ID: 928161997

View in Genome Browser
Species Human (GRCh38)
Location 2:28936313-28936335
Sequence TCAGCAGCATGTTAGATAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928161997_928161999 15 Left 928161997 2:28936313-28936335 CCATTTATCTAACATGCTGCTGA 0: 1
1: 0
2: 0
3: 11
4: 175
Right 928161999 2:28936351-28936373 TAGTTACGGTATTAACAGTGTGG 0: 1
1: 0
2: 1
3: 3
4: 58
928161997_928162001 20 Left 928161997 2:28936313-28936335 CCATTTATCTAACATGCTGCTGA 0: 1
1: 0
2: 0
3: 11
4: 175
Right 928162001 2:28936356-28936378 ACGGTATTAACAGTGTGGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 63
928161997_928161998 1 Left 928161997 2:28936313-28936335 CCATTTATCTAACATGCTGCTGA 0: 1
1: 0
2: 0
3: 11
4: 175
Right 928161998 2:28936337-28936359 GTATTTTGCAAGTATAGTTACGG 0: 1
1: 0
2: 0
3: 34
4: 281
928161997_928162000 16 Left 928161997 2:28936313-28936335 CCATTTATCTAACATGCTGCTGA 0: 1
1: 0
2: 0
3: 11
4: 175
Right 928162000 2:28936352-28936374 AGTTACGGTATTAACAGTGTGGG 0: 1
1: 0
2: 0
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928161997 Original CRISPR TCAGCAGCATGTTAGATAAA TGG (reversed) Intronic
900530291 1:3149680-3149702 TCAGCACCATCTTGCATAAAAGG - Intronic
903312423 1:22470018-22470040 TCAGCAGCATGTGAGATGCATGG + Intronic
904057999 1:27685152-27685174 ACAGCAGCATTTTAGGAAAAGGG + Intergenic
904329555 1:29749377-29749399 TCAGCTGCATGTTCATTAAATGG - Intergenic
905502220 1:38448885-38448907 GCAGAAGCATGTAAGGTAAAGGG - Intergenic
906175876 1:43771944-43771966 TCAGGAGCATGGAAGTTAAAAGG + Intronic
906518245 1:46452227-46452249 TCAGCAGCATGAGAGACAAGAGG + Intergenic
910535975 1:88298071-88298093 TCAGCAGCAGTTTCTATAAAAGG - Intergenic
913936509 1:125057827-125057849 CCACCAGCAGGTTAGACAAAAGG - Intergenic
917013342 1:170500546-170500568 TCAGGATCCTGTAAGATAAAGGG + Intergenic
918688454 1:187448642-187448664 TCAGAAGTATGTTGAATAAATGG + Intergenic
919090472 1:192972931-192972953 TTTCCAGCATGTTATATAAATGG + Intergenic
919686481 1:200487971-200487993 TATACAGCATGTTAGATACAAGG + Intergenic
921782537 1:219183073-219183095 TCAGGAGGATGTGAGACAAATGG - Intronic
923767670 1:236907508-236907530 AGAGCAGCTTGTTAAATAAATGG - Intergenic
923901472 1:238330391-238330413 TCACCAGCAAGTAAGATACAAGG - Intergenic
1063436639 10:6037312-6037334 TGAGCAACATGAAAGATAAAGGG + Intronic
1065234754 10:23637749-23637771 TCAACAGAATATTTGATAAAAGG + Intergenic
1065287170 10:24197208-24197230 TCAGCATCTTTTTTGATAAATGG + Intronic
1065426087 10:25605620-25605642 TAAGCAGCATGTAATATGAAAGG - Intergenic
1068006504 10:51397755-51397777 GCAGGAGCAGGTTAGGTAAAGGG - Intronic
1069332319 10:67307437-67307459 TCAGTAGCATGTTGTATAGAAGG - Intronic
1073227392 10:101934150-101934172 TCAGCAGCCTCTGAGATAATGGG - Intronic
1075766195 10:124894943-124894965 TCAGCAGCGTGATGGAGAAAGGG - Intergenic
1079481653 11:20887069-20887091 TTACCAGAATGTTATATAAATGG + Intronic
