ID: 928170395

View in Genome Browser
Species Human (GRCh38)
Location 2:28999498-28999520
Sequence GCCCTTGACCTGGAAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 239}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928170395_928170403 0 Left 928170395 2:28999498-28999520 CCACCCACTTCCAGGTCAAGGGC 0: 1
1: 0
2: 1
3: 17
4: 239
Right 928170403 2:28999521-28999543 CGCAGGCCTCCAGGGCTGTGAGG 0: 1
1: 0
2: 3
3: 37
4: 359
928170395_928170410 28 Left 928170395 2:28999498-28999520 CCACCCACTTCCAGGTCAAGGGC 0: 1
1: 0
2: 1
3: 17
4: 239
Right 928170410 2:28999549-28999571 CAGGCTTCCAGGTGGCATGCTGG 0: 1
1: 1
2: 1
3: 30
4: 257
928170395_928170407 9 Left 928170395 2:28999498-28999520 CCACCCACTTCCAGGTCAAGGGC 0: 1
1: 0
2: 1
3: 17
4: 239
Right 928170407 2:28999530-28999552 CCAGGGCTGTGAGGGTCAGCAGG 0: 1
1: 0
2: 2
3: 59
4: 425
928170395_928170401 -8 Left 928170395 2:28999498-28999520 CCACCCACTTCCAGGTCAAGGGC 0: 1
1: 0
2: 1
3: 17
4: 239
Right 928170401 2:28999513-28999535 TCAAGGGCCGCAGGCCTCCAGGG 0: 1
1: 0
2: 2
3: 22
4: 145
928170395_928170411 29 Left 928170395 2:28999498-28999520 CCACCCACTTCCAGGTCAAGGGC 0: 1
1: 0
2: 1
3: 17
4: 239
Right 928170411 2:28999550-28999572 AGGCTTCCAGGTGGCATGCTGGG 0: 1
1: 1
2: 9
3: 39
4: 283
928170395_928170400 -9 Left 928170395 2:28999498-28999520 CCACCCACTTCCAGGTCAAGGGC 0: 1
1: 0
2: 1
3: 17
4: 239
Right 928170400 2:28999512-28999534 GTCAAGGGCCGCAGGCCTCCAGG 0: 1
1: 0
2: 1
3: 9
4: 124
928170395_928170404 1 Left 928170395 2:28999498-28999520 CCACCCACTTCCAGGTCAAGGGC 0: 1
1: 0
2: 1
3: 17
4: 239
Right 928170404 2:28999522-28999544 GCAGGCCTCCAGGGCTGTGAGGG 0: 1
1: 0
2: 44
3: 530
4: 1343
928170395_928170408 17 Left 928170395 2:28999498-28999520 CCACCCACTTCCAGGTCAAGGGC 0: 1
1: 0
2: 1
3: 17
4: 239
Right 928170408 2:28999538-28999560 GTGAGGGTCAGCAGGCTTCCAGG 0: 1
1: 0
2: 1
3: 17
4: 229
928170395_928170409 20 Left 928170395 2:28999498-28999520 CCACCCACTTCCAGGTCAAGGGC 0: 1
1: 0
2: 1
3: 17
4: 239
Right 928170409 2:28999541-28999563 AGGGTCAGCAGGCTTCCAGGTGG 0: 1
1: 0
2: 1
3: 43
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928170395 Original CRISPR GCCCTTGACCTGGAAGTGGG TGG (reversed) Intronic
900147698 1:1165590-1165612 GCCCTGAACCTGGCAGTGGGAGG + Intergenic
900547375 1:3236374-3236396 GTCCTTGACCTGGAAGTCACAGG - Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
901606773 1:10465348-10465370 TCACTTGACCTGGGAGGGGGAGG - Intronic
901828918 1:11880359-11880381 GCCCTTGGCCCAGCAGTGGGTGG + Intergenic
