ID: 928175801

View in Genome Browser
Species Human (GRCh38)
Location 2:29033628-29033650
Sequence CCCAGAGCCACCCCTGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 582
Summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 521}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928175801_928175812 19 Left 928175801 2:29033628-29033650 CCATGGCCAGGGGTGGCTCTGGG 0: 1
1: 0
2: 3
3: 57
4: 521
Right 928175812 2:29033670-29033692 GTATCGCTGAGACCTAGTTGGGG 0: 1
1: 0
2: 0
3: 1
4: 36
928175801_928175807 -5 Left 928175801 2:29033628-29033650 CCATGGCCAGGGGTGGCTCTGGG 0: 1
1: 0
2: 3
3: 57
4: 521
Right 928175807 2:29033646-29033668 CTGGGGTGGACATATGGATCTGG 0: 1
1: 0
2: 3
3: 15
4: 227
928175801_928175809 -3 Left 928175801 2:29033628-29033650 CCATGGCCAGGGGTGGCTCTGGG 0: 1
1: 0
2: 3
3: 57
4: 521
Right 928175809 2:29033648-29033670 GGGGTGGACATATGGATCTGGGG 0: 1
1: 0
2: 1
3: 14
4: 223
928175801_928175811 18 Left 928175801 2:29033628-29033650 CCATGGCCAGGGGTGGCTCTGGG 0: 1
1: 0
2: 3
3: 57
4: 521
Right 928175811 2:29033669-29033691 GGTATCGCTGAGACCTAGTTGGG 0: 1
1: 0
2: 0
3: 2
4: 23
928175801_928175810 17 Left 928175801 2:29033628-29033650 CCATGGCCAGGGGTGGCTCTGGG 0: 1
1: 0
2: 3
3: 57
4: 521
Right 928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG 0: 1
1: 0
2: 0
3: 4
4: 55
928175801_928175808 -4 Left 928175801 2:29033628-29033650 CCATGGCCAGGGGTGGCTCTGGG 0: 1
1: 0
2: 3
3: 57
4: 521
Right 928175808 2:29033647-29033669 TGGGGTGGACATATGGATCTGGG 0: 1
1: 0
2: 2
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928175801 Original CRISPR CCCAGAGCCACCCCTGGCCA TGG (reversed) Intronic
900089430 1:913403-913425 CCCAGAGCCTCCAATGGGCATGG - Intergenic
900102994 1:970782-970804 CCCAGAGGCACTCCTGACCCAGG + Intronic
900175943 1:1291410-1291432 CCCAGAGCCAGCCCTGCCTCAGG + Exonic
900209435 1:1446644-1446666 CCCATCCCCACCCCTCGCCATGG - Intergenic
900219254 1:1498506-1498528 CCCATCCCCACCCCTCGCCATGG - Intergenic
900371805 1:2335540-2335562 CCCGGTGCCACCCCTGTCCCAGG + Intronic
900402385 1:2477905-2477927 CCAGGAGCCACCTGTGGCCAGGG + Intronic
900420459 1:2553890-2553912 CTCAGAGCCCCCCATGGCCTGGG + Intergenic
900546049 1:3229806-3229828 CCCAGAGGAGCCCCTGGCCCAGG + Intronic
900548221 1:3240589-3240611 CCCAGAGTGAGCCCCGGCCACGG - Intronic
900616105 1:3566387-3566409 CCCAGTGCCAACCCTGTTCAGGG - Intronic
900735812 1:4298752-4298774 CCCAGTCCCACTCCTTGCCACGG - Intergenic
900933727 1:5752589-5752611 CCCAGACTCACCACTGGCCCTGG + Intergenic
901183664 1:7358541-7358563 CCCCGCGCCACCCCTGCCCCGGG + Intronic
901217644 1:7563579-7563601 ATCAGAGCCACCCCAAGCCAAGG - Intronic
901287647 1:8093888-8093910 CCAAGAGCCAGCCCTGAACACGG + Intergenic
901534811 1:9875255-9875277 CAGAGAGCCACCCCTGCCCAGGG + Intronic
903128473 1:21263203-21263225 CCCAGAACCAGCCCTGGATAGGG + Intronic
903285206 1:22272731-22272753 CCCAGAGCCAGCCCTTTCCTTGG + Intergenic
903330974 1:22597228-22597250 CCCAGACCCATCCCAGGCCCAGG + Intronic
903373820 1:22853525-22853547 CCCAGACCCAGCCCTGGCAGGGG + Intronic
903690130 1:25167501-25167523 CCCAGTACCAGCCCTGGCCCGGG + Intergenic
903694526 1:25197239-25197261 TGCAAAGCCACCCCGGGCCAGGG + Intergenic
904049293 1:27628891-27628913 CAGAGAGCCAGGCCTGGCCAGGG - Intronic
904424654 1:30415635-30415657 CCAACAGCCAGCCCTGACCAAGG + Intergenic
904489936 1:30852333-30852355 TCCAGAGCCAGCCCTGGGCAGGG + Intergenic
904700032 1:32352388-32352410 CCCAGAGACACTCCTCCCCAGGG + Intronic
905434255 1:37946205-37946227 CCCTGAGCCTGCCCTGGCCTTGG - Intronic
905857116 1:41321492-41321514 ACCACAGACACCCCTGGCAAAGG - Intergenic
