ID: 928166411

View in Genome Browser
Species Human (GRCh38)
Location 2:28975775-28975797
Sequence TCTAGCACACAGATCTAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 74}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928166404_928166411 21 Left 928166404 2:28975731-28975753 CCTCTTCTGTCTTCTTTTTTTGC 0: 1
1: 0
2: 5
3: 163
4: 1861
Right 928166411 2:28975775-28975797 TCTAGCACACAGATCTAGGTGGG 0: 1
1: 0
2: 3
3: 9
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928166411 Original CRISPR TCTAGCACACAGATCTAGGT GGG Intronic
904871764 1:33623851-33623873 TCCAGCAGACAGATCTGGGCAGG - Intronic
905918628 1:41703857-41703879 CCTTGCTCACAGATCTAGGCGGG + Intronic
907954723 1:59217193-59217215 CCTAGCTCACAGATCTAGCTAGG - Intergenic
910160058 1:84263042-84263064 TATAGCACACAGATATAGACAGG + Intergenic
922131604 1:222785949-222785971 TCTAGCACACACATCTATAGAGG + Intergenic
1063882256 10:10543109-10543131 TCTAGCAAACAGATGTCTGTTGG + Intergenic
1073720298 10:106161813-106161835 TTCATCACACAGATCTAGGAGGG - Intergenic
1073783479 10:106864431-106864453 TCTAACACACAGAGCTAAGTGGG + Intronic
1075907352 10:126093217-126093239 ACTAGCACAAAGTTCTAGTTTGG + Intronic
1078240866 11:9529889-9529911 GCTAGCAAACAGAACCAGGTGGG + Intergenic
1080380344 11:31764267-31764289 TCAAGCACACACAGCTAGTTTGG - Intronic
1081797103 11:45828191-45828213 TCTAGGACAGAGATGAAGGTCGG - Intergenic
1088348601 11:108859101-108859123 GCTAGCACTCAGATCCAGGTCGG + Intronic
1089300453 11:117495600-117495622 TCTAGCACACAGCTCTAGGGAGG + Intronic
1091788224 12:3256042-3256064 TCCTGCACCCAGATCTAGGCCGG + Intronic
1100826220 12:98477087-98477109 TCTAGCACACTGATATGGTTTGG + Intergenic
1102057554 12:109908024-109908046 TCTAGCACCCAGCTCTCCGTGGG + Intronic
1118878499 14:69805697-69805719 ACTAGGACACATCTCTAGGTTGG - Intergenic
1119447269 14:74676549-74676571 TCTAGCACACAGATAAAGAAGGG + Intronic
1123108152 14:105852538-105852560 TGCAGCACACAGACCAAGGTGGG + Intergenic
1128664389 15:69527638-69527660 CCAAGCACACAGATCTAGGGAGG + Intergenic
1134202692 16:12212000-12212022 TTTAACAGACAGATCTGGGTAGG - Intronic
1135137575 16:19896279-19896301 TCTTGCTCACAGCTCTGGGTGGG - Intergenic
1135913549 16:26582825-26582847 TTTCCCACACAGATGTAGGTAGG + Intergenic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1140928756 16:79607854-79607876 ACAAGCACACAAATCTAGGATGG - Intergenic
1141938911 16:87261343-87261365 CCTGGCACACAGATTTAGCTTGG - Intronic
1143600843 17:7944836-7944858 TCTAGAACACAGTTCTTGCTGGG - Intronic
1146775651 17:35612717-35612739 TCTGGGACTCAGAACTAGGTTGG - Intronic
1148175907 17:45564719-45564741 TTTAGCAAAGAGGTCTAGGTAGG + Intergenic
1150869872 17:68895626-68895648 TCTATTACACAGATCTGGGAAGG - Intronic
1151988547 17:77559257-77559279 CCTAGCACGCATCTCTAGGTGGG + Intergenic
1157230799 18:45914088-45914110 TCTTGCACACAGATCTTGCCTGG - Intronic
1158021143 18:52843356-52843378 TCTAGCATCCAAATATAGGTAGG - Intronic
1162125619 19:8498279-8498301 TCTACCCCACAGATCTACGGAGG - Exonic
1168237982 19:55075738-55075760 GCTGGCAGACAGATCTAGGAGGG - Intronic
927399755 2:22697290-22697312 TCTAGGAAACAGATCCAGGATGG + Intergenic
928000687 2:27520729-27520751 TCTAGCACCCAAATTGAGGTGGG + Intronic
928166411 2:28975775-28975797 TCTAGCACACAGATCTAGGTGGG + Intronic
