCh38)
Location 2:28745761-28745783
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928142871_928142872 12 Left 928142871 2:28745761-28745783 CCTCGTTTTGCTAGTAAATCAAT No data
Right 928142872 2:28745796-28745818 TGTTTTTGTTTTCTAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928142871 Original CRISPR ATTGATTTACTAGCAAAACG AGG (reversed) Intergenic
No off target data available for this crispr