905862828 1:41362125-41362147 CCCAGCGCCGCCCCTGGGCGCGG + Exonic
906058589 1:42934231-42934253 CCAGGAGCCAGCCCTGGACAAGG - Intronic
906061278 1:42950477-42950499 CCCACACCCACACATGGCCAAGG - Intronic
906645347 1:47470592-47470614 CCCAGAGCCACCCCTTCTTAAGG - Intergenic
907246806 1:53114057-53114079 CTCAGAGCCAGCCCTTGCCCTGG - Intronic
907371690 1:54007767-54007789 CGCAGAGACTGCCCTGGCCAAGG + Intronic
907385433 1:54122542-54122564 CCCACTGGCACCCCTGGCCCTGG + Intergenic
907454132 1:54564483-54564505 CACAGGGCCACACCTGGGCAGGG - Intronic
908401310 1:63774672-63774694 CCCGGAGCCCCGCCAGGCCAGGG + Intronic
908892329 1:68861585-68861607 CCCAGAGGCACACCTGGCAGAGG - Intergenic
911217247 1:95208463-95208485 CTCAGTCCCACCCCTGTCCAAGG - Intronic
911793922 1:102053507-102053529 CCCAGCTCCAGCTCTGGCCAAGG - Intergenic
913446051 1:118951839-118951861 CCCTGTGCCATCCCTGGGCAAGG + Intronic
915073158 1:153288806-153288828 CCCAGCCCCAGCCCTGACCATGG + Intergenic
915146854 1:153800592-153800614 CCCAGAGCCACCCCGTCCCCAGG + Intergenic
915442203 1:155952158-155952180 CCGAGAGCCAGCCCTGCCCTTGG - Exonic
915840033 1:159205993-159206015 ACCAGAAGCACCACTGGCCAGGG - Exonic
916132838 1:161626411-161626433 CACAGAGACACCCCAGGCCCGGG + Intronic
916824744 1:168432549-168432571 CCTTCAGCCACCCATGGCCAAGG - Intergenic
917837632 1:178953613-178953635 CCCAGATGCTGCCCTGGCCAAGG - Intergenic
918030147 1:180799719-180799741 CCCAGAGTCACCCCTGGGACTGG - Intronic
919793217 1:201305675-201305697 CCCAGAGCCACCCCATGCACTGG - Intronic
919813103 1:201421302-201421324 CCCAGGGCCACCCCTTCCCCTGG + Intronic
919937509 1:202264449-202264471 ACCACAGCCACCCTTTGCCAGGG + Intronic
920053283 1:203175938-203175960 CCCAGAGCTATTCCTGGCCTGGG - Intergenic
922108130 1:222530292-222530314 CCCAGAGGCAGGCCTGCCCAGGG - Intronic
922475929 1:225907046-225907068 CACAGAGCCAGCCTTGGCCTCGG - Intronic
922720086 1:227895910-227895932 CCCAGAGCCCCTCCTGGGAAAGG - Intergenic
922726313 1:227924615-227924637 ACCAGAGCCCGCCATGGCCATGG + Intronic
922729428 1:227942108-227942130 CCCAGTGCCTGCCCTGGCCTGGG - Intronic
924246787 1:242093138-242093160 CCCAGAGACCCCCGTGGCCAAGG + Intronic
924602639 1:245504783-245504805 GACAGAGCCACCTCTGACCACGG - Intronic
1062819105 10:520660-520682 CCCAGAGCCTGCACTGGCCCAGG + Intronic
1063098067 10:2925800-2925822 CCCAGAGCAAGCCCTCGCTATGG - Intergenic
1063139283 10:3242177-3242199 CCCAGAGCCACCCTCGTCAAGGG + Intergenic
1063268179 10:4476905-4476927 CTAAGAGCCACCCCTGGCATAGG + Intergenic
1063429701 10:5977715-5977737 CGCACAGCCACCCCTGTCCCCGG + Intronic
1065343083 10:24723985-24724007 CCCAGAGCCTCCCCTGGGGAGGG - Intergenic
1065967552 10:30781820-30781842 CGCTGAGCCAGCCCTGGCCTGGG + Intergenic
1067471469 10:46541421-46541443 CCCAGGACCACGCCTGGCCCGGG + Intergenic
1067559748 10:47296618-47296640 CCCAGGGCCTCCCCAGGCCGCGG - Intergenic
1069639974 10:69948457-69948479 AGCAGCGCCACCCCTGCCCATGG + Intronic
1069719289 10:70539484-70539506 GCCAGGGCCAGGCCTGGCCATGG + Intronic
1069899795 10:71700865-71700887 CCCAGAGACACCTCTGGCTGGGG + Intronic
1069911933 10:71765231-71765253 CCCAGAGCCACCCCAGGGCTGGG + Intronic
1070813570 10:79310396-79310418 CCCAGCATCACCCCTGCCCAGGG + Intronic
1070968220 10:80543008-80543030 CCCAGATGCAGCCCTGGCCTGGG + Intronic
1072716487 10:97755971-97755993 CCCAGAGCCCTCCCTGGCTCCGG + Intronic
1073352966 10:102832784-102832806 CCCAGAGCCACTACTGGGAAGGG - Intronic
1074860508 10:117506533-117506555 CCCACAGGCACCCCTGCCAATGG - Intergenic
1075624311 10:123950830-123950852 CCCAAACCCACACCTGGCCCTGG + Intergenic
