ID: 928175798

View in Genome Browser
Species Human (GRCh38)
Location 2:29033619-29033641
Sequence ACCCCTGGCCATGGACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 181}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928175798_928175812 28 Left 928175798 2:29033619-29033641 CCTGCTTGTCCATGGCCAGGGGT 0: 1
1: 0
2: 2
3: 7
4: 181
Right 928175812 2:29033670-29033692 GTATCGCTGAGACCTAGTTGGGG 0: 1
1: 0
2: 0
3: 1
4: 36
928175798_928175806 -2 Left 928175798 2:29033619-29033641 CCTGCTTGTCCATGGCCAGGGGT 0: 1
1: 0
2: 2
3: 7
4: 181
Right 928175806 2:29033640-29033662 GTGGCTCTGGGGTGGACATATGG 0: 1
1: 1
2: 4
3: 23
4: 207
928175798_928175809 6 Left 928175798 2:29033619-29033641 CCTGCTTGTCCATGGCCAGGGGT 0: 1
1: 0
2: 2
3: 7
4: 181
Right 928175809 2:29033648-29033670 GGGGTGGACATATGGATCTGGGG 0: 1
1: 0
2: 1
3: 14
4: 223
928175798_928175804 -10 Left 928175798 2:29033619-29033641 CCTGCTTGTCCATGGCCAGGGGT 0: 1
1: 0
2: 2
3: 7
4: 181
Right 928175804 2:29033632-29033654 GGCCAGGGGTGGCTCTGGGGTGG 0: 1
1: 1
2: 4
3: 83
4: 704
928175798_928175810 26 Left 928175798 2:29033619-29033641 CCTGCTTGTCCATGGCCAGGGGT 0: 1
1: 0
2: 2
3: 7
4: 181
Right 928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG 0: 1
1: 0
2: 0
3: 4
4: 55
928175798_928175807 4 Left 928175798 2:29033619-29033641 CCTGCTTGTCCATGGCCAGGGGT 0: 1
1: 0
2: 2
3: 7
4: 181
Right 928175807 2:29033646-29033668 CTGGGGTGGACATATGGATCTGG 0: 1
1: 0
2: 3
3: 15
4: 227
928175798_928175808 5 Left 928175798 2:29033619-29033641 CCTGCTTGTCCATGGCCAGGGGT 0: 1
1: 0
2: 2
3: 7
4: 181
Right 928175808 2:29033647-29033669 TGGGGTGGACATATGGATCTGGG 0: 1
1: 0
2: 2
3: 16
4: 160
928175798_928175811 27 Left 928175798 2:29033619-29033641 CCTGCTTGTCCATGGCCAGGGGT 0: 1
1: 0
2: 2
3: 7
4: 181
Right 928175811 2:29033669-29033691 GGTATCGCTGAGACCTAGTTGGG 0: 1
1: 0
2: 0
3: 2
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928175798 Original CRISPR ACCCCTGGCCATGGACAAGC AGG (reversed) Intronic
900536274 1:3179289-3179311 GCCCCAGGGCATGGACAGGCTGG + Intronic
900601383 1:3504183-3504205 AGCCCAGGCCATGGTCATGCTGG + Intronic
901632757 1:10655948-10655970 GCCACTGGCCTTGGACAATCTGG - Intronic
903014631 1:20353969-20353991 GCCTCTGGCCAAGGGCAAGCTGG + Exonic
905349988 1:37338858-37338880 AGCCCTGCCCAAGGACAGGCAGG + Intergenic
908752667 1:67439561-67439583 ACCGCAGGCCTTTGACAAGCTGG + Intergenic
912505381 1:110152200-110152222 AGCCATGGCCAAGGACAATCAGG - Intronic
915914748 1:159934276-159934298 ACCCCTGCCCATAGGCATGCCGG - Exonic
919465211 1:197917212-197917234 CCCCCTGGTGATGGGCAAGCAGG - Intronic
