ID: 928155850

View in Genome Browser
Species Human (GRCh38)
Location 2:28875760-28875782
Sequence TCTGAAGCCCAGACAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928155850_928155856 26 Left 928155850 2:28875760-28875782 CCTGCTCCTGTCTGGGCTTCAGA No data
Right 928155856 2:28875809-28875831 CCACCCTCCATCTCTTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928155850 Original CRISPR TCTGAAGCCCAGACAGGAGC AGG (reversed) Intergenic
No off target data available for this crispr