1075805704 10:125187325-125187347 TCCAGAGCCAGCACTGGCCTTGG + Intergenic
1075873585 10:125788813-125788835 TCCAGAGCCAGCCCAGCCCAGGG + Exonic
1076068947 10:127470777-127470799 AACAGATCCATCCCTGGCCATGG + Intergenic
1076635064 10:131876344-131876366 CCCAGTGACACTCCTGGCCGGGG - Intergenic
1076727716 10:132421268-132421290 CCCAGCCCCACCCCCAGCCATGG + Intergenic
1076851509 10:133095646-133095668 CCCAGAGCACCCTCTGTCCACGG + Intronic
1077095978 11:799306-799328 CCCAGAGCCTGCCCAGGCCTAGG - Exonic
1077327347 11:1969442-1969464 CCCCGAGCCCCCCCTGCCCAGGG - Intronic
1077384530 11:2262797-2262819 CCCAGAGTAGCCCCTGTCCAAGG - Intergenic
1077394838 11:2315738-2315760 TCCAGTGCCACCCCAGGGCATGG - Intronic
1077430258 11:2512731-2512753 CTCAGGGCCACCACTGGTCATGG + Intronic
1077444073 11:2582249-2582271 CCCATGGCCACCCCCGGGCAGGG - Intronic
1077465737 11:2732892-2732914 ACCAGAGCCACCCCTGCCTCAGG - Intronic
1077474273 11:2778975-2778997 CCCACGGCCGCCCCAGGCCATGG - Intronic
1077476847 11:2794501-2794523 CCCTGTGCCGCCCCTGACCACGG - Intronic
1078718390 11:13860949-13860971 CCCAGACCCAAGCCTGGCCATGG + Intergenic
1081597142 11:44467184-44467206 CCTGGAGCCACCCCTGCCAACGG + Intergenic
1081691037 11:45078713-45078735 CGCAGAGCCACCTCCCGCCATGG - Intergenic
1082924432 11:58530597-58530619 CCCACAGCCACCCCTTCCCCTGG - Intronic
1082996793 11:59261688-59261710 CCCAAGGCCACCGCTGGTCAGGG + Intergenic
1083209893 11:61176638-61176660 TCCTGAGCCTCCCCTGCCCACGG - Intergenic
1083613964 11:64017536-64017558 GCAAGCCCCACCCCTGGCCAGGG - Intronic
1084389470 11:68865660-68865682 CCCAGAGCTCCCACAGGCCAGGG - Intergenic
1084618314 11:70251377-70251399 CCCAAGGCCACCCCTGCCCTTGG + Intergenic
1085249798 11:75135413-75135435 CCCAAAGCCAGCCATAGCCAAGG - Intronic
1085687163 11:78633654-78633676 CTCAGAGCCACCCCCCACCATGG - Intergenic
1089422327 11:118341123-118341145 CCCACAGCCATCCCTGGCCCTGG - Intronic
1089536246 11:119162188-119162210 CCCTGTGCCACCCCTGGCTTGGG - Exonic
1090798998 11:130159379-130159401 ACCAGAACCGCCCCTGGCCCAGG - Intergenic
1202810329 11_KI270721v1_random:24622-24644 CCCCGAGCCCCCCCTGCCCAGGG - Intergenic
1091639933 12:2228722-2228744 GCCAGAGTCACCCCTGGCCCTGG - Intronic
1091769763 12:3143705-3143727 CCTAGAGCTTCCCATGGCCAAGG - Intronic
1091790194 12:3267813-3267835 CCCAGAGCCACGGCTGCCCAGGG - Intronic
1091826964 12:3520076-3520098 CCCAGAGCCAGGCTGGGCCAGGG + Intronic
1092708473 12:11309115-11309137 CCAGGAGGCACTCCTGGCCAGGG + Intronic
1095788870 12:46142929-46142951 CCCACAGCCACCACTGCCCCAGG + Intergenic
1096536963 12:52281091-52281113 CTGAGAGGCTCCCCTGGCCATGG + Intronic
1097187893 12:57205300-57205322 CCTTGAGCCACCCCAGGCCAGGG - Intronic
1098008905 12:66029702-66029724 CCCAGGGCCAGCACTGTCCAGGG - Intergenic
1100590395 12:96022775-96022797 CCCAGCACCATCCCTGGCAATGG + Intronic
1100979526 12:100153730-100153752 CCCAGGGCCACCCCTCGCTTTGG - Intergenic
1101324903 12:103706823-103706845 CCCAATGCCAGCCCTGCCCAGGG + Exonic
1102201683 12:111061733-111061755 CCCAGAGATACCCAGGGCCAGGG - Intronic
1103415195 12:120738526-120738548 CCCACAGCAAACCCTGGACATGG + Exonic
1103856029 12:123972306-123972328 CCCGGGGCCACCCCTGCCCCTGG + Intronic
1103901373 12:124305261-124305283 CCCAGTGCCACCCCTGGGTTGGG + Intronic
1104474039 12:129055413-129055435 GGCAGAGCCTCCCCTGGCCATGG + Intergenic
1104938382 12:132379724-132379746 TCGAGAGCCACCCGTGGCCCTGG + Intergenic
1104980038 12:132569681-132569703 CCCACCCCCACCCCTGGCCACGG + Intronic
1105680123 13:22717582-22717604 GCCAGAGCCAGGCCAGGCCATGG - Intergenic
1105830709 13:24161125-24161147 CGCAGAGCCACCGCCGGGCAGGG - Intronic