920965507 1:210697689-210697711 AGCCCTGGCCATGGGCCAGAAGG - Intronic
922043676 1:221922271-221922293 GCACCTGGCCCAGGACAAGCTGG + Intergenic
924219698 1:241861084-241861106 GCCACTGGCCATGTACATGCAGG + Intronic
924387628 1:243513870-243513892 TCCCCTGGACATGAGCAAGCAGG + Intronic
924578808 1:245304934-245304956 ACCTCTGGGCCTGGGCAAGCTGG - Intronic
924808282 1:247379026-247379048 ACCCGAGGCCATGGACTAGTTGG + Intergenic
1063827214 10:9911250-9911272 ACCACAGGCCATCCACAAGCTGG - Intergenic
1067285869 10:44907394-44907416 CCCCCTGGCCATGGAAAATTGGG - Intergenic
1067746135 10:48937984-48938006 TCGCCTGGCAATGGCCAAGCTGG + Intronic
1071106846 10:82107960-82107982 AGCCGTGGCAATGGATAAGCTGG - Intronic
1074543822 10:114387051-114387073 TCCCCTGGCCATGGAGACCCAGG - Intronic
1075222676 10:120598683-120598705 ACCTCTGGCCATTGAGAATCCGG + Exonic
1075390273 10:122086499-122086521 ACTTCTGGCCAAGGGCAAGCAGG + Exonic
1076340883 10:129744150-129744172 TCCCCTGGGCCTGGACAACCTGG - Intronic
1076628031 10:131833859-131833881 GGCCCTGGTCATGGACCAGCAGG - Intergenic
1076675714 10:132146543-132146565 GTCCCTGCCCATGGACAAGTGGG - Intronic
1077046805 11:550294-550316 TCTCCTGGCCATGCACATGCTGG - Intronic
1077213129 11:1382701-1382723 ACCCCTGTCCAGGGACAGGTGGG + Intergenic
1077533491 11:3108072-3108094 ACCCCTGGCCCTGCCCCAGCAGG + Intronic
1079094565 11:17502157-17502179 ACCCCTGTTCAGGGACAAGCAGG + Intronic
1079993094 11:27266985-27267007 CTCCCTGGCCAGGGAGAAGCTGG - Intergenic
1083372605 11:62193817-62193839 AACCCTGGGCCTGGACAATCAGG - Intergenic
1083381336 11:62271102-62271124 TCCCCTGACCAGGGACAAGTGGG + Intronic
1083993757 11:66262053-66262075 ACCCCAGCCCATGGACACCCCGG + Intronic
1084562454 11:69912404-69912426 TCCCCTGGCCTTGGCCCAGCTGG + Intergenic
1089119740 11:116125115-116125137 ACCCCTGGGCACAGGCAAGCCGG + Intergenic
1089694774 11:120210471-120210493 ACACCTGGCCGTGGCAAAGCTGG + Intergenic
1089788741 11:120927002-120927024 TGCCCTGGCCATGGCCCAGCTGG - Intronic
1090041888 11:123299054-123299076 ACCCCTTGGCATGAACAACCTGG + Intergenic
1100981758 12:100167576-100167598 ACCGCAGGCCATGGAGGAGCGGG - Intergenic
1101425023 12:104581084-104581106 ACTCCTGACCTTGGACATGCAGG + Intronic
1107681936 13:42861188-42861210 ACCCGCTCCCATGGACAAGCAGG + Intergenic
1107978098 13:45709229-45709251 ATCCCTAGCCACGGACAACCTGG - Intronic
1113768567 13:112895000-112895022 GACCCTGGCCCGGGACAAGCAGG - Intronic
1115526378 14:34284483-34284505 ACCACAGGCCATTTACAAGCTGG - Intronic
1118447067 14:65861751-65861773 AATCCTGGCCATGGACAGGAAGG + Intergenic