902324252 1:15688564-15688586 GCACTTGACCTGGGAGGTGGAGG + Intronic
902575055 1:17372425-17372447 CCCCTTGATCTGGGAGTTGGGGG + Intronic
904833700 1:33321324-33321346 GCCAATCACCTGGAAGAGGGTGG + Intergenic
905207408 1:36350809-36350831 GCCCGTGCCCTGGCAGAGGGTGG - Intronic
905946101 1:41902467-41902489 CACCTTGCCCTGGCAGTGGGGGG - Intronic
906579047 1:46919829-46919851 ACACTGGAACTGGAAGTGGGTGG - Intergenic
907283090 1:53363398-53363420 ACCCATGGCCTGGAAGTAGGGGG - Intergenic
907304793 1:53507465-53507487 GCCCTTGACTTGGGAGGGGCCGG + Intronic
911187148 1:94915668-94915690 GCCCTTGATCTGGAAGGGATGGG - Intronic
914900705 1:151709688-151709710 GCCCTGGGCCTGGGGGTGGGAGG + Intronic
915107418 1:153543100-153543122 GCCAATGATCTGGAAGTGGGTGG + Intergenic
915165787 1:153946944-153946966 GCCCTAAACCTGGAAGTAGGGGG - Intergenic
916735273 1:167601872-167601894 GCCTTTGATCTGCAGGTGGGAGG + Intergenic
918209626 1:182339450-182339472 GCCCCTGTCCTGGAAGGGAGAGG + Intergenic
919834745 1:201565977-201565999 AGCCTTGACATGGAAGAGGGTGG - Intergenic
923659210 1:235944071-235944093 GGCCTGGACCTGGATCTGGGAGG + Intergenic
924786722 1:247206188-247206210 GCCCTTGACTTGGCTGTGGAAGG - Intergenic
1064702470 10:18036172-18036194 GCCCTGAAGCTGGAACTGGGTGG - Intronic
1067573330 10:47387388-47387410 GCCCCTGCCCTGGAAGTCTGTGG - Intergenic
1069777939 10:70937703-70937725 GCCCTAGACCAGGGTGTGGGAGG + Intergenic
1069842493 10:71348517-71348539 GCCCTTATCTTGGGAGTGGGTGG + Intronic
1071806239 10:89124191-89124213 TTCCTTTACCTGGAAGTGAGAGG - Intergenic
1073324109 10:102632652-102632674 GCCCCTGACCTTGTAGTGGGTGG + Exonic
1076111917 10:127866371-127866393 GCGATTGTCCTGGAAGTGGGAGG - Intergenic
1076250777 10:128982392-128982414 TCCTGTGACCTGGAGGTGGGGGG + Intergenic
1076994745 11:292456-292478 GCCCTCGCCCTGGAGGAGGGGGG - Intronic
1077349429 11:2085628-2085650 GGCCTAGACCAGGCAGTGGGTGG + Intergenic
1077635636 11:3840163-3840185 GCCCTGTAACTGGAAGTGGAAGG - Intronic
1078511638 11:11988624-11988646 CCCCTTTACAGGGAAGTGGGAGG + Intronic
1081654072 11:44845803-44845825 ACAGTTGACATGGAAGTGGGTGG + Intronic
1082711079 11:56554552-56554574 GCCCTGAAGCTGGAACTGGGTGG - Intergenic
1083818391 11:65151002-65151024 GCCCGTGCCCTGGCAGAGGGAGG - Intergenic
1084428273 11:69097397-69097419 GCCCCTCACCTGGCAATGGGAGG - Intergenic
1084632757 11:70365331-70365353 TCCCTTGCCCTGGATGTGGTTGG + Intronic
1085249208 11:75131144-75131166 GCCCATGACGTGGAAGTCGAGGG + Intronic
1085387019 11:76163332-76163354 CCCTTTGTCCTGGAAGTGGAAGG + Intergenic
