ID: 928148060

View in Genome Browser
Species Human (GRCh38)
Location 2:28799379-28799401
Sequence AAGGGTGTCAAATGGCTGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 162}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928148060_928148065 3 Left 928148060 2:28799379-28799401 CCATCCAGCCATTTGACACCCTT 0: 1
1: 0
2: 1
3: 23
4: 162
Right 928148065 2:28799405-28799427 GATGTCACACCTTTAACTTAAGG 0: 1
1: 0
2: 1
3: 7
4: 101
928148060_928148067 10 Left 928148060 2:28799379-28799401 CCATCCAGCCATTTGACACCCTT 0: 1
1: 0
2: 1
3: 23
4: 162
Right 928148067 2:28799412-28799434 CACCTTTAACTTAAGGAGACGGG 0: 1
1: 0
2: 1
3: 4
4: 109
928148060_928148066 9 Left 928148060 2:28799379-28799401 CCATCCAGCCATTTGACACCCTT 0: 1
1: 0
2: 1
3: 23
4: 162
Right 928148066 2:28799411-28799433 ACACCTTTAACTTAAGGAGACGG 0: 1
1: 0
2: 1
3: 9
4: 170
928148060_928148069 16 Left 928148060 2:28799379-28799401 CCATCCAGCCATTTGACACCCTT 0: 1
1: 0
2: 1
3: 23
4: 162
Right 928148069 2:28799418-28799440 TAACTTAAGGAGACGGGTAAAGG 0: 1
1: 0
2: 0
3: 2
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928148060 Original CRISPR AAGGGTGTCAAATGGCTGGA TGG (reversed) Exonic
901333250 1:8426567-8426589 GAGGCTTTTAAATGGCTGGATGG - Intronic
901649937 1:10737610-10737632 AAGGGAGTTACATGGCTGTAAGG + Intronic
902243271 1:15102618-15102640 AAGGGGGACAAAAGGCTGGATGG - Intronic
902993091 1:20203396-20203418 CAGGGAGTCAAATGGCTGGTGGG + Intergenic
903407096 1:23106945-23106967 AAAGGTGTCACATGGCTGTAAGG + Intronic
903772361 1:25771931-25771953 CAGGGTGTAAAATGCCTGGCTGG - Intronic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
907713189 1:56903533-56903555 AAAGGTCTCAAAAGGCTGGGTGG - Intronic
908356237 1:63327048-63327070 AAGGGTAAGAACTGGCTGGAAGG - Intergenic
909102044 1:71359892-71359914 AAGGGAGTTCTATGGCTGGAAGG - Intergenic
912510610 1:110187758-110187780 AAGGGTGACTTATGCCTGGAAGG - Intronic
912940587 1:114041359-114041381 GAGGGTGGAAAATGGATGGATGG - Intergenic
913457771 1:119051174-119051196 AAGGGTGTCGAATGGGAGGAGGG - Intronic
913607091 1:120476342-120476364 AAGGGAGGCAATTGGCTGGAGGG + Intergenic
914095792 1:144543434-144543456 AAGGCTTTCAAATGTCTGAACGG + Intergenic
914244990 1:145878883-145878905 ATGGGAGTCACATGGCTAGAGGG - Intronic
914584103 1:149045496-149045518 AAGGGAGGCAATTGGCTGGAGGG - Intronic
917401750 1:174657272-174657294 AATAGTTTCAAATAGCTGGAAGG - Intronic
917577239 1:176336414-176336436 GAGTGTGGCAAATGGATGGAGGG + Intergenic
918200571 1:182262479-182262501 AAGTATGTGAAATGCCTGGATGG + Intergenic
920992410 1:210952241-210952263 AAGGGTGTGAATGAGCTGGAGGG - Intronic
922403842 1:225290889-225290911 TATAGTGTCAAATGGCTAGAAGG - Intronic
923154185 1:231262122-231262144 ATGGGTGTCATGTGGCTGGGAGG - Intronic
923269278 1:232340414-232340436 AAGGGTGTCTCATGGCTTCAGGG - Intergenic