1079640031 11:22793652-22793674 TCAGAAGTATGTTATAGAAAGGG + Intronic
1082179252 11:49098860-49098882 TCAGGAGCAAATGAGATAAATGG - Intergenic
1084748401 11:71188197-71188219 TCAGCAGGATGTGAGAGAGATGG - Intronic
1086686035 11:89734060-89734082 TCAGGAGCAAATGAGATAAATGG + Intergenic
1086700673 11:89897382-89897404 TCAGGAGCAAATGAGATAAATGG - Intergenic
1086705496 11:89947144-89947166 TCAGGAGCAAATGAGATAAATGG + Intergenic
1089764283 11:120751729-120751751 TCAGCAGCATCTTCGGTGAAGGG + Intronic
1090337398 11:125981236-125981258 TCAGGAGCAAGTCAGATAAATGG - Exonic
1090979578 11:131706459-131706481 TGAGCAGCATAATAGATTAAAGG + Intronic
1093302555 12:17473817-17473839 TCAGCTGCATGTAAGGAAAAAGG - Intergenic
1093443108 12:19223093-19223115 TCAGCAACATTTTGGATACAGGG - Intronic
1093824222 12:23662804-23662826 TCATCAGTATGTTCAATAAATGG + Intronic
1093843592 12:23938053-23938075 TTAGCAGCATTTTAGACAACTGG + Intronic
1096030451 12:48409566-48409588 TCAGCAACATGTAAGACCAAAGG - Intergenic
1096118960 12:49074202-49074224 TCATCCTAATGTTAGATAAATGG + Intergenic
1098355438 12:69608788-69608810 CCAGAAGCATGTTAGTTTAAAGG - Exonic
1100695346 12:97086725-97086747 TCAGCTGCAGGTTGGATGAAGGG + Intergenic
1101037371 12:100718311-100718333 TCAGCAGTATTTCTGATAAAGGG - Intronic
1101984635 12:109436142-109436164 TCATCAGCATGTTTTATAAATGG - Intronic
1103150517 12:118634546-118634568 TCAACAGCATGGTGGAGAAAAGG + Intergenic
1103489549 12:121306210-121306232 TCAGCAGAAGGTTGAATAAATGG - Intergenic
1108941273 13:55957422-55957444 TCTTCAGCATGTTATATAAGAGG + Intergenic
1111408300 13:87839678-87839700 TCAGCAGAAAGTAAAATAAAAGG - Intergenic
1114727857 14:24957715-24957737 TAATCAGCATTTTACATAAATGG + Intronic
1117616242 14:57536567-57536589 TCAGGAGCCTGGCAGATAAAAGG - Intergenic
1118487755 14:66229893-66229915 TAAGCATCATGTTAGAAATATGG - Intergenic
1119549051 14:75494834-75494856 TCTGCAGCATGGTAGAGGAAGGG - Intergenic
1119898972 14:78243897-78243919 TTAGCTGCATGTTAGATCACTGG + Intronic
1120401616 14:84039686-84039708 TCAGCAGGATGTAAAATTAAGGG + Intergenic
1120563280 14:86023065-86023087 TCTGCAACATGAGAGATAAATGG + Intergenic
1120717251 14:87853125-87853147 TCAGTAGCATATTGGATTAAAGG - Intronic
1122048638 14:99040689-99040711 GCTGCAGCACGTTATATAAAAGG + Intergenic
1123481718 15:20638611-20638633 TCAGCAGCCTGTTAGAAACCAGG - Intergenic
1123636295 15:22361754-22361776 TCAGCAGCCTGTTAGAAACCAGG + Intergenic
1126576153 15:50198826-50198848 TCAGCTGCAGCTGAGATAAAAGG - Intronic
1131075510 15:89492796-89492818 TCAGCACCTTGTTAGAAACATGG - Intronic
1135125080 16:19802720-19802742 TTTCCAGCATGTTACATAAATGG + Intronic
1136051842 16:27656455-27656477 TCAGTAGCATGAGAGACAAAGGG + Intronic
1141225274 16:82109157-82109179 CCATCAACATGTGAGATAAAGGG - Intergenic
1149765295 17:59271301-59271323 TCACCAGCAAGTAAGCTAAAGGG - Intronic