1085460725 11:76691680-76691702 GCCCTTCCCCTGGAAGAGAGAGG + Intergenic
1085633425 11:78139102-78139124 GTCCTTGCCCTCGAAGTTGGTGG - Intronic
1087378379 11:97372338-97372360 GGCATTGACCAGGAAGTGGAGGG + Intergenic
1088341557 11:108773852-108773874 GCCCTTGAACTGCTAGTAGGAGG + Intronic
1089366336 11:117923223-117923245 ACCCCTGGGCTGGAAGTGGGGGG - Intronic
1091322660 11:134663108-134663130 GCCTCTGACCTGAAGGTGGGAGG - Intergenic
1091760790 12:3085821-3085843 GCCTCTGACCTGGAGGTGGATGG + Intronic
1092209917 12:6639432-6639454 CCCCTTGATCTGGAATGGGGAGG - Intronic
1092911480 12:13148821-13148843 TCGCTTGACCTGGAGGTGAGGGG + Intergenic
1093363366 12:18260443-18260465 GAGCTTGACCTAGAAGTGGAGGG - Intronic
1093661917 12:21767317-21767339 GTCCCTGGCCTGGAGGTGGGGGG - Intronic
1096519951 12:52179361-52179383 GCACTTGGCCTGGCTGTGGGGGG + Intronic
1096909081 12:54963815-54963837 GCCCTTGGCCTGAGAGGGGGTGG + Exonic
1098181574 12:67852686-67852708 GCCCTTGGCCTGGATGTTGCTGG + Intergenic
1102676662 12:114664124-114664146 ACCCTTGATCTTGAGGTGGGAGG + Intergenic
1102816223 12:115868540-115868562 TCCCTGGTCCTGGAGGTGGGAGG + Intergenic
1103336964 12:120196926-120196948 GGCCTTGACCTGAAAGGAGGGGG + Exonic
1103728420 12:123010610-123010632 GCCCTTGAACAAGAGGTGGGGGG + Intronic
1104124946 12:125837621-125837643 GACCTTCACCATGAAGTGGGCGG - Intergenic
1105306578 13:19173220-19173242 TCACTTGAAGTGGAAGTGGGAGG + Intergenic
1108075994 13:46680308-46680330 GCACTCCACCTGGCAGTGGGAGG + Intronic
1111070620 13:83161198-83161220 GCCCTTGATCTGGCAGGAGGTGG - Intergenic
1111437834 13:88235234-88235256 TCCCTTGAACTGGAAGGCGGAGG + Intergenic
1113800758 13:113085266-113085288 GCCCTTGGCCTGGGAGGGGCAGG - Intronic
1114455799 14:22852864-22852886 GCCCTTAATCTGGGAGTGGTTGG + Intergenic
1117226330 14:53664016-53664038 GCCTCTGTCCTGGAAGTGGCTGG - Intergenic
1117368909 14:55058003-55058025 GACCCTGAACTGGAAGAGGGAGG - Intronic
1118309246 14:64680576-64680598 GCCCTGGAACTGGTAGAGGGAGG + Intergenic
1119800696 14:77442449-77442471 GCCCTTTTCCTGGAAGTGCTTGG - Intronic
1120781729 14:88491439-88491461 GCCCCTGGCCTGGAACTGGACGG - Intronic
1122909963 14:104822729-104822751 GCCCTTCACCTAGAAGCAGGAGG - Intergenic
1128216779 15:65939813-65939835 AAACTTGCCCTGGAAGTGGGAGG - Intronic
1129320175 15:74770372-74770394 GTCCTGGACCTTGAGGTGGGAGG - Intergenic
1129729546 15:77922124-77922146 TCCCCAGACCTGGAAGTGGTAGG + Intergenic
1130955807 15:88626521-88626543 GCCCTTGCCCAGCAAGTGTGTGG + Exonic
1131264307 15:90906636-90906658 GCTCTTGTCCTGGTAGTGAGTGG - Intronic
