ID: 928143095

View in Genome Browser
Species Human (GRCh38)
Location 2:28747874-28747896
Sequence ATCCATTTCAGTGAGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928143091_928143095 2 Left 928143091 2:28747849-28747871 CCTCATCAAACAGTTATTTCCTG No data
Right 928143095 2:28747874-28747896 ATCCATTTCAGTGAGCAGGATGG No data
928143090_928143095 3 Left 928143090 2:28747848-28747870 CCCTCATCAAACAGTTATTTCCT No data
Right 928143095 2:28747874-28747896 ATCCATTTCAGTGAGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928143095 Original CRISPR ATCCATTTCAGTGAGCAGGA TGG Intergenic
No off target data available for this crispr