1119026256 14:71155249-71155271 AGTCCTGTGCATGGACAAGCAGG - Intergenic
1120252399 14:82074571-82074593 ACCCCTTGCCATGAGCAAGGTGG + Intergenic
1121485931 14:94314366-94314388 AACCCAGGCCCTGGAGAAGCTGG + Exonic
1122018574 14:98817918-98817940 AACCCAGTCCATGGACCAGCTGG + Intergenic
1122121398 14:99555355-99555377 ACCTGTAGCCTTGGACAAGCCGG - Intronic
1124023271 15:25943021-25943043 AGGCCTGGCCAGGGACAGGCTGG - Intergenic
1124628393 15:31323696-31323718 CTCCCAGGCCAAGGACAAGCAGG - Intergenic
1128248742 15:66150533-66150555 CTCCCTGTCCATGGGCAAGCAGG + Intronic
1129606776 15:77028819-77028841 ACCTCAGGCCATGGACAGGCAGG + Intronic
1130051922 15:80490844-80490866 ACCCCAGGAAATGGACAAACAGG + Intronic
1132598890 16:765238-765260 ACCCCTGGACCAGGACCAGCAGG + Exonic
1132882201 16:2167437-2167459 CCCTCTGGCCCTGGCCAAGCTGG + Intronic
1133189806 16:4125252-4125274 AGACCTGGCCCTGGAGAAGCTGG - Intergenic
1133279317 16:4656088-4656110 AGCCCTGGCCACAGGCAAGCAGG + Intronic
1135111101 16:19691453-19691475 AACCCTGGCCAAGGACGAGGTGG + Exonic
1137612637 16:49829108-49829130 AGCCCTGGGGATGGTCAAGCCGG + Intronic
1138344523 16:56311808-56311830 ACCCATGGCCATGCAGCAGCTGG - Intronic
1140855832 16:78977018-78977040 TCCCCTGGCCTGGGACAATCAGG + Intronic
1143462781 17:7114656-7114678 AACCCTGGCCTTGGCCAAGGAGG + Intronic
1144191452 17:12850480-12850502 ACCCCTGCCCATGGACATGTGGG - Intronic
1144823766 17:18093756-18093778 ACCCCTGGGCTTGGACACCCTGG + Intronic
1145720122 17:27063456-27063478 ACCTCTGGCCATGCAGAAGATGG + Intergenic
1147374962 17:40017839-40017861 GCCCCTGGCCAGGCACCAGCTGG - Intergenic
1147888403 17:43699933-43699955 AACCCTGGGCATGGACAGGTGGG - Intergenic
1148195690 17:45710980-45711002 ACCCCTGGCCATTGCCCAGCAGG - Intergenic
1148806674 17:50267326-50267348 ACCCCTCCACATGGACAAGAGGG + Intergenic
1151694430 17:75706947-75706969 GCCTCTGGGCATGGACAGGCGGG + Exonic
1152102292 17:78309174-78309196 ACTGCTGGTCATGGAAAAGCTGG - Intergenic
1152228715 17:79104278-79104300 ACCCCTGGCCATGGAGCAGCTGG + Intronic
1152856646 17:82668450-82668472 GCCCCTTGGCATGAACAAGCTGG - Intronic
1160221958 18:76984455-76984477 ACCCCTGGGCATGAGCAAGTTGG + Intronic
1162109698 19:8393434-8393456 TCCCCTGCCCAAGGACAAGGTGG + Intronic
1166656231 19:44614014-44614036 ACCACGGGCCAGGGACAAGGAGG + Intronic
1166656869 19:44618635-44618657 GTGCCTGGCCATGGACCAGCTGG + Intronic
1166892630 19:46003009-46003031 AACCTTGGCCATGGACCAGCCGG + Exonic
1167149244 19:47699383-47699405 ACAGCTGGCCAAGGAGAAGCCGG + Exonic
1167768420 19:51499457-51499479 AGCCCTGGTCATGGTCACGCCGG + Exonic