1107820688 13:44282825-44282847 CACAGAGGCTCCCCTGTCCAGGG + Intergenic
1108434092 13:50384851-50384873 CTCAGAGCCACACCTGTCCTGGG - Intronic
1108532757 13:51343030-51343052 CCCAGAGTCCACCCTGGCCAGGG - Intronic
1108885722 13:55178773-55178795 GGCAGAGCCACCCAAGGCCATGG + Intergenic
1111895401 13:94135818-94135840 CACTGAGCCACCACTGGCCAGGG + Intronic
1113819652 13:113204097-113204119 CCCACAGCCACCCCTGCTTATGG + Intronic
1113885285 13:113655580-113655602 CCAGGAGCCGCCCATGGCCACGG - Intronic
1113932779 13:113976950-113976972 CCCATAGCCACTCCTGGACTGGG + Intergenic
1115347511 14:32358987-32359009 CCCTGAGCCAGCCCTGGCTTTGG - Intronic
1115662457 14:35510802-35510824 CCCACCCCCACCCCTGTCCATGG - Intergenic
1115842689 14:37490046-37490068 CCCACAGCCACCCCTTCCCCAGG + Intronic
1116826559 14:49678324-49678346 CCAAGAGCAACACCTGGACAAGG + Intronic
1117399886 14:55349343-55349365 CCCATCTCTACCCCTGGCCAAGG + Intronic
1117647404 14:57866118-57866140 CCCACACCCGCCCCCGGCCACGG - Intronic
1118838016 14:69490236-69490258 CCCACACCCACCCCTGTCCTTGG - Intronic
1119199240 14:72740780-72740802 CCCCGAGGCACCCATGGCCCAGG - Intronic
1119702983 14:76767930-76767952 CCCAGAGCCAGGCCTGGGCCGGG - Intronic
1120348141 14:83316596-83316618 CCCAGATACACCACTGGCAATGG + Intergenic
1121127475 14:91417524-91417546 CCCGGAGCCACCCGGGGCCCCGG + Intronic
1121219746 14:92276626-92276648 CCCACAGCTACCCCTGGCCTGGG - Intergenic
1121236944 14:92398584-92398606 CCCAGGACCACACCTGGCCAGGG + Intronic
1121833024 14:97068048-97068070 CCCAAAGCCAGCCCTGGCCCTGG - Intergenic
1121855788 14:97268971-97268993 CCCAGGGCCACCTCTGGCCAGGG + Intergenic
1122424140 14:101596000-101596022 CTCAGAGTCACCACTGGGCAAGG - Intergenic
1122500611 14:102196582-102196604 CCCGGAGGCAGCCCTGGCCGAGG + Intronic
1122574296 14:102732023-102732045 CCCAGAGCTGCCCCTGGGGATGG - Intergenic
1122921914 14:104883862-104883884 CTCAGAGGACCCCCTGGCCAAGG + Exonic
1125887906 15:43242625-43242647 CACAGAGCCTCTCCAGGCCAGGG + Intronic
1127309481 15:57739739-57739761 CCCACAGGCTCCCCTGGGCATGG + Intronic
1128857463 15:71031607-71031629 CCCATAGCCACCCCTTCCCCAGG + Intronic
1129367111 15:75062933-75062955 CCGAGAGCCAGCACTGGCCCAGG - Intronic
1129403630 15:75300585-75300607 CCCAGGGCCACCTCTCGCCTTGG + Intergenic
1129727586 15:77909420-77909442 CCCAGGGCCACCTCTTGCCTGGG - Intergenic
1130099426 15:80881199-80881221 CCTAGAGCGGCACCTGGCCAGGG - Intronic
1130282708 15:82532066-82532088 CCCAGGGCCACCCCTCGCCTTGG + Intergenic
1130919223 15:88330171-88330193 CCCAGAAGCACCTCTGTCCAAGG + Intergenic
1132070821 15:98775394-98775416 CCCAGTCCCACCCCTGGAAATGG - Intronic
1132481351 16:167676-167698 CCCAGAGCCAACCCTATTCAGGG - Intergenic
1132556098 16:573338-573360 CCCACAGCCACCCCAGGGCAGGG - Intronic
1132676970 16:1124909-1124931 CCGAGCCCCACACCTGGCCAGGG - Intergenic
1132700714 16:1220947-1220969 CCCTCAGCCACCCCTGCCCCAGG + Exonic
1132973605 16:2700868-2700890 CCCAGAGTCACCCCGGCCCCCGG - Intronic
1133119074 16:3595317-3595339 CCCAGAGCCTGCCCTGTCCTGGG - Intronic
1133136204 16:3713876-3713898 CACAGAGCCAGCCCTGGGCCTGG - Intronic
1133222288 16:4323947-4323969 CCCTGTGCCACCCCTGGCTGTGG - Intronic
1133238734 16:4402577-4402599 GACAGCGCCACCCCTGGGCAGGG + Intronic
1133390430 16:5405760-5405782 CCCAAAGCAATCACTGGCCAAGG - Intergenic
1134109645 16:11507091-11507113 CCCTGAGCCACCCCTGCCAGGGG + Intronic
1137671906 16:50284092-50284114 CCCAGAGGCACCCCCTGCCCGGG - Intronic
1138434259 16:56988619-56988641 CCCACACCCACCCCAGGCCTGGG + Intergenic
1138650846 16:58460456-58460478 GCCAGTGCCACCCCTGGACGTGG - Intergenic
