ID: 928155801

View in Genome Browser
Species Human (GRCh38)
Location 2:28875340-28875362
Sequence GATTCAAGTTTAGCAGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928155801_928155803 4 Left 928155801 2:28875340-28875362 CCAGTTGCTGCTAAACTTGAATC No data
Right 928155803 2:28875367-28875389 TTCTGTAGAACTTCTCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928155801 Original CRISPR GATTCAAGTTTAGCAGCAAC TGG (reversed) Intergenic
No off target data available for this crispr