1131337321 15:91561846-91561868 GCCCATGACCTCGAAAAGGGAGG + Intergenic
1132613359 16:828618-828640 GCCCCTGACCTGGGAGTCTGGGG + Intergenic
1133221390 16:4320569-4320591 GCCCTTGCAGTGGACGTGGGGGG - Intronic
1133296075 16:4752936-4752958 GCCTCTGACCTGGGAGCGGGTGG + Exonic
1134524780 16:14935145-14935167 GCCCTTGTCCTGCAGGTGGCTGG + Intronic
1134712369 16:16333632-16333654 GCCCTTGTCCTGCAGGTGGCTGG + Intergenic
1134954458 16:18375062-18375084 GCCCTTGTCCTGCAGGTGGCTGG - Intergenic
1136228109 16:28872376-28872398 GGCCTTGCCCTGGAAGTTGAAGG - Exonic
1136455597 16:30378226-30378248 GCCCCGGGCCGGGAAGTGGGCGG + Exonic
1137222695 16:46471644-46471666 GACCTTTTCCTGGCAGTGGGTGG + Intergenic
1137284491 16:47003757-47003779 GCGCTTGACCTGGGAGGTGGAGG + Intergenic
1138184746 16:54967889-54967911 CTGCTTGACCTGTAAGTGGGTGG + Intergenic
1138374393 16:56552858-56552880 TCGCTTGACCTGGAAGGTGGAGG - Intergenic
1138458556 16:57134692-57134714 AGCCTTGGCCTGGCAGTGGGTGG + Intronic
1139696647 16:68679960-68679982 GGCCTGGACCGGGAAGTGAGTGG + Exonic
1140046434 16:71442872-71442894 GCCCTGGGCCTGGAAGGGGGAGG - Intergenic
1141754688 16:85983322-85983344 ACCATTGACCTGGAAGGTGGGGG + Intergenic
1143118250 17:4592530-4592552 GCCCTTGGCCTGGCATCGGGGGG + Intronic
1143915905 17:10292685-10292707 GAACTTGACCTAGTAGTGGGAGG + Intergenic
1144949901 17:18988551-18988573 GCCCGGGACCAGGAAGTGAGGGG + Intronic
1146229469 17:31095242-31095264 GCCCTGGGCCGGGAAGAGGGCGG - Exonic
1146305479 17:31726812-31726834 CCCCTCTTCCTGGAAGTGGGAGG - Intergenic
1147008866 17:37427606-37427628 GCCCTGGCCATGGGAGTGGGTGG + Intronic
1149076580 17:52602522-52602544 GTCAGTGACCTGGGAGTGGGAGG - Intergenic
1149557904 17:57587322-57587344 ACCCTTGACCTTGAAATGTGAGG - Intronic
1149839440 17:59946148-59946170 GCCCTTTTCCTGGAAGTGAAAGG + Intronic
1149914816 17:60599694-60599716 ACCCTTGAGCTGGATCTGGGTGG - Intergenic
1149943518 17:60897046-60897068 GCCCTAAACCTGGAAGTGAAAGG - Intronic
1149998152 17:61415781-61415803 GCCCAGGACCTGGGGGTGGGGGG - Intergenic
1151583387 17:74992869-74992891 GACACTAACCTGGAAGTGGGGGG + Intronic
1152670350 17:81600492-81600514 GACCTAGAGCTGGAAGTGGAAGG - Intronic
1154079740 18:11244168-11244190 GCACTTGACCTGGCTCTGGGAGG + Intergenic
1155069514 18:22301901-22301923 GCTCTTGAGCTGAAAGTGAGGGG - Intergenic
1155150781 18:23121331-23121353 GCCCTGGACCCGTAAGTGGGCGG - Intergenic
1155172206 18:23275364-23275386 GCCTTGGACCTGAAACTGGGCGG + Intronic
1156438344 18:37157722-37157744 TCACTTGACCTGGAAGGTGGAGG + Intronic