1139513254 16:67439210-67439232 GGCAGAGCCTCCCCAGGCCAGGG + Intronic
1139947309 16:70650153-70650175 GCCAGTGCCACCCCTGACCTTGG - Intronic
1140043346 16:71424111-71424133 CTCATAGCCACCCCTGCCCCTGG + Intergenic
1140587394 16:76309444-76309466 CCTACAGCCTCCCCTAGCCAAGG - Intronic
1141465980 16:84206128-84206150 CCCAGAGAAAGGCCTGGCCATGG + Intergenic
1141609867 16:85175265-85175287 CCCAGACACAGCCCTGGCGAAGG - Intronic
1141731441 16:85825538-85825560 CCCACGCCCACCCCTGGCCTGGG - Intergenic
1141754668 16:85983277-85983299 CCCAGAGCCAACCCAGGGCCAGG + Intergenic
1141812530 16:86385137-86385159 CTCCGAGCCATCCCTGGCCTGGG + Intergenic
1142023875 16:87801934-87801956 ACGAGAGCCACCCCTCACCAGGG + Intergenic
1142265963 16:89064067-89064089 CCCGGAGCCACCCATGCCCCTGG - Intergenic
1142305914 16:89285521-89285543 CCCAGAGCCACAGAAGGCCACGG - Exonic
1142973804 17:3631084-3631106 CCAAGAGCTGCCCCTGACCAAGG - Intronic
1143393301 17:6573130-6573152 CCCAGAGACAGCCCAGGCTAGGG + Intergenic
1143485425 17:7251442-7251464 CAGAAAGCCACCCCTGGCGAGGG + Exonic
1143509383 17:7387105-7387127 CACAGAGGCACCCCTGCCCGGGG + Exonic
1143584528 17:7844621-7844643 CCCAGAGCCGCCGGTGGCCACGG - Intronic
1143747747 17:9005944-9005966 CCCAGAGGCCCCCCTTGGCAAGG + Intergenic
1144737847 17:17564840-17564862 CCCAAGGCCCTCCCTGGCCAGGG - Intronic
1144761589 17:17710472-17710494 CCCAGAGACCCTCCTGGCCCTGG + Intronic
1145056729 17:19707990-19708012 CCCACAGGCACCTCTGGCCATGG + Intronic
1145910074 17:28537285-28537307 CCCGGAGCCACCACTGCCCGGGG - Exonic
1146279773 17:31537599-31537621 CCCAGAGGAAGCCCTGTCCATGG + Exonic
1147248606 17:39139135-39139157 CCCAGAACTGCCCCAGGCCAAGG + Intronic
1147263139 17:39220264-39220286 CCCAGAGCCACACTTGGTCCTGG - Intronic
1147322559 17:39654971-39654993 CCTAGGGCCATCCATGGCCATGG - Intronic
1147862148 17:43530013-43530035 TCCAGAGGGACTCCTGGCCAGGG + Intronic
1147862743 17:43533194-43533216 CCCCGAGGTACCCATGGCCAGGG + Exonic
1147989257 17:44323326-44323348 CCCAGTGACACCCCTGGACGTGG - Exonic
1148116116 17:45176079-45176101 CCAGGACCCATCCCTGGCCAGGG + Intergenic
1148386468 17:47238194-47238216 CCTGGAGGCACCCCTGGGCAGGG - Intergenic
1148759798 17:49993755-49993777 CCCAGAGCCAGAACTGGCCGCGG + Intronic
1148829350 17:50420341-50420363 CCCAGCGCCACACCTGGGCCTGG - Intergenic
1149862865 17:60133675-60133697 CCCACCACCACGCCTGGCCATGG - Intergenic
1149864421 17:60142718-60142740 CCCAGGGCCACACCTGGAGAAGG + Intergenic
1149909390 17:60553103-60553125 CCAAGAGCCAGGCATGGCCAGGG + Intergenic
1149997468 17:61412495-61412517 CCCAGAGCCCGCCCAGGCCTCGG + Exonic
1150265817 17:63831832-63831854 CCCAGAGCCACCACTGGCAAAGG - Intronic
1150271874 17:63872071-63872093 CCCAGTGCCTCTCCTGGCCCTGG - Exonic
1150278846 17:63917257-63917279 CCCAGTGCCTCTCCTGGCCCTGG - Exonic
1150928661 17:69560913-69560935 CAGAGAGCCACCACTTGCCAAGG - Intergenic
1151314135 17:73311553-73311575 CTCAGCGGCACCCTTGGCCAGGG + Intronic
1151424923 17:74024762-74024784 CCCAGAGGCACGCAGGGCCAGGG - Intergenic
1151463822 17:74271930-74271952 CTGAGAGCCGCCCCTGGCCCTGG - Intergenic
1151723631 17:75872678-75872700 CCCACAGGCGCCCCTCGCCAGGG - Intergenic
1152032760 17:77854212-77854234 CAGAGAGCCTGCCCTGGCCAAGG + Intergenic
1152228709 17:79104269-79104291 CCCCCTCCCACCCCTGGCCATGG + Intronic
1152938014 17:83151982-83152004 CCCAGAGCCCCAGCTGCCCATGG - Intergenic
1153377190 18:4393770-4393792 CCCAGAACCACCCCTGCCCCCGG - Intronic
1153971149 18:10228510-10228532 GCCAGAGCCTCCCCTTGCCTGGG + Intergenic
1154218109 18:12430172-12430194 CCCATGGCCACCCCTGGCTTGGG - Intronic