1063033884 10:2266377-2266399 AAGGGTGTGAAGAGGCTGTAGGG + Intergenic
1063069527 10:2647358-2647380 AAGGATGACAGATGGGTGGATGG - Intergenic
1063749756 10:8930066-8930088 AAGGGTGTGGAGTGGGTGGAGGG + Intergenic
1064301031 10:14122927-14122949 AACAGTTTCAAATGGCTAGAAGG - Intronic
1065666034 10:28062235-28062257 AAGGGTCTTAAATGGCTGCCAGG + Intronic
1067208938 10:44242540-44242562 AAGGCTGTCAACTGGCGGAATGG - Intergenic
1069623822 10:69854537-69854559 CAGGGTCTCAAAAGACTGGAGGG - Intronic
1070499791 10:77061754-77061776 AATGGTGTCCAATGGATGAATGG + Intronic
1072299124 10:94041821-94041843 ATTGGTGTCAAATGGTTTGAAGG - Intronic
1073632999 10:105167471-105167493 AAGGCTATTAAATGGATGGATGG - Intronic
1076922748 10:133463841-133463863 TATGGTTTCAAATCGCTGGAAGG - Intergenic
1078246481 11:9576583-9576605 AAGTGTGTGAAGAGGCTGGATGG + Exonic
1079306342 11:19326961-19326983 AAGGGTTCCACATGGATGGATGG - Intergenic
1079756384 11:24269281-24269303 AAAAGTGGAAAATGGCTGGAAGG - Intergenic
1085553347 11:77395980-77396002 TAGGGTATCAGATGGCTGCAGGG - Intronic
1085713816 11:78854196-78854218 AAGCCTGTCTCATGGCTGGAGGG + Exonic
1088709018 11:112489854-112489876 AAATGTGTCAAAAGGATGGATGG - Intergenic
1091027510 11:132155306-132155328 AAGGGTGTCAAGTAGGTGCAGGG + Intronic
1092114525 12:5989758-5989780 ATGAGTGTCAAATGTCTGCAAGG - Intronic
1097471822 12:60002780-60002802 AAGGTTGTCAAATGTGTGAAAGG + Intergenic
1098652901 12:72995976-72995998 AAGTGTGTCAAAAGCCTGGAAGG - Intergenic
1099347990 12:81526622-81526644 CAGGATGTCAAATAGCTGAATGG + Intronic
1099419737 12:82442061-82442083 AGGGGTGTCATATGGCTGGCTGG - Intronic
1099481579 12:83173438-83173460 AAGTCTGTCAAGTGACTGGAGGG + Intergenic
1100802945 12:98252243-98252265 AAGGTTGTGAAATGGCTGAAAGG - Intergenic
1100998752 12:100332634-100332656 GAGGGTGGAAAATGACTGGAAGG + Intronic
1102096614 12:110246314-110246336 GAGGGTGTCAAAGGCCTGTAAGG - Intergenic
1102707082 12:114891417-114891439 AAGGGTTTTGGATGGCTGGATGG + Intergenic
1103583696 12:121935636-121935658 GAGTGTGTCAAAAGGCTGGTAGG - Intronic
1104440626 12:128790560-128790582 CAGGTTGTCAAAGGGCTGCATGG - Intergenic
1106287080 13:28327593-28327615 AAGGCTGGCAAATGGCTGACTGG - Intronic
1107440446 13:40422581-40422603 GAGGGTGTCTCCTGGCTGGATGG - Intergenic
1108058564 13:46509689-46509711 CAGTGTGTCACATGGCAGGATGG - Intergenic
1110371904 13:74750070-74750092 TAGGGTGTCTAATGGGTGGAAGG - Intergenic
1115228109 14:31126563-31126585 AAGAGTGTCAAATAGCTTTATGG + Intronic
1117906455 14:60593833-60593855 AAGGGTGAGTAATGACTGGAAGG + Intergenic
1118550516 14:66944845-66944867 AAGGGTGCCTAATGGCAGGCTGG - Intronic
1121433947 14:93906556-93906578 AAGTGTGTGGAATAGCTGGATGG + Intergenic
1124844794 15:33279824-33279846 AAGGGAGACAAAGGGCTGGGTGG + Intergenic
1124857630 15:33406112-33406134 AAGAGTGTCTAATGGCAGTAGGG + Intronic
1125362050 15:38874672-38874694 AAGGGTTCCAAAGGACTGGAAGG - Intergenic
