ID: 928165738

View in Genome Browser
Species Human (GRCh38)
Location 2:28970623-28970645
Sequence TCCCTGGCGGTGAGGGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928165732_928165738 -5 Left 928165732 2:28970605-28970627 CCTATATCAAGTTGCTTCTCCCT 0: 1
1: 0
2: 2
3: 41
4: 304
Right 928165738 2:28970623-28970645 TCCCTGGCGGTGAGGGCCATGGG 0: 1
1: 0
2: 1
3: 13
4: 132
928165731_928165738 -2 Left 928165731 2:28970602-28970624 CCACCTATATCAAGTTGCTTCTC 0: 1
1: 0
2: 0
3: 16
4: 191
Right 928165738 2:28970623-28970645 TCCCTGGCGGTGAGGGCCATGGG 0: 1
1: 0
2: 1
3: 13
4: 132
928165730_928165738 23 Left 928165730 2:28970577-28970599 CCTATTAATGTGGGGAAATCACT 0: 1
1: 0
2: 0
3: 6
4: 141
Right 928165738 2:28970623-28970645 TCCCTGGCGGTGAGGGCCATGGG 0: 1
1: 0
2: 1
3: 13
4: 132
928165729_928165738 27 Left 928165729 2:28970573-28970595 CCTGCCTATTAATGTGGGGAAAT 0: 1
1: 0
2: 0
3: 12
4: 102
Right 928165738 2:28970623-28970645 TCCCTGGCGGTGAGGGCCATGGG 0: 1
1: 0
2: 1
3: 13
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928165738 Original CRISPR TCCCTGGCGGTGAGGGCCAT GGG Intronic
900422341 1:2561021-2561043 TCCCTGAATGTCAGGGCCATGGG + Intronic
901022950 1:6264207-6264229 TCCCAGGGGGTGTGGGACATTGG - Intergenic
902437939 1:16410027-16410049 CCCCAGGAGGTGAGGGACATTGG - Exonic
903027273 1:20438324-20438346 TACCAGGAGGTGAGGACCATCGG - Intergenic
905637049 1:39561037-39561059 TCCTTGGTGTTGAGGTCCATAGG + Exonic
906035742 1:42749329-42749351 CCCCTGGCAGTGATGGCCATTGG - Intronic
906711137 1:47930737-47930759 GCCCTGGAGGTGAAGGCCACTGG - Intronic
916601886 1:166301135-166301157 ATCCTGGCCTTGAGGGCCATGGG + Intergenic
923086892 1:230709020-230709042 TGCCTGGCAGTGAGGGCAACAGG - Intronic
1063024236 10:2162308-2162330 TTCCTGAGGGTGAGGGTCATGGG + Intergenic
1063872141 10:10429297-10429319 TTTCTGGCTGTGAGGGCCACAGG + Intergenic
1067527518 10:47047417-47047439 TCTGTGGGGGTGAGAGCCATGGG + Intergenic
1068891631 10:62154423-62154445 TCCCAGTCGCTGAGGTCCATAGG + Intergenic
1069403477 10:68074817-68074839 TTCCTGGGGGTGAGGGGCGTGGG - Intronic
1069719019 10:70538379-70538401 CCCCTGGCGATGAGGTCCCTCGG - Exonic
1069861454 10:71474196-71474218 TCCCTGGAGGTGAAGGCCACTGG - Intronic
1070944544 10:80378351-80378373 TCCCTAGCGGTGAGGGCGGATGG - Intergenic
1075303027 10:121342307-121342329 TCACTGGGGGTGAGGGCTCTGGG - Intergenic
1077279260 11:1734704-1734726 TGCCTGGCGGTCAGGGCCCCGGG - Exonic
1077914287 11:6601161-6601183 TCCCTGGCGATGCGGTCCACTGG + Exonic
1077976323 11:7252078-7252100 TCCCTGGCGGTGAGCGCGGACGG + Exonic
1078748037 11:14133962-14133984 GCCCTGGAGCAGAGGGCCATGGG + Intronic
1079407658 11:20160092-20160114 CCCGTGTCGGTGAGGGCCGTGGG + Exonic
1084478512 11:69402494-69402516 TACCTGGCTGTGAGGTCCCTAGG + Intergenic
1084589954 11:70084819-70084841 TCTCTGGTGCTGAGGGGCATGGG - Intronic
