ID: 928174033

View in Genome Browser
Species Human (GRCh38)
Location 2:29022216-29022238
Sequence GATGGATCTTAGAGCCTGTA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928174026_928174033 24 Left 928174026 2:29022169-29022191 CCTGCGGTGCTCACGTTGGGGTC 0: 1
1: 0
2: 0
3: 2
4: 42
Right 928174033 2:29022216-29022238 GATGGATCTTAGAGCCTGTAAGG 0: 1
1: 0
2: 0
3: 5
4: 81
928174031_928174033 0 Left 928174031 2:29022193-29022215 CCTGAATGGGAAGAAGAGGAGGA 0: 1
1: 0
2: 7
3: 60
4: 554
Right 928174033 2:29022216-29022238 GATGGATCTTAGAGCCTGTAAGG 0: 1
1: 0
2: 0
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928174033 Original CRISPR GATGGATCTTAGAGCCTGTA AGG Exonic
901017594 1:6240994-6241016 GAGGGCTCTTAGAGCCTCCAAGG - Intergenic
906896326 1:49777096-49777118 GCTGGAGCTTAGAGATTGTAGGG + Intronic
912410847 1:109479823-109479845 GCTGGTTCTCAGAGACTGTAAGG - Exonic
921793586 1:219317861-219317883 TATGGATCTTAAAGGCTGCAAGG - Intergenic
921952945 1:220951270-220951292 GATGGATCTTATAATATGTAAGG + Intergenic
924439814 1:244076859-244076881 GAGGGATTTTAGAGCCAGAAGGG + Intergenic
924681190 1:246235777-246235799 GAGAGAGCTTAGAGCTTGTAGGG - Intronic
1066358961 10:34712157-34712179 GATGGATCTAAGAGTGTGGAAGG + Intronic
1071489949 10:86129470-86129492 GATGGAGCTTTGAGCCTGTGGGG - Intronic
1075327517 10:121546264-121546286 TATGGTTCTCAGAGCCTGAAGGG + Intronic
1078386631 11:10898735-10898757 GATGGGGCTCAGAGCCTGTGGGG - Intergenic
1079116137 11:17641749-17641771 GAGGGATCCCAGAGCCTGGAAGG - Intronic
1087055946 11:93936483-93936505 GATGGATTTTAGAGTGTTTAGGG + Intergenic
1088595042 11:111435106-111435128 GATGGATTTTAGATCCTCCAGGG - Intronic
1090532770 11:127608241-127608263 GATGGATCTTAGAGTATCTTGGG + Intergenic
1092275534 12:7058229-7058251 CAGGGACCCTAGAGCCTGTAGGG - Intronic
1092625333 12:10321042-10321064 GACAGAACTAAGAGCCTGTAAGG + Intergenic
1094332614 12:29312021-29312043 CATGGAGCTTAGAGCTTATATGG + Intronic
1108143654 13:47453269-47453291 AATGCATCTTAGTTCCTGTAAGG + Intergenic
1110119987 13:71867653-71867675 GATGGATCCTAAATCCTGGAAGG - Intergenic
1112648671 13:101366291-101366313 AATGGAACTTAGTTCCTGTAAGG - Intronic
1120792151 14:88594425-88594447 GATGGTACTTAGAGGATGTAGGG + Intronic
1125207217 15:37167370-37167392 GATGGGTCTGTGAGCCTGTTAGG + Intergenic
1127992734 15:64132805-64132827 GATGCCTCATAGAGCCTGGAAGG + Intronic
1128277984 15:66370270-66370292 GCTGGATCTGACATCCTGTATGG + Intronic
1128966627 15:72065163-72065185 GATGGATCATAGACCATGAAAGG + Intronic
1131541631 15:93279759-93279781 GAAGGATCTTAGAACATGAAGGG - Intergenic
1138485681 16:57341571-57341593 GAGTCATCTTATAGCCTGTAGGG - Intergenic
1143934611 17:10469940-10469962 GTTGGTTCTTAGAGCCATTAAGG + Intergenic
1149683716 17:58522825-58522847 GATGGTTCTTAGGGCCTTGAAGG - Intronic
1150604187 17:66676823-66676845 GATGGATCATAGTTCCTGTCAGG + Intronic
1153168189 18:2285756-2285778 GATGGCTTCTAGGGCCTGTATGG - Intergenic
1154135983 18:11778628-11778650 GTTGGTTCTCAGAGCCTGCATGG - Intronic
1156160264 18:34350795-34350817 CAGGGATCTTCGAGCCTGTGTGG - Intergenic
1159141781 18:64405116-64405138 GCAGGATCTTAGAACCTGGATGG + Intergenic
1159878547 18:73835752-73835774 GTTGGATCTCATAGCCTGTTAGG + Intergenic
1167833860 19:52050135-52050157 GATGGAACAGAGAGCCTGGAGGG - Intronic
1168260969 19:55194330-55194352 GAAGGGTCTTACAACCTGTACGG + Intronic