925061089 2:890817-890839 AGACCTGGCCATGGACACACTGG - Intergenic
928175798 2:29033619-29033641 ACCCCTGGCCATGGACAAGCAGG - Intronic
932129951 2:69178500-69178522 TCCCCAGGCCAGGGACAAGAGGG + Intronic
933936976 2:87214029-87214051 ACCTCTGGTTATGGACAAGATGG - Intergenic
936228254 2:110677983-110678005 TCCTCTGGCCATGGACACCCCGG - Exonic
936356166 2:111751795-111751817 ACCTCTGGTTATGGACAAGATGG + Intergenic
937697511 2:124824460-124824482 ACCCCTTTCCATGGACACGATGG - Intronic
941856368 2:170235150-170235172 ACCCATGGCCATGGCCAGGTGGG - Intronic
945362752 2:208911210-208911232 AGCCATGGCCATGAACTAGCTGG - Intergenic
945694273 2:213083224-213083246 ACCCCAGGCCAGGGACCAGTAGG + Intronic
945981601 2:216316799-216316821 ACCCCAGGTCATTGAGAAGCAGG + Intronic
947147397 2:227080843-227080865 ATCCCTGGCCATGGGAAAGGGGG + Intronic
947612632 2:231533251-231533273 GCTCCTGGCCATGGCCAGGCTGG - Intergenic
947712249 2:232322971-232322993 ACCCCTGGCCAGGAGCAAGCAGG + Intronic
948473877 2:238203886-238203908 ACCCCCAGCCAAGGAAAAGCAGG - Intergenic
948691021 2:239705145-239705167 ACACTTGCCCATGGACAGGCTGG - Intergenic
948896215 2:240928998-240929020 ACACCTGGCCATGCACCCGCTGG - Intronic
948942357 2:241202854-241202876 ACCCCTGGCCATGCAGCAGTGGG - Intronic
1169058186 20:2641159-2641181 AAGCCAGGCCATGGACAAGAAGG + Exonic
1169092078 20:2867161-2867183 ACCCCGGGCCAAGTGCAAGCTGG + Intronic
1169105183 20:2988393-2988415 ACCCCTGCCCGTGGACAAGCTGG + Exonic
1172600671 20:36180416-36180438 TCCACTGGCCAAGGAGAAGCAGG - Intronic
1175080668 20:56417852-56417874 ACATCTGACCATGGACAAGGAGG - Intronic
1176307291 21:5130412-5130434 ACCGCTGGCGAGGGACAGGCTGG + Intergenic
1176679779 21:9813163-9813185 ACCCCTGGGCTTTTACAAGCGGG - Intergenic
1176680061 21:9814572-9814594 ACCCCTGGGCTTTTACAAGCGGG - Intergenic
1176680629 21:9817390-9817412 ACCCCTGGGCTTTTACAAGCGGG - Intergenic
1176681197 21:9820202-9820224 ACCCCTGGGCTTTTACAAGCGGG - Intergenic
1176681482 21:9821621-9821643 ACCCCTGGGCTTTTACAAGCGGG - Intergenic
1176681770 21:9823030-9823052 ACCCCTGGGCTTTTACAAGCGGG - Intergenic
1177476625 21:21632163-21632185 AGCCATGGCCCCGGACAAGCAGG + Intergenic
1178476791 21:32944242-32944264 ACCCCTGGCCAATCTCAAGCTGG + Intergenic
1178905266 21:36631272-36631294 ACCCCTGGCCACTGAGAAGTGGG + Intergenic
1179446996 21:41438931-41438953 GCCCCTTGCCATGGTCCAGCTGG - Intronic
1179849768 21:44131618-44131640 ACCGCTGGCGAGGGACAGGCTGG - Intergenic
1183723195 22:39573970-39573992 AGCCCTGGCCATGGGGATGCCGG - Intronic
949226301 3:1699771-1699793 ACCCCTTGGCATGGACAGCCTGG + Intergenic