1085512152 11:77093862-77093884 TGTCTGGCAGTGAGGGCCACAGG - Intronic
1094752868 12:33433823-33433845 TCCTTGGCGCTGAAGGGCATTGG - Intronic
1095403304 12:41839803-41839825 TCTCTGGCTGTGAGAGCCACAGG - Intergenic
1096620192 12:52859734-52859756 TCCCTGGTGCTGGGGGCTATGGG + Intergenic
1097262588 12:57727872-57727894 ACCCTGGTGCTGACGGCCATTGG - Intronic
1103400883 12:120641699-120641721 TCCCTGGCGGTACTGGCCAGAGG - Intronic
1104972548 12:132538508-132538530 TCCCTGGCAGTGATGGCCACGGG + Intronic
1106694681 13:32160563-32160585 TCCATAGAGGTGAGGCCCATCGG + Intronic
1110626374 13:77660166-77660188 TCCCAGGCGGTGCGGGGGATGGG + Intergenic
1112251200 13:97782212-97782234 GCCCTGGTGGTGTGGGCAATAGG - Intergenic
1113871362 13:113561861-113561883 TCCCTGGCAGTGACGTCCACCGG - Intergenic
1113944106 13:114034005-114034027 TGCCAGGCGGTGAGGACCACAGG - Intronic
1115766349 14:36627037-36627059 TGCCCGGAGGTGAGGACCATTGG + Intergenic
1116715296 14:48418353-48418375 TCCCTGCCTGTGAAGGCCAAGGG + Intergenic
1117842972 14:59880462-59880484 CCACTGGTGGTGATGGCCATGGG - Intergenic
1121011919 14:90524721-90524743 GCCCTGGGGGTTAGGGCCTTGGG + Exonic
1121275680 14:92666147-92666169 TCCCTGGAGGTGAGGGGGCTGGG - Intronic
1122028033 14:98891940-98891962 ACCCTGGCCCTGAGGGCCAAGGG - Intergenic
1123932587 15:25179000-25179022 TCCCTGGGGTTGAGGCACATTGG + Intergenic
1123935819 15:25193584-25193606 TCCCTGGGGGTGGGGCACATGGG + Intergenic
1123943779 15:25229229-25229251 TCCCTGGGGGTGGGGAACATTGG + Intergenic
1129115138 15:73361416-73361438 TCCCAGACAGAGAGGGCCATGGG - Intronic
1129202822 15:74015170-74015192 TCACTGGAGGGGAGGTCCATAGG + Intronic
1132550064 16:550646-550668 TCCCTGTCGGTGAGGGTCCCCGG + Intronic
1132551731 16:556442-556464 GCCCTGGTGCTGAGGGCTATGGG + Intergenic
1132756246 16:1486858-1486880 TCCCTGGCAGTGAGGGGCGCTGG - Intronic
1132895876 16:2229172-2229194 GCCCTGGAGGTGTGGGCCAGAGG - Intronic
1133248258 16:4463427-4463449 TTCCAGGAGGAGAGGGCCATAGG - Intronic
1136292525 16:29284431-29284453 TCCCTGGCACAGAAGGCCATCGG - Intergenic
1136569934 16:31090662-31090684 TTCCTGGGGGTGGGGGCCAATGG + Intronic
1137288463 16:47035653-47035675 TCCCTGGCTGCGAGGGCCCAGGG + Intergenic
1137777987 16:51072263-51072285 TCCCTGGGTGTGAGGACCCTAGG - Intergenic
1138360617 16:56424974-56424996 TCCCTGGCGGAGGGGCCCCTAGG + Intronic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1141831657 16:86512571-86512593 GCCCTGGCGGTGACGGCCATGGG + Intronic
1142098415 16:88258446-88258468 TCCCTGGCAGAGAAGGCCATCGG - Intergenic
1142514219 17:416431-416453 TCCATGGCGGTGAGAGGCAGGGG + Intronic
1142852167 17:2709529-2709551 TCCCTGGAGTTGAGGCCCAGAGG - Intronic
1143025832 17:3941572-3941594 TCCCTGGAGGTGGGGGTCAGGGG + Exonic
1143203902 17:5130203-5130225 CCCATGGAGGTGTGGGCCATGGG + Intronic
1152032653 17:77853709-77853731 TCCTTTGAGGAGAGGGCCATGGG - Intergenic