1155786947 18:29913759-29913781 CCCAGAGGCACCTCTGGTCGGGG + Intergenic
1156266353 18:35491556-35491578 ACCAGAGACACCCCTGCCCCAGG + Intronic
1157490589 18:48121025-48121047 CCCAGAGCTGCCCCTGGTCTTGG + Intronic
1158074203 18:53510059-53510081 ATCAGAGCCACCGCTGTCCATGG + Intronic
1158934834 18:62354775-62354797 GCCCCAGCAACCCCTGGCCATGG - Intronic
1159026045 18:63183083-63183105 CTCAGACCCACCCCTTGCTATGG + Intronic
1159053449 18:63443017-63443039 CCCATGGCCACCCCCTGCCAGGG - Intergenic
1159955648 18:74516687-74516709 CCCAGAGCCGCCCCTTACCATGG + Intronic
1160408604 18:78659807-78659829 CCCACAGCCACCCTGGGGCATGG + Intergenic
1160474503 18:79170218-79170240 CCCAGAGCCACACTGGGCCTGGG + Intronic
1160682728 19:419222-419244 TCCAGAACCACCCATGGGCACGG + Intronic
1161120794 19:2525189-2525211 CCCACAGCTTCCCCGGGCCACGG - Intronic
1161144839 19:2671341-2671363 CTCAGAGCCACCGGTGTCCAGGG - Intronic
1161331801 19:3692099-3692121 CTCAGAGCCGGCCCTGCCCATGG - Intronic
1161469493 19:4449193-4449215 CAGAGAGCCACCCATGGCCTGGG + Intronic
1161614936 19:5264870-5264892 CCCAGAGCCAACGCCTGCCACGG + Intronic
1161709758 19:5841459-5841481 TCCAGTGCCTTCCCTGGCCAGGG + Intergenic
1161898217 19:7098833-7098855 CCCAGAGCCACGCCGAGCCCAGG + Intergenic
1162416793 19:10543541-10543563 CCCAGAACCCGCCCTGGCCTGGG - Intergenic
1162540820 19:11294925-11294947 CCCAGACACACCCCAGCCCAGGG + Intergenic
1162661426 19:12172322-12172344 CCCAGAGCCACACCAGGACAGGG - Intronic
1162831427 19:13286866-13286888 CCAAGACCCACCCCTGGCAGAGG - Exonic
1162840084 19:13349905-13349927 CCCAGAGCCTTCTCTGGCCCAGG + Intronic
1163237625 19:16038582-16038604 CCCAGGCCTCCCCCTGGCCATGG - Intergenic
1163417412 19:17195081-17195103 CACAGAGCAACCCCAGGCCATGG + Exonic
1163714783 19:18867423-18867445 CACAGGGCCAGTCCTGGCCAAGG - Exonic
1163721699 19:18900974-18900996 CCCAGAGCCCGACCTGCCCACGG + Intronic
1163724229 19:18913446-18913468 CCCAGGGTCTCCCCTGGCCAGGG - Intronic
1163775154 19:19213094-19213116 CCCAGAGCCAACCCTCTCCCTGG - Intronic
1164696514 19:30248752-30248774 CTCAGAACCACTGCTGGCCAAGG - Intronic
1165246292 19:34500286-34500308 CCCACACCCACCCCGGCCCAGGG - Exonic
1166083271 19:40458312-40458334 CCCAGCGCCACCCCCGCCCCCGG - Intronic
1166185361 19:41135797-41135819 CCCAGAGCCAGCCTAGGTCAGGG + Intergenic
1166252085 19:41578094-41578116 CCCAGAGCCCCATCTGGGCAAGG + Intronic
1166255615 19:41602070-41602092 CCCAGAGCCTCATCTGGGCAAGG + Intronic
1166338130 19:42121506-42121528 CCCTCAGCCACCACTGGTCAGGG + Intronic
1166415572 19:42592969-42592991 CCCAGAGCCTCATCTGGGCAAGG - Intronic
1166420253 19:42631173-42631195 CCCAGAGCCTCATCTGGGCATGG - Intronic
1166976609 19:46608597-46608619 CTCAGAGCCGCCCCTGGAGAGGG - Intronic
1167166672 19:47803656-47803678 CCCAGGCCCTCCCCTGGCCCTGG - Exonic
1167175165 19:47860108-47860130 CCCAGGCCCTCCCCTGGCCCTGG + Intergenic
1167291828 19:48629020-48629042 CCCAGACCCAGCCCCGCCCATGG + Exonic
1167411678 19:49347696-49347718 CCCTGACCCTCCCCTGGTCATGG + Intronic
1167609923 19:50502072-50502094 CCCAGAGACAAGGCTGGCCACGG - Intergenic
1167757610 19:51422147-51422169 CCCAGAGCCCGCGCTGTCCATGG + Intergenic
1168650082 19:58087092-58087114 CTAGGAGCCAGCCCTGGCCAGGG + Intronic
925203883 2:1990614-1990636 CATCGAGACACCCCTGGCCATGG - Intronic
926626630 2:15095974-15095996 GCCAGAGCCACCCCCAGCCCAGG + Intergenic
927600251 2:24434604-24434626 CCCAGAGTCAGCCTTGCCCAAGG - Intergenic
927637858 2:24828958-24828980 TCCAGAGCCTACCTTGGCCAGGG - Intronic
928175801 2:29033628-29033650 CCCAGAGCCACCCCTGGCCATGG - Intronic
928359674 2:30653035-30653057 GCCAGAGTCACGCCTGGTCAGGG + Intergenic