927917583 2:26946902-26946924 CATCGATCTGAGAGCCTGCAGGG - Exonic
928174033 2:29022216-29022238 GATGGATCTTAGAGCCTGTAAGG + Exonic
930411521 2:51031570-51031592 GATGGAGCTTAGAGACTGGGCGG - Intronic
930835218 2:55785629-55785651 GATGGGTCTGAGAGCCATTAAGG - Intergenic
932984985 2:76715223-76715245 GATGGAAATTAGGGCCTATATGG - Intergenic
938327837 2:130425000-130425022 CATGGAGCTTAGAGCCTACATGG - Intergenic
938362110 2:130696478-130696500 CATGGAGCTTAGAGCCTACATGG + Intergenic
938438516 2:131303177-131303199 CATGGAGCTTAGAGCCTACATGG + Intronic
938775342 2:134536822-134536844 TATGGCTCTTACAGCCTGTCAGG - Intronic
944469901 2:200041786-200041808 GAAGCATCTTAGTGGCTGTAAGG - Intergenic
947694179 2:232169619-232169641 GAAGGATCTTAGAGTCTGAAGGG - Intronic
1178835872 21:36097013-36097035 TAAGGATCTTAGGGCCTGCAAGG - Intergenic
1179316813 21:40251115-40251137 GATGCAGCTTGGAGGCTGTAAGG + Intronic
1181894309 22:26093465-26093487 GAGGGATCTTAGAGGATGAAGGG + Intergenic
1182398030 22:30050785-30050807 AATGAGTCTCAGAGCCTGTAGGG - Intergenic
949856043 3:8462274-8462296 GCTGGATCTTAAAACCTGAAAGG - Intergenic
950221492 3:11199724-11199746 GATGGATCTAAGAGCATGCTTGG + Intronic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
955516990 3:59735633-59735655 GCTGGAACTGAGAGCCTGAAGGG + Intergenic
969979042 4:11135171-11135193 GAGTAATCTTAGAGCCTGTGTGG - Intergenic
970423392 4:15925736-15925758 GATGGATCTGAGAGTCCGCAAGG - Intergenic
974726471 4:65805543-65805565 GAGGTGTCTTAGAGGCTGTAAGG + Intergenic
979386420 4:120070406-120070428 GATGGATATTTTAGCCTGCAGGG + Intergenic
983586741 4:169363464-169363486 GCAGGAGCTGAGAGCCTGTATGG - Intergenic
989081856 5:37630924-37630946 GATGGAGCTGAGAGCTTGTAAGG + Intronic
996407282 5:123118007-123118029 GATGGAGCTTACAGTCTGTGAGG + Intronic
1000377032 5:160592312-160592334 GATGCATCTCAGAGCCTGGAGGG + Intronic
1009520550 6:64677056-64677078 GATGGATGTTAGAGTATTTAAGG - Intronic
1010354502 6:74916008-74916030 AATGGTTCTTAAAGCCTGAAAGG + Intergenic
1014952266 6:127569983-127570005 GGTGGATGTTAGAGCCTGAAAGG + Intronic
1015308878 6:131742692-131742714 CCTGGAACTTATAGCCTGTAAGG - Intronic
1015905780 6:138115170-138115192 GATGGAGCAGAGAGCCTGGATGG - Intergenic
1016553134 6:145305038-145305060 CATGGAGCTTATAGTCTGTAAGG - Intergenic
1017334798 6:153243497-153243519 GATGGAAGGTAGAGCCTGGAAGG - Intergenic
1024268332 7:47623376-47623398 GCAGGATCTTAGAGCCTACAAGG + Intergenic
1030301423 7:107977994-107978016 AATGGATACTAGAGCCTGAATGG + Intronic
1033142517 7:138840264-138840286 GCTGGATCTGGGAGCCTGGAAGG + Exonic
1036587479 8:10137728-10137750 TAAGGAGCTTAGAGCCTGGATGG + Intronic
1039818502 8:41115723-41115745 GAGGGATCATAGAGCATTTAAGG - Intergenic
1052245857 9:26333781-26333803 GATGGGTCTTAGAATCTGTTTGG - Intergenic
1053474911 9:38375759-38375781 GCTGGAGCTTAGAGCGTGTGAGG - Intergenic
1058921437 9:109618949-109618971 GGTGGATCCCTGAGCCTGTAGGG + Intergenic
1061004220 9:127919268-127919290 CATGGAGCTTAGAGTCTGTGGGG - Intergenic
1062480297 9:136747916-136747938 GCTGGAGCCTAGAGGCTGTAGGG - Intronic
1188894202 X:35646172-35646194 GATTGATCTTATATCCTGTGTGG + Intergenic
1192778243 X:74267218-74267240 CATGGATTTTAGAATCTGTAGGG - Intergenic
1196276484 X:113771756-113771778 TATGGATCTTAGATTGTGTATGG - Intergenic
1196892982 X:120308597-120308619 GATGGATTTCAGCGCCTTTAAGG - Intronic
1199092811 X:143711859-143711881 GAAGGATATGAGATCCTGTAGGG - Intergenic