1152874952 17:82781267-82781289 TCCCTGGCGGTGATGGGGACAGG + Intronic
1153624630 18:7012443-7012465 TCCCTGGGTGTGAGAGCCACCGG + Intronic
1160404419 18:78635298-78635320 CCCCTGGCGGTGTGGGCCCTTGG - Intergenic
1160570707 18:79815838-79815860 TCCAGGGCGGTGGGTGCCATCGG - Intergenic
1160672558 19:373284-373306 GTCCTGGGGGTGAGGGGCATGGG - Intronic
1161517340 19:4703803-4703825 ACCCTGGCTGTGGGGGCAATGGG + Intronic
1161587049 19:5111236-5111258 TCCCTGGCGCTGAGAGCAGTCGG + Intronic
1164678432 19:30118497-30118519 TCCCTGACTGTGAGGCTCATGGG + Intergenic
1166876878 19:45902712-45902734 ACCCTGGCGGTAAGGGCATTGGG - Intergenic
1166996631 19:46722633-46722655 GCCCTGGCTGTGAGGGCCGGGGG + Intronic
1167124559 19:47540190-47540212 TCCCTCGAGGTGACGGCCACTGG + Exonic
1168120278 19:54248195-54248217 TCCCTGACTGTGAGGGCCCTGGG - Intronic
1168123934 19:54272483-54272505 TCCCTGTCTGTGAGGGCCCTGGG - Intronic
1168178429 19:54643051-54643073 TCCCTGTCTGTGAGGGCCTGGGG + Intronic
1168301439 19:55407382-55407404 TCCCTGGCGGCGAGGGCTCCGGG - Intronic
1168573697 19:57490946-57490968 GCCCTGGCAGTCAGTGCCATTGG + Intronic
925193794 2:1907470-1907492 CCCCTGGCGGGGAAGGCCAAAGG + Intronic
928165738 2:28970623-28970645 TCCCTGGCGGTGAGGGCCATGGG + Intronic
934975492 2:98799424-98799446 TCCCTGGCTGCCAGGGCCAGGGG - Intronic
936572384 2:113627460-113627482 TCCCTAGCGGTGTGGGCGAGAGG + Intronic
937262515 2:120595588-120595610 TCCCTGTCTGTGAGGGCATTAGG + Intergenic
937322715 2:120970529-120970551 TTGATGGAGGTGAGGGCCATGGG - Exonic
938246365 2:129780544-129780566 CCCCTGGGGGTGCGGGCTATGGG - Intergenic
947793165 2:232879162-232879184 TCCCTGGGGGCCAGGGGCATGGG + Exonic
948615214 2:239194032-239194054 TCCCAGGTGGTGGGGGCCCTTGG - Intronic
948827450 2:240579515-240579537 TCCCTGGGTGTGAGGGGCAGTGG - Exonic
1173116798 20:40251395-40251417 TCCCTGGAGGTGTGTGCCACTGG + Intergenic
1173619988 20:44429536-44429558 CACCTGGCGGTGAGGGCTGTGGG - Exonic
1173843966 20:46176627-46176649 GAGCTGGCTGTGAGGGCCATGGG + Intronic
1174449046 20:50608797-50608819 TGCCTGGCAGGGAGGGCCCTGGG - Intronic
1174451770 20:50624986-50625008 TGCCTGGCGGTGCTGGCCACTGG + Intronic
1179990310 21:44944808-44944830 TACCAGGCGGTGAGGGGCAGAGG - Intronic
1182304559 22:29358919-29358941 GCCCTGGCAGTGCGGACCATGGG - Exonic
1185427805 22:50783419-50783441 TCCCTAGCGGTGTGGGCGAGAGG - Intronic
952339343 3:32432377-32432399 TGTCTGGGGGTCAGGGCCATGGG - Intronic
952383544 3:32822182-32822204 TCACTAGCGGTGAGGGGCAGTGG + Intronic
960670696 3:120153104-120153126 TCCCTGGGTGTGAGAGCTATGGG - Intergenic
967699054 3:192570225-192570247 TCCATGGGGGGGAGGGCCATAGG + Intronic
969494732 4:7520055-7520077 GCCCTGGTGATGAGGGCCCTTGG + Intronic
971268036 4:25111876-25111898 TCCCTGTAGGTGAGGTCCTTGGG - Intergenic
975335514 4:73170752-73170774 CCTCTGGTGGTGACGGCCATGGG + Intronic