952370201 3:32715213-32715235 ACATCTGGTCATGGACAAGGAGG + Intronic
953851169 3:46466482-46466504 GCACCTAGCCATGGAGAAGCAGG + Intronic
954682762 3:52354836-52354858 ACCCCAGGCACTGGACAAGATGG + Exonic
956084938 3:65598300-65598322 GCCCCTGGACATGGAAAGGCGGG + Intronic
957170522 3:76731063-76731085 TCTCCTGGGCATGGAAAAGCGGG - Intronic
960202065 3:114848794-114848816 AGCCCTGGCGAAGGAGAAGCAGG - Intronic
961477723 3:127159045-127159067 AGCCCAGGCAATGGACCAGCCGG + Intergenic
967852545 3:194093264-194093286 ACCCCAGGACAAGGACTAGCCGG - Intergenic
968538552 4:1150462-1150484 CCCCCAGGCCAGGAACAAGCAGG - Intergenic
969449361 4:7264368-7264390 TCCCATGCCCCTGGACAAGCAGG - Intronic
969516213 4:7649504-7649526 ACCCAGGGCCATGGCCCAGCTGG - Intronic
969947504 4:10799554-10799576 CTCCCTGGCCATGGATTAGCTGG + Intergenic
969956056 4:10891936-10891958 GCCCCTGGCCATCTAGAAGCAGG + Intergenic
972374888 4:38460694-38460716 ATCCCTGGCCAGGAACAGGCAGG - Intergenic
973207094 4:47572925-47572947 ACCAGTGTCCATGGACAAGAAGG - Exonic
978659619 4:111108931-111108953 TCTCCTGGCCATGCACCAGCAGG + Intergenic
980761427 4:137238893-137238915 AGCCCTACCCATGGAGAAGCTGG - Intergenic
981772642 4:148328011-148328033 GCCTCTGGAAATGGACAAGCTGG - Intronic
985791026 5:1926807-1926829 ACCCCTGGCCATGGGGGAGGAGG - Intergenic
986015004 5:3749879-3749901 AACCACGGACATGGACAAGCAGG + Intergenic
990863451 5:60353658-60353680 ACCCCTGGCCCTGTGAAAGCTGG - Intronic
993568089 5:89500397-89500419 AACCCTGGCTAAGGACCAGCAGG + Intergenic
994452124 5:99955979-99956001 ACCCCTCAGCATGGACAGGCTGG - Intergenic
994753256 5:103764460-103764482 GCCCCTCAGCATGGACAAGCCGG - Intergenic
1000633771 5:163620357-163620379 CCTCTTGGCCATGGACTAGCTGG + Intergenic
1001795262 5:174496885-174496907 ATCCCTGGACATGAACAAGTCGG - Intergenic
1002381237 5:178831483-178831505 ACCCCTGGGCATGGAATAGTGGG - Intergenic
1002631245 5:180580624-180580646 ACCCCTAGCTATAGACTAGCTGG - Intergenic
1006134805 6:31888861-31888883 AAGCCTGGCCATGGACACCCCGG + Intronic
1006412575 6:33883130-33883152 TCCTCTGGCCATGGACACCCCGG + Intergenic
1007166897 6:39834958-39834980 ACCGCTGGCTATTGACAAGGAGG - Intronic
1007450995 6:41940528-41940550 CCCCCTGGCCATGAACTACCTGG - Exonic
1007742891 6:44023549-44023571 ACACCTGGCCAGGGACAGGGTGG - Intergenic
1008817014 6:55580057-55580079 ATTCCTGGCCATGGACACCCTGG - Intergenic
1009534336 6:64861138-64861160 ACCCCTGGGCATGAACAGCCTGG - Intronic
1009615695 6:66002644-66002666 ACCCCAGGCAATGGAAAAACTGG + Intergenic
1013464210 6:110402807-110402829 ACCCCTGGCCATCCCCACGCAGG + Intronic