1157518865 18:48330978-48331000 ACCCTTGACCTGAAAGTCTGGGG - Intronic
1161395770 19:4044152-4044174 GGTCTTCCCCTGGAAGTGGGCGG - Intergenic
1163582175 19:18145484-18145506 GCCCTTGGGCTGGGAGAGGGAGG - Intronic
1165071252 19:33256127-33256149 GCCCTGGATCTTGAAGTGTGTGG + Intergenic
1165309310 19:35021064-35021086 GCCCTTGACCCAGATGGGGGCGG + Intronic
1165692134 19:37871795-37871817 TCGATTGACCAGGAAGTGGGAGG - Intergenic
1165948213 19:39458031-39458053 GCACTGGCCCAGGAAGTGGGGGG - Intronic
1166571257 19:43798468-43798490 GCCATTGCCCTGGAAGCAGGCGG + Exonic
1168261323 19:55196674-55196696 GCCTTTGAGTTGGAGGTGGGAGG - Exonic
925095567 2:1196882-1196904 GCCCTACACCTGGAAGTGAAAGG + Intronic
925414427 2:3659506-3659528 TCCCTTGAGCAGGCAGTGGGAGG + Intronic
925638486 2:5965211-5965233 GCCCTTGGCCTGGATGGGAGGGG + Intergenic
926060809 2:9803493-9803515 GTCCCTTACCTGCAAGTGGGTGG - Intergenic
926703100 2:15817252-15817274 TCCCTTCACCTAGAAGAGGGTGG - Intergenic
927810041 2:26175565-26175587 CCCCTTGACAAGGCAGTGGGTGG + Intronic
927841565 2:26448377-26448399 GCCATGAACCAGGAAGTGGGAGG - Intronic
927892272 2:26759093-26759115 GCCCTTGGCCTGGACGTGTGGGG + Intergenic
928170395 2:28999498-28999520 GCCCTTGACCTGGAAGTGGGTGG - Intronic
929429913 2:41878358-41878380 GCCCTTGACATGGATGGGGAAGG - Intergenic
929565284 2:42979966-42979988 GACCTGGCCCTGCAAGTGGGTGG + Intergenic
931243770 2:60476135-60476157 GACCTTGACCTGGATGAGGAGGG + Intronic
933832466 2:86222009-86222031 GCCCTGGACCTGGATGTGGAGGG - Intronic
936716368 2:115191627-115191649 GCCCATGACTTGGGAGGGGGCGG + Intronic
937279462 2:120707423-120707445 GACCTGGAGCTTGAAGTGGGAGG + Intergenic
937322309 2:120968250-120968272 GCCCTTGGGCTGGAAGATGGAGG + Intronic
937504186 2:122517766-122517788 CCTCATGACCTGGAAGTGAGGGG + Intergenic
937508489 2:122564817-122564839 TCACCTGGCCTGGAAGTGGGGGG - Intergenic
939650046 2:144748522-144748544 ACCCTTGAGCTGCAAGTGCGTGG + Intergenic
941185936 2:162321563-162321585 GCTCTTAACCTGGCAGTGTGGGG + Intronic
944409525 2:199425277-199425299 GCCCATGACCTGGAAGGGACTGG - Intronic
946137130 2:217656651-217656673 GCCCTTGACCTGGAAGTTCTAGG + Intronic
1169029184 20:2394981-2395003 CTCCTTGGCCTGGAAGTGGCTGG + Intronic
1170023361 20:11861885-11861907 CCCCTTGAAATGGAAGAGGGTGG - Intergenic
1172782810 20:37447342-37447364 GGCCCTGGGCTGGAAGTGGGAGG - Intergenic
1174158807 20:48535704-48535726 GCCTGGGACCTGGAAGTGTGAGG - Intergenic
1175133584 20:56807149-56807171 GCCTGTGCCCTGCAAGTGGGCGG - Intergenic