979228072 4:118313211-118313233 ACCCTGGCGGCGAGGGACACAGG - Exonic
984256300 4:177393543-177393565 TCCCAGGCTGTGAGGGGCACAGG + Intergenic
985873260 5:2575703-2575725 TCACTGGCTGTGAGTTCCATGGG + Intergenic
985912476 5:2895312-2895334 ACCCTTGCTGTGGGGGCCATGGG - Intergenic
986212279 5:5685370-5685392 TTTCTGGCTGTGAGGGCCATGGG + Intergenic
992448014 5:76851141-76851163 TCCCAGGAGCTGAGGGGCATCGG + Intronic
997372592 5:133371307-133371329 CCTCTTGCGGTGAGGGCCTTGGG - Intronic
1001174842 5:169458694-169458716 TCCCTGGCGATAAGGGCTAAAGG - Intergenic
1005871937 6:29980892-29980914 TCCCTGGTGGGGAGGTCCGTGGG + Intergenic
1006298018 6:33178679-33178701 TCCCTGGAGAGAAGGGCCATAGG - Exonic
1007270054 6:40629500-40629522 GCCCTGCAGGTGAGGGCCATAGG - Intergenic
1011709410 6:90037078-90037100 TCCATGGTGGTGAGAACCATGGG + Intronic
1011768666 6:90652097-90652119 TCCCAGGCTGTGAAGGCCAAAGG - Intergenic
1013039319 6:106417978-106418000 TCTCTGCCGGTGAGGGCAAAAGG + Intergenic
1015127951 6:129775195-129775217 TCCCTGGAAGTGAGCGCCACTGG + Intergenic
1017603833 6:156112048-156112070 TCCCTGGCTGTCAGGGCCAGGGG - Intergenic
1019599038 7:1872322-1872344 TTCCTGGGGCTCAGGGCCATCGG - Intronic
1020577649 7:9954830-9954852 TCCTTGGTGGTGAGGGCTGTAGG + Intergenic
1023882503 7:44328266-44328288 TCCCTGGAGGTGAGGGGGACAGG - Intronic
1024075825 7:45817371-45817393 TCCCCAGGGGTGGGGGCCATGGG + Intergenic
1028845307 7:95473417-95473439 TGCCTGGCTGTGAGAGCCACAGG + Intergenic
1028851364 7:95541823-95541845 TCCCTAGCAGGGAGGGTCATTGG + Intergenic
1028979612 7:96953293-96953315 TCCCTGGGGGTTGGCGCCATGGG - Intergenic
1031997208 7:128240804-128240826 TCCCTGGCGTCCAGGGCCGTCGG + Intergenic
1034224746 7:149473869-149473891 CCCTGGGCAGTGAGGGCCATTGG - Exonic
1040414930 8:47187626-47187648 TCCCTGGGGGTAGGGGCCCTGGG + Intergenic
1045771304 8:105743327-105743349 ACCATGGGGGTGAGGGCCATGGG + Intronic
1049404928 8:142448091-142448113 TGACTGCCGTTGAGGGCCATGGG + Intergenic
1056656552 9:88514317-88514339 TCCCTGGCGGGCAGGGGCAGGGG + Intergenic
1057214211 9:93219111-93219133 TCCCTGGAGGGGAGGGGCATGGG + Intronic
1059703171 9:116795545-116795567 GCTCTGGGGGTGAGGGTCATGGG - Intronic
1060661915 9:125409395-125409417 TGCCTGGAGGTGGGGACCATAGG + Intergenic
1185612195 X:1399278-1399300 TGCCACGCGGTGAGGGCCACAGG + Intergenic
1187247677 X:17567600-17567622 TCCCTGGGGCTCAGGGGCATAGG - Intronic
1187363736 X:18650191-18650213 TCCCAGGCTGTCAAGGCCATTGG - Intronic
1188090098 X:25953343-25953365 TCCCTAGTGGTAAGGACCATAGG + Intergenic
1188995669 X:36882099-36882121 CCCCTTGAGGTGAGGGCCTTGGG - Intergenic
1191749804 X:64529458-64529480 GCCTTGGCAGTGAGGGCTATTGG + Intergenic
1192560214 X:72123429-72123451 TGCCTGGGGGTGGGGGCCGTGGG - Intergenic
1198420811 X:136469519-136469541 TCCCTGGGGGAAAGGGCCCTCGG - Intergenic