1149775403 17:59353200-59353222 TCAGCAGCCTGTAACATCAAGGG - Exonic
1152267836 17:79306613-79306635 TCAGCAGCATGGAAGGGAAAGGG - Intronic
1153946059 18:10018453-10018475 TCAGCAACCTTTTAGATAAATGG + Intergenic
1158553543 18:58457451-58457473 TCAGGAGCATGTTAGAGATGAGG + Intergenic
1159235108 18:65661505-65661527 GCAGCAGCAGTTTAGAAAAAGGG + Intergenic
1159319490 18:66829105-66829127 TCAGTGGTATGTTGGATAAAAGG + Intergenic
1159849033 18:73503613-73503635 ACAGCAGCATGTTCAACAAATGG + Intergenic
1160593632 18:79959496-79959518 TCAGCAGCGTCTTAGATTTAGGG + Intergenic
1163257955 19:16168976-16168998 TCAGCAGGATGTTTGACACATGG - Intronic
1164510631 19:28894219-28894241 TCAGCAGCAGGTTAGCTCACAGG + Intergenic
1167828009 19:51991559-51991581 TTAGTAGCATGTTATAAAAATGG - Exonic
926640853 2:15235238-15235260 TTAGCTGCATGTTATAAAAAAGG + Intronic
928161997 2:28936313-28936335 TCAGCAGCATGTTAGATAAATGG - Intronic
929096418 2:38267143-38267165 TCAGCAGCCTGTTAGAGGCATGG + Intergenic
929395804 2:41520824-41520846 TCAGCAGGATGTTGGAAATATGG - Intergenic
930214338 2:48678885-48678907 TCAGGAGCATTCCAGATAAAAGG - Intronic
934018071 2:87911105-87911127 TCAGCAAGATATTAGATACAGGG + Intergenic
934580641 2:95434894-95434916 TCAGGAGCAAATGAGATAAATGG + Intergenic
934598810 2:95641823-95641845 TCAGGAGCAAATGAGATAAATGG - Intergenic
935719309 2:105966303-105966325 TCAGCAGCAGGTCAGATATATGG - Intergenic
936481726 2:112890988-112891010 TCAGCTTCATGTGAGGTAAAAGG - Intergenic
937644705 2:124253563-124253585 TCAGCAGGACCTCAGATAAATGG + Intronic
939756827 2:146124084-146124106 ACAGAAGCATGTTATTTAAATGG - Intergenic
940576882 2:155519624-155519646 TCAGCAGCCTGTCAGCAAAAAGG - Intergenic
941202620 2:162531333-162531355 TCAGCAGCATGGCAGAGAAGGGG - Intronic
942674833 2:178415848-178415870 TCAGCCTCATTTAAGATAAAAGG + Intergenic
943050916 2:182912072-182912094 TCAGCAGTTTTTTAGGTAAAAGG - Intronic
943184385 2:184587850-184587872 TCAGCAGCATGTATAATATATGG + Intergenic
943973274 2:194438864-194438886 GCAACAGCCTGTTAAATAAATGG + Intergenic
944978268 2:205083447-205083469 TCAACATCATGGTAGAAAAAGGG + Intronic
945200910 2:207280040-207280062 TCATCAGCATGTAAGATATATGG - Intergenic
1169022133 20:2338133-2338155 TCAGTACCAGGTTAGATAATGGG - Intronic
1170182324 20:13545886-13545908 TAAGCTGGATGTTGGATAAAGGG - Intronic
1174953228 20:55066578-55066600 TCAGCAGCCTCAAAGATAAAAGG - Intergenic
1175120765 20:56714583-56714605 ACAAAAGAATGTTAGATAAATGG + Intergenic
1177375553 21:20266284-20266306 TCACCAACAAGTTAGATATAAGG - Intergenic
1177472817 21:21580674-21580696 TCAGCAGCCTGTGAGAGCAATGG - Intergenic
1181087509 22:20448380-20448402 TCCCCAGCATTTCAGATAAAGGG + Intronic
953518022 3:43616083-43616105 TCAACAGTATGTGAAATAAAAGG + Intronic
955432827 3:58867072-58867094 TCATCAGCATGTTAAGAAAATGG + Intronic
956041077 3:65145768-65145790 TAAGCAGAATTGTAGATAAATGG + Intergenic