1175182528 20:57158682-57158704 AACCTTGACCTGAAAGTGGGAGG + Intergenic
1175388270 20:58610958-58610980 GCCCTGGACTGGGAAGTGGCGGG - Intergenic
1176140779 20:63544158-63544180 GCCCTTGACCTTGGGGTGGTTGG - Intronic
1177510405 21:22079564-22079586 TCGCTTGACCTGGAAGGCGGAGG + Intergenic
1179510393 21:41869124-41869146 ACCCTTAAACTGGGAGTGGGAGG - Intronic
1180082921 21:45494798-45494820 GCCCTTGACCACGAGTTGGGGGG - Intronic
1180083007 21:45495064-45495086 GCTCTTGTCCTGGATGTGGCTGG + Intronic
1180796630 22:18608961-18608983 TCCCTGGCCCTGGAAATGGGGGG - Exonic
1181225094 22:21386310-21386332 TCCCTGGCCCTGGAAATGGGGGG + Exonic
1181253538 22:21548503-21548525 TCCCTGGCCCTGGAAATGGGGGG - Exonic
1181444697 22:22960029-22960051 GCCCTTGACTGGGAGCTGGGTGG - Intergenic
1181514214 22:23402147-23402169 GCCCTTGGACTGGGAGGGGGCGG + Intergenic
1182422970 22:30257521-30257543 GCCCTTCAACTGGAGGTGGGGGG - Intergenic
1182488326 22:30653164-30653186 GGCCTTGACCTGCCAGTGGTGGG - Intronic
1183304736 22:37076539-37076561 GCCCATGCCCTGGAGATGGGAGG - Intronic
1183828919 22:40407860-40407882 GCTCTTGAGCTGGGAGAGGGAGG + Intronic
1184115817 22:42421575-42421597 GCCCATGACTTGGTGGTGGGAGG - Intronic
1184145912 22:42610407-42610429 TCCTTGGAGCTGGAAGTGGGAGG - Intronic
1184250558 22:43257911-43257933 GTCCTCGTCCTGGAAGTGAGGGG - Intronic
1184412919 22:44336302-44336324 GCCCTTCACCTGCCACTGGGTGG + Intergenic
1184682155 22:46078324-46078346 GCCCTTCTCCTGGCAGTGCGGGG - Intronic
1185413322 22:50697251-50697273 GCCCTGGACCTGGAGGGGTGGGG + Intergenic
950582217 3:13870020-13870042 GCCCTTGATCTGGGACTTGGAGG - Intronic
952136361 3:30426486-30426508 GCCCTTGACTGGGAGCTGGGAGG + Intergenic
952820422 3:37481560-37481582 GCCTTTGGCCTGGAGGTTGGAGG - Exonic
954688823 3:52385082-52385104 GCCCACGACGTTGAAGTGGGTGG + Intronic
954806000 3:53221059-53221081 GCCCTGGACCTGGACGTGTGTGG + Intergenic
954921120 3:54191926-54191948 CCCCTGAACCGGGAAGTGGGGGG + Intronic
955016780 3:55077909-55077931 GACAGTGGCCTGGAAGTGGGAGG - Intergenic
955022752 3:55136810-55136832 GCCCTTAAGCTCGAACTGGGTGG + Intergenic
960473173 3:118093119-118093141 GCCCTGTGCCTGGCAGTGGGGGG - Intergenic
960900656 3:122551118-122551140 GACGTTGACCTGGAAGGGGCAGG - Intronic
961671187 3:128532630-128532652 GCCTTTGTCCTACAAGTGGGGGG + Intergenic
962113729 3:132478648-132478670 GTGGTTCACCTGGAAGTGGGAGG + Intronic
967188232 3:186963677-186963699 GCCCCGGAGCTGGCAGTGGGAGG + Intronic
967825918 3:193877288-193877310 GCCCCTGAGCAGAAAGTGGGAGG + Intergenic