1128796933 15:70472873-70472895 AAGGGGGTTAGATGGATGGATGG + Intergenic
1129707847 15:77804904-77804926 AAGGGAGCCCAAGGGCTGGATGG + Intronic
1130538602 15:84804331-84804353 AAGGGTTTGAAATGACTGGCTGG + Exonic
1130808683 15:87353848-87353870 AAGGGAGATAAATGGCTGGAGGG + Intergenic
1135618662 16:23934049-23934071 AAGAAAGTCAAATGGGTGGATGG - Intronic
1138628119 16:58269022-58269044 AAGGATTTCTAATGGCTGCAGGG - Intronic
1140443143 16:75001965-75001987 AAGGGTGTCAAAAGTGTGTATGG + Intronic
1141096776 16:81168489-81168511 ATGGGTGGAAAATGGATGGATGG + Intergenic
1144226604 17:13155383-13155405 CAGGGTGTAAAATGTCTCGAGGG - Intergenic
1148533594 17:48419066-48419088 AAGGGAGAAAAATGGATGGAAGG + Intronic
1151437469 17:74106854-74106876 AGTGGGGTCAAAGGGCTGGAAGG - Intergenic
1153465022 18:5379315-5379337 AAGGGTGTCAATTGGCCCGTGGG + Intergenic
1153641049 18:7157526-7157548 AAGGGTGGTAGATGGCTCGAGGG + Intergenic
1154347193 18:13551939-13551961 CAGTGTGTCACATGGCAGGATGG + Intronic
1155252957 18:23968863-23968885 AAGTGTTTCAGTTGGCTGGAGGG + Intergenic
1155920859 18:31601499-31601521 AAGGCTGTCAAGTGATTGGAAGG + Intergenic
1157251145 18:46097394-46097416 AAGGTTGGAAAATGGCTGTAAGG - Intronic
1159416517 18:68156247-68156269 AATAGTTTCAAATAGCTGGAAGG - Intergenic
1159893016 18:73970563-73970585 GAAGGTGTCAATTGTCTGGAAGG + Intergenic
1159968762 18:74622671-74622693 AAGGGTGTGATGGGGCTGGATGG + Intronic
1162838667 19:13339538-13339560 AATGGTTTCAAATAGCTAGAAGG + Intronic
1163239398 19:16050912-16050934 CAGGGTGTCATCTGGGTGGATGG - Intergenic
1163605820 19:18274766-18274788 GAGGCTGTAAAATGGCTAGATGG + Intergenic
1166391938 19:42413226-42413248 TAAAGTGTCAAATGGCAGGATGG - Intronic
1167060998 19:47146275-47146297 AAGAGTTTCAAATGACAGGAAGG + Intronic
1167317139 19:48771072-48771094 AAGGGGGTCACAGAGCTGGAGGG - Intergenic
925749443 2:7074311-7074333 AGGTGTGTCAATAGGCTGGAAGG - Intergenic
928148060 2:28799379-28799401 AAGGGTGTCAAATGGCTGGATGG - Exonic
929570007 2:43016745-43016767 AAGTGTGTCACATGGCAAGAAGG - Intergenic
930127343 2:47811950-47811972 AAGGGTGTGAAAAGGTTGGGGGG - Intronic
933606565 2:84389993-84390015 ATGGGTGTCCAAAGCCTGGAGGG + Intergenic
935274573 2:101464932-101464954 AAGGGTGGTAGATGGCTGGATGG + Intronic
935361079 2:102246716-102246738 AAGGGCATCAAGTGGATGGATGG + Intergenic
935898863 2:107768852-107768874 AAGGGTGTTAAAAGGCTGTAAGG + Intergenic
937603241 2:123765919-123765941 AAAGATGTAAACTGGCTGGATGG - Intergenic
937673518 2:124564206-124564228 AATAGTTTCAGATGGCTGGAGGG + Intronic
941735464 2:168970201-168970223 AAGGGTGTCAAATTGCTAGATGG + Exonic
944364811 2:198905687-198905709 ATGGGTCTCAAATTGGTGGAGGG - Intergenic
946671158 2:222105880-222105902 AAGGGTTACAACTGGCTGGAGGG - Intergenic
948900039 2:240951687-240951709 AAGGATGTTAAGTGGATGGATGG - Intronic