959561043 3:107781782-107781804 TCAACAGTATGTTTGATAATAGG - Intronic
960306311 3:116065769-116065791 GAAGCAGCATGTTAGCAAAACGG + Intronic
961530139 3:127535667-127535689 TCAGCATCATGTTTGACCAAAGG - Intergenic
962637292 3:137344131-137344153 TCTTCAACATGTGAGATAAATGG - Intergenic
962655876 3:137543429-137543451 TCAGATGCATGAAAGATAAATGG - Intergenic
963876587 3:150482693-150482715 TCAAGAACATGGTAGATAAAAGG - Intergenic
963931050 3:151004658-151004680 TCAGCAGCAGGTTGGAGGAAAGG + Intergenic
965076389 3:163982947-163982969 TAAGAAGCATGTTAAATTAATGG - Intergenic
965584485 3:170304694-170304716 TCAGCAGCTTATTATTTAAAGGG + Exonic
966127740 3:176599760-176599782 TGAGCAGAAAGTAAGATAAATGG + Intergenic
966639557 3:182174521-182174543 TAAGCAACATGATATATAAATGG + Intergenic
967362047 3:188642311-188642333 TCAGCATAATGTTAGAGAAATGG + Intronic
967362408 3:188646785-188646807 TCAGCACCATGTGATAGAAAGGG - Intronic
970717398 4:18942226-18942248 TATGCTGCCTGTTAGATAAAAGG + Intergenic
973924213 4:55720579-55720601 TCAGCTCCAGGTAAGATAAATGG - Intergenic
974483996 4:62482920-62482942 CCAGGAGCATGTAAGAAAAATGG + Intergenic
979361639 4:119772543-119772565 TCAGCTTCTTGTTAGATTAAAGG + Intergenic
981078791 4:140617843-140617865 TCAAAAGCATGTTAAACAAAAGG + Intergenic
982355577 4:154464152-154464174 CCTCCAGCATGTTAGATAGAGGG + Intronic
982512106 4:156295785-156295807 ACAGAAACATGTTAAATAAATGG - Intergenic
985010689 4:185579492-185579514 TCTGCAGCAGGGTAGATTAATGG + Intergenic
985395934 4:189544329-189544351 GAAGCAGCATTTAAGATAAATGG - Intergenic
985584355 5:721609-721631 TCAGCAACATGTTCCATATATGG - Intronic
986012902 5:3732799-3732821 TCAGCAGCATTTCAGATCCACGG - Intergenic
986531195 5:8738803-8738825 TCAGCCGAATGTTATATCAAGGG + Intergenic
986701147 5:10409871-10409893 TTAGTAGCATGTTACACAAAAGG - Intronic
989990377 5:50756807-50756829 ACAGCAAGATGTTAGCTAAAGGG - Intronic
990288636 5:54326753-54326775 TCAGCAACATGTGGGACAAAAGG - Intergenic
993207279 5:84897753-84897775 TCAGCAGCATATTTGTTAAAGGG + Intergenic
994272579 5:97798417-97798439 TTTGCAGCATGTTTGCTAAATGG + Intergenic
994298912 5:98122379-98122401 TCAGCAGCATCAAAGATCAAAGG + Intergenic
995121629 5:108541843-108541865 TCAGTAGAGTGTTAGAAAAAGGG + Intergenic
995252311 5:110007351-110007373 GCAGCTGGATGTTGGATAAAGGG + Intergenic
995366850 5:111371540-111371562 TCAGCCCCATGTTAAATAATTGG - Intronic
996070733 5:119128379-119128401 ACAGCAGCATGGTAGCTCAACGG - Intronic
996070960 5:119131131-119131153 TCAGCAGGAAATTAGATAAAGGG - Intronic
996495769 5:124154092-124154114 TTTCCAGCATGTTACATAAATGG - Intergenic
997591221 5:135073506-135073528 TCAGCAGCAAGCCAGAAAAAGGG + Intronic
997769117 5:136536817-136536839 TAAGCAGCCTATTAGATTAAAGG + Intergenic
1000733743 5:164871532-164871554 TAAGCAGCATGCTAGAAGAAAGG - Intergenic