967840758 3:194003142-194003164 GCCCTTCCCCTGGGAGCGGGAGG - Intergenic
968298111 3:197592836-197592858 ATCCTGGCCCTGGAAGTGGGGGG + Intergenic
968437645 4:602421-602443 GCCCTTGACGGGGACATGGGTGG - Intergenic
968881724 4:3303581-3303603 GAGCTTGCCCTGGTAGTGGGGGG + Intronic
969364133 4:6684344-6684366 GCGCTTGTCCTGGAGGTGTGCGG - Intergenic
969456939 4:7305695-7305717 TCCCTAGACCTGGGAGTGGACGG - Intronic
970667004 4:18348200-18348222 GCTCTTGACCGGTAACTGGGGGG - Intergenic
978371715 4:108035998-108036020 GCCCTTGTCCTGGAAATGGCAGG + Intergenic
982131635 4:152233967-152233989 GCCCTTGACCTGGAAATGGCTGG + Intergenic
983213012 4:164977663-164977685 GCAGTTGCCCCGGAAGTGGGCGG + Exonic
983769006 4:171524693-171524715 GCACTTGATCTGGAAGCGAGTGG + Intergenic
985643629 5:1074943-1074965 GCCCATGACAGGGAAGTGGCTGG + Intronic
985690919 5:1311808-1311830 GTCATTGCCATGGAAGTGGGTGG + Intergenic
986164711 5:5263785-5263807 GCCCCTGACCCTGTAGTGGGGGG + Intronic
989498172 5:42133578-42133600 GCCCTAAACCTGGAAGTGAAAGG + Intergenic
991404880 5:66292146-66292168 ACCATTGACCTGGGGGTGGGAGG - Intergenic
993019568 5:82575507-82575529 GCTCTTGAGCTGGGTGTGGGAGG - Intergenic
993957841 5:94258350-94258372 TCCCCTAACCTGAAAGTGGGAGG + Intronic
996168709 5:120260796-120260818 GCCCTTGACTGGGAACTGGGAGG + Intergenic
998160313 5:139809377-139809399 CCTCTAGACCTGGCAGTGGGTGG - Exonic
998204828 5:140150985-140151007 GCCCCTGAGCTGGGAGAGGGAGG + Intergenic
999312808 5:150562776-150562798 GACCTTGAAATGGAAGTGGTGGG + Intergenic
999627269 5:153534006-153534028 TGCATTGGCCTGGAAGTGGGGGG - Intronic
999715372 5:154355954-154355976 GTCTATGACCTGGAAGAGGGAGG - Intronic
1003595658 6:7471986-7472008 TCCCTTGACCTCCAAGTGGCAGG + Intergenic
1004348109 6:14866897-14866919 TCCCTGGACATGGGAGTGGGGGG - Intergenic
1004453032 6:15765184-15765206 CACCATGACCTGGAAGTGTGTGG - Intergenic
1005825006 6:29627460-29627482 GCCCTGGACATGGGGGTGGGTGG - Intronic
1007593766 6:43038985-43039007 GACCTGGACCAGGAAGGGGGAGG + Exonic
1007627698 6:43255538-43255560 GCCCATCTCCTGGAGGTGGGGGG - Exonic
1007640744 6:43337600-43337622 GCCCTTGACCTGTTAGCAGGAGG - Exonic
1014953594 6:127588956-127588978 GCCCTATACTTGGAAGTGGTAGG - Intronic
1016177521 6:141098707-141098729 GCCCTTGACCTAGAAATTTGTGG + Intergenic
1017519560 6:155189900-155189922 GCCATGGACCTGGAGGTGTGTGG + Intronic
1017764804 6:157597797-157597819 GGCCATGTCCTGGATGTGGGAGG - Intronic
1018008412 6:159645566-159645588 TCGCTTGACCTGGGAGGGGGAGG - Intergenic
1018440874 6:163812071-163812093 GCCCTTCACATTGAAGAGGGTGG - Intergenic