1020096091 7:5370480-5370502 AGCCCAGGCCTTGGAGAAGCTGG - Exonic
1029666963 7:102001726-102001748 CCTCCTGGCCATGCACATGCAGG + Intronic
1032457412 7:132083865-132083887 ACATCTGGCCAGGGACAATCTGG - Intergenic
1034566319 7:151918511-151918533 AGCCCAGGCCCTGGACTAGCGGG + Intergenic
1035231698 7:157469511-157469533 ACCCCCGACCAAGGACATGCCGG + Intergenic
1036751068 8:11444081-11444103 ACCCCTGTCCACTGGCAAGCTGG - Exonic
1037539367 8:19856420-19856442 ATCCCTTGCCAGGAACAAGCTGG + Intergenic
1038320033 8:26517561-26517583 ACCCCTGGGCACTGACAAGGGGG - Intronic
1039967277 8:42292529-42292551 ACCCGTGGGCATGGAGAGGCAGG + Intronic
1049587536 8:143438976-143438998 GCTCCTGGCCATGGCCAAGCAGG + Intronic
1049735092 8:144200571-144200593 ACCCCTGGCCATGTCCAGGATGG + Intronic
1051355137 9:16234019-16234041 ACCCCTTGCCATGAACAGCCTGG + Intronic
1054448528 9:65389872-65389894 ACCCCAGGGCTTTGACAAGCGGG - Intergenic
1056533785 9:87510223-87510245 CCTCGTGGCCATGGAGAAGCAGG + Intronic
1056576595 9:87859662-87859684 ACACCTGGCCACGGAGAAGTGGG - Intergenic
1062204131 9:135326371-135326393 AGCCCAGGCCCTGGACACGCAGG + Intergenic
1062627112 9:137448335-137448357 ACCCCTGGCTCTGCACAAGGGGG + Exonic
1203664943 Un_KI270754v1:15697-15719 ACCCCTGGGCTTTTACAAGCGGG - Intergenic
1203665229 Un_KI270754v1:17106-17128 ACCCCTGGGCTTTTACAAGCGGG - Intergenic
1203665790 Un_KI270754v1:19923-19945 ACCCCTGGGCTTTTACAAGCGGG - Intergenic
1203666078 Un_KI270754v1:21333-21355 ACCCCTGGGCTTTTACAAGCGGG - Intergenic
1203666367 Un_KI270754v1:22742-22764 ACCCCTGGGCTTTTACAAGCGGG - Intergenic
1203666656 Un_KI270754v1:24149-24171 ACCCCTGGGCTTTTACAAGCGGG - Intergenic
1203666936 Un_KI270754v1:25561-25583 ACCCCTGGGCTTTTACAAGCGGG - Intergenic
1203667226 Un_KI270754v1:26972-26994 ACCCCTGGGCTTTTACAAGCGGG - Intergenic
1203667516 Un_KI270754v1:28381-28403 ACCCCTGGGCTTTTACAAGCGGG - Intergenic
1203667805 Un_KI270754v1:29788-29810 ACCCCTGGGCTTTTACAAGCGGG - Intergenic
1203668084 Un_KI270754v1:31200-31222 ACCCCTGGGCTTTTACAAGCGGG - Intergenic
1203668374 Un_KI270754v1:32611-32633 ACCCCTGGGCTTTTACAAGCGGG - Intergenic
1203668664 Un_KI270754v1:34020-34042 ACCCCTGGGCTTTTACAAGCGGG - Intergenic
1203669223 Un_KI270754v1:36837-36859 ACCCCTGGGCTTTTACAAGCGGG - Intergenic
1203669510 Un_KI270754v1:38246-38268 ACCCCTGGGCTTTTACAAGCGGG - Intergenic
1203669796 Un_KI270754v1:39653-39675 ACCCCTGGGCTTTTACAAGCGGG - Intergenic
1189225842 X:39412519-39412541 ACCCTAGGCCGTGGAGAAGCTGG - Intergenic
1200115315 X:153767430-153767452 ACCCCTGGCCATCCGCCAGCTGG + Exonic