933839160 2:86272548-86272570 TCTAGAACAGAGCTCTAGGGAGG - Intronic
947349348 2:229226245-229226267 ACTGGGCCACAGATCTAGGTGGG - Intronic
1169106565 20:3001151-3001173 CCTAGCTCACAGAGCTAGGAAGG - Intronic
1169976940 20:11339878-11339900 TCCAGGAAACAAATCTAGGTGGG - Intergenic
1179001848 21:37468491-37468513 TCTTGAACAGAGACCTAGGTAGG + Intronic
952690010 3:36194246-36194268 TCTAGGTCCCAGATATAGGTAGG + Intergenic
954646380 3:52134101-52134123 TTTAGCTCACAGGTCTAGGTAGG - Intronic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
956650345 3:71499079-71499101 TCTAGGACACAGAGCTGGGTGGG - Intronic
958966300 3:100562654-100562676 GCTAGCATACAGATTCAGGTTGG - Intronic
967139086 3:186538477-186538499 TTTGGCACAAAGATCTAGATTGG + Exonic
967552868 3:190819492-190819514 TCTTGTTCACAGACCTAGGTGGG - Intergenic
969870919 4:10104154-10104176 TCTATCACCCAGAGATAGGTAGG - Intronic
970176070 4:13340716-13340738 TCTAGCAAACAGATTTCTGTGGG - Intergenic
971937547 4:33171963-33171985 TTAAGCACACACAGCTAGGTGGG - Intergenic
972913189 4:43845019-43845041 TCTAGTACACATATCTATGAGGG + Intergenic
976405816 4:84659564-84659586 CCTAGCAGACAGATCCAGGAGGG - Intergenic
980207290 4:129736350-129736372 TATAGCATTCAGAACTAGGTAGG + Intergenic
982016505 4:151159657-151159679 TCTAGCACATAGATCTTGGTTGG - Intronic
982381405 4:154753044-154753066 CTTAGCTGACAGATCTAGGTTGG - Exonic
983814774 4:172109850-172109872 TGTAGCATACAAATCTTGGTGGG + Intronic
986422849 5:7601427-7601449 TCTGGCACTAAGATTTAGGTAGG + Intronic
990869697 5:60417304-60417326 TCAAGCAGACAGATGTAGGCTGG - Intronic
993024644 5:82631352-82631374 TCTAGGATAGAAATCTAGGTTGG - Intergenic
994601002 5:101904965-101904987 TCTGGCACACAGATCTCATTTGG - Intergenic
1003490709 6:6619175-6619197 TTTATCAAACAGATCTAGTTGGG - Intronic
1007304892 6:40896141-40896163 TCTAGCACCCAGCTCAAGATTGG - Intergenic
1009275742 6:61676889-61676911 TCTTGCAGACATATGTAGGTAGG + Intergenic
1011370846 6:86634771-86634793 TCTGACACACAGAGCTACGTGGG - Intergenic
1017768819 6:157628988-157629010 TCTTGCACACAAATCTATATAGG + Intronic
1020151183 7:5682970-5682992 TCCATCACACAGATTTATGTTGG - Intronic
1026358080 7:69577264-69577286 TCTAGAACACATATTTTGGTTGG + Intergenic
1027685250 7:81272468-81272490 TCTAGCACATTGATCATGGTTGG - Intergenic
1028957278 7:96708165-96708187 TCTACGACACAGCTCTATGTTGG + Intronic
1036659532 8:10699123-10699145 TCTAGCACACGGAGCAGGGTGGG + Intronic
1038464799 8:27751660-27751682 TGTAGAACACAGGTCTAGATCGG - Intronic
1038469804 8:27805606-27805628 CCTACCACCCAGATCTTGGTTGG + Intronic
1044615053 8:94131482-94131504 TCAAACACACATATTTAGGTTGG + Intronic
1045079601 8:98610732-98610754 TCTAGCACAGAGATGTAGCATGG + Intronic
1046993681 8:120490044-120490066 TCCAGCACATTTATCTAGGTTGG + Intronic
1047726749 8:127690595-127690617 TGTAGCACCTAGATCAAGGTAGG + Intergenic
1049466417 8:142752990-142753012 TCCAGCACACAGATCTGCCTTGG - Intergenic
1050736488 9:8769033-8769055 GCTAACACACAGAATTAGGTGGG - Intronic
1051286314 9:15500824-15500846 TCTAAGATACAGAACTAGGTAGG + Intronic
1057345207 9:94244353-94244375 TATAGCACACAGGTCTTGGTGGG - Intergenic
1058197158 9:101991779-101991801 TTTATCACACAGATATAGGAAGG + Intergenic
1058606205 9:106726240-106726262 TCTAGCACACAGCTCTGGTTTGG + Intergenic
1193959389 X:87905654-87905676 TCTAGCACACCGATATGGTTTGG + Intergenic