1174739629 20:52999380-52999402 AAGGGTGGCAAAGGGAGGGAAGG + Intronic
1179715392 21:43284208-43284230 ATGGGTGATAAATGGATGGATGG - Intergenic
950016276 3:9757124-9757146 AAGGGTTCCAAAGGGCCGGAAGG + Intronic
952692452 3:36225774-36225796 AAGGGTGTCATATGACTAAATGG + Intergenic
953785942 3:45911217-45911239 AAGGGTGTCAAATAACTCTAGGG + Intronic
954415013 3:50389079-50389101 AAGGTTGACAACAGGCTGGAAGG - Intronic
955476678 3:59343449-59343471 CTGGGTGTCAAATGGCAGGAAGG - Intergenic
955564873 3:60233344-60233366 TATGGTGGCAAAGGGCTGGAAGG - Intronic
955787898 3:62559144-62559166 AAGTGTGTCAAATGCAAGGAAGG - Intronic
956098681 3:65744968-65744990 GAGGTTGCCAAAGGGCTGGAGGG - Intronic
961718349 3:128874612-128874634 AAGTGTGTCAACAGGGTGGAAGG + Intergenic
964004665 3:151812835-151812857 AAGAGTGTGAAATGCCAGGATGG - Intergenic
966307390 3:178551897-178551919 AAGTGTGTCAAATGGCCAGCAGG - Intronic
967106699 3:186260311-186260333 AAGGGAGTAAAATGGCAGGAAGG + Intronic
968443617 4:636867-636889 ACAGGTGTCCACTGGCTGGATGG - Intronic
969599226 4:8166257-8166279 AAGGGTGGTAGATGGATGGATGG - Intergenic
969599391 4:8166979-8167001 ATGGGTGGCAGATGGATGGATGG - Intergenic
971152304 4:24046356-24046378 GAGGGTTGCAAATGACTGGATGG - Intergenic
971640610 4:29127304-29127326 AAGGTTCTCAAATGGATGTAGGG + Intergenic
972429253 4:38964619-38964641 AAGGGAGCAAAATGGATGGAGGG - Intergenic
972648456 4:40992630-40992652 AGGTGTGTGAAATGACTGGATGG + Intronic
976672342 4:87667319-87667341 TATGGTTTCAAATAGCTGGAAGG - Intergenic
978840146 4:113202340-113202362 TGGGGTGTCAAGTGGATGGATGG + Intronic
978981057 4:114945919-114945941 AATGGTGACAAATCTCTGGAGGG + Intronic
982576558 4:157118415-157118437 AAGGATGACAACTGGCTGTAAGG + Intronic
985886265 5:2681965-2681987 AATGGTGGGAAGTGGCTGGAGGG + Intergenic
986970031 5:13322684-13322706 AAGGGTGTGAATAGTCTGGAAGG - Intergenic
990291004 5:54351630-54351652 AAGGGAGTCAAATGCCAAGATGG - Intergenic
990396944 5:55391862-55391884 AAGGGTTTCTAAGGGCAGGAAGG - Intronic
990550477 5:56872098-56872120 AAGAGTGTAACATGGCTTGAGGG + Intronic
996155231 5:120090989-120091011 AAGTGTGACAAATGCCAGGAAGG + Intergenic
997791182 5:136763768-136763790 ATGGGTGTCAGATGGATGGATGG + Intergenic
998159026 5:139802782-139802804 GAGGGTGCCAATTGGCTGGGGGG + Intronic
999167553 5:149563271-149563293 AAGGGTGTAGAAAGGCTGGTGGG - Intronic
999826829 5:155281689-155281711 AAGGGTATCAAAAGTCAGGATGG + Intergenic
1000266594 5:159643778-159643800 AAGGGTGTCTAATGCCTGGGGGG + Intergenic
1001135413 5:169098670-169098692 AAATGTGTCAAATGACAGGAGGG + Intronic
1002678468 5:180938957-180938979 AAGGGAGTCCTATGTCTGGAAGG + Intronic
1005515820 6:26553251-26553273 AAGCATGTCTGATGGCTGGAAGG + Intergenic
1008541204 6:52547730-52547752 CAGGGTGCCAAAGGGGTGGAGGG + Intronic
1010333662 6:74655102-74655124 GAGGGAGTCAAATGGCTTAATGG - Intergenic
1011517778 6:88170726-88170748 AAGGCTGAGAAATGGCAGGAAGG + Intergenic