929053758 2:37858697-37858719 CCCAGAGGACCCCCTGTCCAGGG - Intergenic
929535991 2:42784420-42784442 CACAGCCCCACCCCTTGCCAAGG - Intronic
931858531 2:66329401-66329423 CCTAGAGACAGCCCTGCCCAGGG - Intergenic
932263434 2:70345878-70345900 CACAGAGAGACCCATGGCCATGG - Intergenic
934568001 2:95351181-95351203 CGGAGGTCCACCCCTGGCCAGGG - Intronic
935056192 2:99569587-99569609 GGCAGAGTCACCGCTGGCCAGGG - Intronic
936279011 2:111122091-111122113 CGAAGAGCCACCCCTGGCCGCGG - Intronic
936332653 2:111561740-111561762 GCAAGCGCCAGCCCTGGCCAAGG - Intergenic
937236498 2:120434540-120434562 CCCAGCGCCCACCCTGGCCCTGG - Intergenic
937324909 2:120984793-120984815 CCCAGGGCCACCCCTTGCCACGG + Intronic
937882332 2:126877855-126877877 CACAGAGCCACCTCCCGCCACGG + Intergenic
938063661 2:128269888-128269910 CCCACCCCCACCCCTGCCCAGGG - Intronic
938130952 2:128715304-128715326 CTCAAAGCCACCCCAGGGCAAGG - Intergenic
938135169 2:128750735-128750757 CCTAGAGCCAGCCCTGGGCCGGG + Intergenic
939997380 2:148932517-148932539 CCCAGCGCCAACCCTGGGTATGG - Intronic
940114464 2:150192720-150192742 CCCACAGCCACCCCTTCCCCAGG - Intergenic
940126441 2:150330997-150331019 CCCAGCGCCACATCAGGCCATGG - Intergenic
940912939 2:159224938-159224960 CCCAGAGCTGCTCCTGACCAAGG - Intronic
941186711 2:162327518-162327540 AACAGAACCTCCCCTGGCCAGGG - Intronic
944094759 2:195953530-195953552 CCCACAGCCGCCCCTTCCCATGG + Intronic
945466105 2:210171636-210171658 CCCAGTGCCATCCCTGGCGAGGG + Intergenic
946167852 2:217876302-217876324 CACAGCGCCACCCCTACCCATGG + Intronic
947543464 2:230994231-230994253 CCCAGAGCCTCCTTAGGCCAAGG + Intergenic
947722690 2:232379264-232379286 GCCTGAGATACCCCTGGCCATGG + Exonic
947736180 2:232456644-232456666 GCCTGAGACGCCCCTGGCCATGG + Exonic
947893029 2:233643326-233643348 GCCACTGCCACCCCTGGCCATGG + Intronic
948116193 2:235495366-235495388 CCGAGAGCCAGCCCTAGCCGCGG + Intronic
948351906 2:237347688-237347710 CCCTGTGCTATCCCTGGCCAGGG + Intronic
948462055 2:238134491-238134513 TCCAGACCTACCCCAGGCCAAGG - Intergenic
948468468 2:238163224-238163246 CCCACAGTCACCACTGGCCAGGG + Intronic
948484312 2:238270862-238270884 CCCAAAGCCAGCCCTGGTCAAGG + Intronic
948653497 2:239463282-239463304 CTCAGCGTCACCCCTGTCCATGG - Intergenic
948664997 2:239529105-239529127 CCCTGAGCCTCCCCTGCCCATGG - Intergenic
948825535 2:240571911-240571933 CCCAGAGCCACCCTGAGCCCAGG - Intronic
948855342 2:240727703-240727725 CCCTGAGCCACCCTGGGACAGGG - Intronic
948877738 2:240839172-240839194 GACAAAGCCAACCCTGGCCATGG - Intergenic
948920319 2:241063310-241063332 CCCAGGGCCACGACTGGGCACGG - Intronic
948988480 2:241540221-241540243 CCCAGGGCCACCTCTGCCCCAGG - Intergenic
949027803 2:241774540-241774562 CCCAGGGCCACCTCGGGGCAGGG - Intergenic
949045771 2:241872073-241872095 GCCAGTGCCACCCCAGGCCGTGG - Exonic
1168971723 20:1935820-1935842 CCAGGTGCCAGCCCTGGCCAGGG + Intronic
1169131177 20:3167052-3167074 CCCGGACCCCCGCCTGGCCATGG - Exonic
1169351423 20:4871348-4871370 CTCAGATCCTTCCCTGGCCAGGG - Intronic
1170145617 20:13170742-13170764 GCCAGACCTATCCCTGGCCATGG - Intergenic
1170773832 20:19358193-19358215 CCCAAAGGCACCCCAGGTCATGG - Intronic
1171154922 20:22863041-22863063 CTGAGAGCCTGCCCTGGCCACGG - Intergenic
1171418223 20:24998236-24998258 CAGGGAGCCACCCCTGGCTATGG - Intergenic
1172123335 20:32611134-32611156 CCCAGAGCCACCTCTTCCCCAGG - Intergenic
1172779118 20:37425256-37425278 CCCTCCGCCACCCCTGGCCTGGG - Intergenic
1173189195 20:40863255-40863277 CCCAGAGCCTGTCCTGACCAGGG - Intergenic
1173664940 20:44756798-44756820 TCCAGAGACACCCCCCGCCAGGG + Intronic