1001368659 5:171172874-171172896 TAAACAGCATGTAAAATAAAAGG - Intronic
1002843203 6:923542-923564 TCAGCAGAAAGTTGCATAAATGG + Intergenic
1004381767 6:15138631-15138653 TTAGAAGCTTGTTAGAAAAAAGG - Intergenic
1006414367 6:33894732-33894754 TCAGCAGTGGGTTAGAGAAAGGG + Intergenic
1008853678 6:56055186-56055208 TCAGCACCATGTTACGTGAAAGG - Intergenic
1010391911 6:75347549-75347571 TCAAAAGCATGTTAGCAAAATGG - Intronic
1011364462 6:86566322-86566344 TCAGGAGCAGGTTGGAGAAATGG + Intergenic
1013319546 6:108973503-108973525 TCTGCATCATGTTAGAAAGAGGG - Exonic
1013635829 6:112028421-112028443 TCTGCAGCATGTTATTTAACTGG - Intergenic
1014774504 6:125493230-125493252 CCAGCAGCATGATGGATAGAGGG + Intergenic
1017321575 6:153100621-153100643 TAAGAAGTAAGTTAGATAAAAGG - Intronic
1017472753 6:154756401-154756423 TCAGTAGATTGTTAGATAAATGG + Intronic
1018050080 6:160001214-160001236 TCTGCATCCTGTTAGATAAGTGG + Intronic
1021781536 7:24111606-24111628 TCAGCACCATGTCATAAAAAGGG + Intergenic
1023882864 7:44330298-44330320 CCAGCAGCAGGATAGAGAAAGGG + Intronic
1027853457 7:83478939-83478961 GCAGCAGCATGATGAATAAATGG - Intronic
1028857911 7:95612857-95612879 TCAGCAGCATTTTACAAAACTGG - Intergenic
1028990456 7:97043905-97043927 TCATCAGCATGTTGGAAACATGG - Intergenic
1030124749 7:106143261-106143283 TCATTAGCACGTTAGATATAAGG + Intergenic
1034885452 7:154795042-154795064 TCCGCCCCAGGTTAGATAAAAGG - Intronic
1035393296 7:158519690-158519712 TCAGCAGCATTGGAGAAAAAGGG - Intronic
1037202483 8:16274784-16274806 ACAGCAACATATTAGATAAAGGG - Intronic
1040409978 8:47144224-47144246 TCTGAAGTATGTTAGATAACAGG - Intergenic
1043799949 8:84596224-84596246 ACAGCAGCAATTTGGATAAATGG - Intronic
1045881672 8:107047869-107047891 TGATCAGCATGTTAAAGAAAAGG + Intergenic
1047814378 8:128446665-128446687 CCAGCAAAATGTTAGCTAAAAGG + Intergenic
1050742022 9:8831993-8832015 TGAACAGCATGACAGATAAAAGG + Intronic
1055405103 9:75965956-75965978 TCAGCAGCATGTGAGCTATCAGG + Intronic
1055504522 9:76934171-76934193 TCATCAGCAGGTTTCATAAATGG + Intergenic
1055994918 9:82146922-82146944 TCAATAACATGTTAGATGAAAGG - Intergenic
1059965864 9:119612789-119612811 TCTCCAGAATGTTATATAAATGG + Intergenic
1185864877 X:3614668-3614690 TAAACATAATGTTAGATAAAAGG + Intronic
1185967785 X:4627117-4627139 TCGGTAGAATGTTGGATAAATGG + Intergenic
1197902142 X:131384889-131384911 TTAGTAGCATGTTATAAAAATGG + Intronic
1198416633 X:136426574-136426596 TCTGCAGCATGCTGGAGAAAAGG + Intergenic
1198436991 X:136626949-136626971 TTAGCAGAATGTTGGCTAAAGGG + Intergenic
1198611617 X:138407566-138407588 TCATCAGTCTGGTAGATAAAGGG - Intergenic
1199063912 X:143391236-143391258 TCAGCAGCATGCAATATAACAGG - Intergenic
1199126458 X:144127904-144127926 TCAGCAAGATATTAGATACAGGG - Intergenic
1199919127 X:152378306-152378328 TCAGGTGCATATTATATAAAAGG + Intronic
1201315080 Y:12636623-12636645 TATTCAGCATGTTGGATAAAAGG + Intergenic