1014734302 6:125074134-125074156 AAGTTTGTCAATTGGCTGGCAGG - Intronic
1014919930 6:127202117-127202139 AAGGAAGTCAAAAGGATGGACGG - Intergenic
1017359442 6:153549387-153549409 CAGGGAGTGAAATGGCAGGATGG - Intergenic
1018143127 6:160859696-160859718 AATAGTTTCAAATAGCTGGAAGG + Intergenic
1018815970 6:167331271-167331293 AATAGTTTCAAATAGCTGGAAGG - Intronic
1019418126 7:936657-936679 AAGGGAGTGGAATGGCTGAAAGG + Intronic
1019522856 7:1468442-1468464 AAGGGTGGCTCCTGGCTGGAGGG + Intergenic
1020773045 7:12420125-12420147 AAGTTTGAGAAATGGCTGGAGGG + Intergenic
1021458069 7:20851262-20851284 AAGAATGACAAATGGGTGGATGG + Intergenic
1026009111 7:66623082-66623104 ATGGATGTCAAAAGACTGGATGG - Intergenic
1026216154 7:68350918-68350940 CATGTTGACAAATGGCTGGAAGG + Intergenic
1028702316 7:93794143-93794165 CAGAATGTCATATGGCTGGAAGG + Intronic
1032470484 7:132174934-132174956 AAGCCTGTGAGATGGCTGGATGG + Intronic
1033438401 7:141355276-141355298 AAGGGAGTCAAAGGGGTGGATGG + Intronic
1033810592 7:145006456-145006478 AAGGGTGGTAGATGGCAGGAAGG - Intergenic
1034535049 7:151721115-151721137 GAGGATGTCAGAGGGCTGGATGG + Intronic
1037500592 8:19481926-19481948 AAGGGTTTCAAAATGCTGGCAGG + Intronic
1038977333 8:32714909-32714931 AAATCTGTCAAATGGCTGCATGG - Intronic
1041341113 8:56846810-56846832 AATAGTTTCAAATAGCTGGAAGG + Intergenic
1043674151 8:82928804-82928826 AAAAGTGTCAAATCTCTGGAAGG + Intergenic
1047228944 8:122979683-122979705 AAGGGTGGTAAATGGCAGGAGGG - Intergenic
1053004259 9:34593712-34593734 AAGGATATCAAAGGGCGGGAGGG - Intergenic
1056011235 9:82333046-82333068 AAGGGAGTCAAATAGGTGCATGG + Intergenic
1056233462 9:84569727-84569749 GTGGGTGGGAAATGGCTGGATGG + Intergenic
1058616845 9:106838769-106838791 AAAAGTAGCAAATGGCTGGATGG + Intergenic
1061718636 9:132537593-132537615 AAGGGTGTGGAAGGCCTGGAGGG - Exonic
1062428273 9:136516013-136516035 AATGGTGCCAAGTGCCTGGACGG - Exonic
1185883535 X:3761356-3761378 AAGGATGACAGATGGATGGATGG + Intergenic
1186985983 X:15014254-15014276 AAAGGTGTCAAATGGCTTAAAGG + Intergenic
1190938469 X:55017870-55017892 CAGGGTTACAAATGACTGGAGGG - Intronic
1190988302 X:55520960-55520982 AGGCGTGTCAAAAGTCTGGAGGG - Intergenic
1192458978 X:71301308-71301330 AGGTGCATCAAATGGCTGGAGGG + Intergenic
1195084961 X:101405346-101405368 CATGGTATCAGATGGCTGGAAGG - Intronic
1196713212 X:118785394-118785416 GAGGATGTGAAAGGGCTGGAAGG - Intronic
1197070105 X:122286383-122286405 AGGAGTATCAAATGGCTGGAAGG - Intergenic
1198330623 X:135619279-135619301 AATGGTGTCACATGGTGGGAAGG + Intergenic
1198336305 X:135669717-135669739 AATGGTGTCACATGGTGGGAAGG - Intergenic
1198363323 X:135916936-135916958 AATGGTGTCACATGGTTGGAGGG + Intergenic
1199505321 X:148554834-148554856 ATGTGTGTTGAATGGCTGGATGG + Intronic
1199594231 X:149493957-149493979 AGGGGTGGCAAAGGCCTGGAGGG + Intronic