1019365402 7:630174-630196 GCCCTGGTCCTGGAAGGGGGAGG - Intronic
1019898322 7:4000157-4000179 GGCCTGGACGTGGAAGTAGGAGG + Intronic
1020007519 7:4790389-4790411 GCCCTTGGCCTGGATGGGGATGG + Intronic
1020339961 7:7099600-7099622 GCAAATGACCTGCAAGTGGGAGG - Intergenic
1023607344 7:41942591-41942613 CCCCTTGACCCGGAGGTAGGAGG - Intergenic
1029256993 7:99276304-99276326 GCCCTAGACATGGATTTGGGAGG - Intergenic
1029714222 7:102317370-102317392 GGCCTTGCCCTGGAAGTTGAAGG - Exonic
1031044908 7:116876719-116876741 GTTCTTGCCCTGGAATTGGGAGG + Intronic
1031668143 7:124510896-124510918 GTCATTGCCATGGAAGTGGGTGG + Intergenic
1035037997 7:155907912-155907934 GACTTTGACCTTGAAGTGTGTGG + Intergenic
1037680830 8:21096135-21096157 CTCCGTGACCTGGAAGTTGGAGG + Intergenic
1037821540 8:22137493-22137515 CTCCTTGACCTGGAAGCCGGGGG + Intergenic
1038038695 8:23706554-23706576 GTCCTTGACCGAGAAGGGGGTGG + Exonic
1041967299 8:63694246-63694268 GTCTTTCACCTGGAAATGGGGGG + Intergenic
1048211417 8:132457442-132457464 ACCCTTTATATGGAAGTGGGAGG - Intronic
1049063071 8:140291502-140291524 GCAGTTGACCTGGGAGTGGGTGG - Intronic
1049725429 8:144143470-144143492 GCGCTTGCCCTGCAGGTGGGAGG + Intergenic
1049791757 8:144475514-144475536 GGCTTGAACCTGGAAGTGGGTGG + Intronic
1050412779 9:5383741-5383763 GCCCTTGATCTGGCAGGAGGTGG + Intronic
1051456886 9:17268686-17268708 GCCCTGAAGCTGGAACTGGGTGG - Intronic
1057776041 9:98010513-98010535 GCCTATGACCTGGCATTGGGAGG + Intronic
1058163413 9:101594664-101594686 GCCCTTGACGCTGAACTGGGAGG + Exonic
1059436069 9:114277150-114277172 GAACTTGACTTGGTAGTGGGGGG + Intronic
1060078549 9:120618506-120618528 TCCCTTAAAATGGAAGTGGGGGG - Intronic
1061008669 9:127942705-127942727 TCCCTTGCCCTGGTGGTGGGGGG - Exonic
1061225719 9:129279767-129279789 GCCCATGGCCTGGGAGGGGGTGG + Intergenic
1061488856 9:130934246-130934268 GCCCTGGCCCTGGCAGAGGGAGG + Intronic
1062581184 9:137229955-137229977 GCCCTTGCTCTGGGGGTGGGGGG - Intergenic
1062674268 9:137731170-137731192 ATCCGTAACCTGGAAGTGGGTGG + Intronic
1185735075 X:2490057-2490079 GCCCAGGCCCAGGAAGTGGGCGG + Exonic
1188934784 X:36160930-36160952 TCGCTTGACCTGGAAGGTGGAGG - Intergenic
1190597633 X:52063917-52063939 GCCTCTGACCTGGGAGTGAGTGG - Intronic
1190611191 X:52190156-52190178 GCCTCTGACCTGGGAGTGAGTGG + Intronic
1191254338 X:58273344-58273366 GCACTTGACCGGGGTGTGGGGGG - Intergenic
1192845614 X:74904151-74904173 GCCCTTGCCTTGTAAGTGGAGGG + Intronic
1196998716 X:121414382-121414404 GCCTTAAACCTGGAAGTGAGGGG - Intergenic