1174389369 20:50208352-50208374 GGCAGAGCCACCCTAGGCCAGGG - Intergenic
1175083018 20:56437157-56437179 CCCACAGGCACTCCTGGCCAGGG + Exonic
1175253149 20:57621868-57621890 CCCAGAGCCATCCGTAGTCACGG + Intergenic
1175520765 20:59601453-59601475 TCCAAATCCACCCCTTGCCAGGG + Intronic
1176520149 21:7818245-7818267 CCCAGAGCCACTCCTTCCCCTGG + Exonic
1178468460 21:32870586-32870608 CTCAGAGCCACACTAGGCCATGG + Intergenic
1178540128 21:33442401-33442423 CTCAGAGCCACCCGTTGCTAAGG + Intronic
1178654175 21:34448257-34448279 CCCAGAGCCACTCCTTCCCCTGG + Intergenic
1179590349 21:42404017-42404039 CCTGGAGCCCCTCCTGGCCATGG + Exonic
1180033150 21:45225924-45225946 CCCCGAGCAACCACTGGCCTCGG - Exonic
1180093385 21:45543441-45543463 CCCAGACTCACCCCTCGCCTGGG - Intronic
1180233866 21:46444555-46444577 CCCAGAGTCACCCATCCCCACGG + Intronic
1180553224 22:16557546-16557568 CCCACAGCCAGCTCTGCCCAAGG - Intergenic
1180758584 22:18181135-18181157 CCCAAGGCCTCCCCTGGCCCTGG - Intergenic
1180768871 22:18364927-18364949 CCCAAGGCCTCCCCTGGCCCTGG - Intergenic
1180777441 22:18497468-18497490 CCCAAGGCCTCCCCTGGCCCTGG + Intergenic
1180783528 22:18534791-18534813 CCCTGAGCCAGCCCTCCCCAGGG + Intergenic
1180810161 22:18754778-18754800 CCCAAGGCCTCCCCTGGCCCTGG + Intergenic
1180826746 22:18868151-18868173 CCCAAGGCCTCCCCTGGCCCTGG - Intergenic
1180835103 22:18925854-18925876 CCCAGCCCCACCCCTAGCCTGGG + Intronic
1180932989 22:19606044-19606066 CCCAGAGACCCACCTGCCCAGGG + Intergenic
1181127095 22:20708842-20708864 CCCTGAGCCAGCCCTCCCCAGGG + Intronic
1181196305 22:21189030-21189052 CCCAAGGCCTCCCCTGGCCCTGG + Intergenic
1181213222 22:21304094-21304116 CCCAAGGCCTCCCCTGGCCCTGG - Intergenic
1181240430 22:21474143-21474165 CCCTGAGCCAGCCCTCCCCAGGG + Intergenic
1181387594 22:22557466-22557488 CCCAGCACCACCCCTGTCCCGGG - Exonic
1181673744 22:24438681-24438703 CCCAGAGGCAACTCAGGCCAAGG - Intronic
1181737304 22:24892139-24892161 CCCAGTGCCATCCTGGGCCAGGG - Intronic
1181855380 22:25777686-25777708 CCCAGCGCCACTCCAGCCCAGGG - Exonic
1182795215 22:32986805-32986827 TCCAGAGCTCCCCCAGGCCAAGG - Intronic
1183264746 22:36818277-36818299 CCCAGGGCCACCACAGCCCAAGG - Intronic
1184301762 22:43565006-43565028 CACAAAGCCCCCCCTGGCAAAGG - Intronic
1184303388 22:43577486-43577508 CCCAGAACAACTCCTGGCTAGGG - Intronic
1184333045 22:43838067-43838089 CCCAAAGCCATGGCTGGCCATGG + Intronic
1184778710 22:46635659-46635681 CTCCCAGCCACCCCTGTCCAGGG + Intronic
1185123061 22:48984918-48984940 CCCAGAGCGTCCCCCAGCCATGG + Intergenic
1185150346 22:49160597-49160619 CACAGAGCCACGCCTGGCGGGGG - Intergenic
1185156403 22:49195842-49195864 CCCATAGCCACCCCCAGACAAGG - Intergenic
1185300449 22:50077230-50077252 TCCAGAGCCCCTCCTGGCCGGGG + Intronic
1185344366 22:50304912-50304934 CCCAGAGCCTGCCTTGGACACGG - Intronic
1203230493 22_KI270731v1_random:105811-105833 CCCAAGGCCTCCCCTGGCCCTGG - Intergenic
1203276887 22_KI270734v1_random:94061-94083 CCCAAGGCCTCCCCTGGCCCTGG - Intergenic
1203285192 22_KI270734v1_random:151153-151175 CCCAGCCCCACCCCTAGCCTGGG + Intergenic
949453366 3:4211974-4211996 CCCACAGCCACCCCTTCCCCAGG - Intronic
949539482 3:5020835-5020857 CCTAGAGGAACCCCCGGCCATGG - Intergenic
950327041 3:12120591-12120613 CCCAAAACCACACCTGGCCATGG - Intronic
950577969 3:13844442-13844464 CTCAGGGCCTCCCCAGGCCATGG - Intronic
950728118 3:14932397-14932419 CCCAGAGCCAGCCCTGAGGAAGG - Intronic
952360845 3:32628615-32628637 CCCACCACCACACCTGGCCATGG + Intergenic
952848260 3:37706644-37706666 CTCAATGACACCCCTGGCCAGGG - Intronic
953840140 3:46383476-46383498 GCCTAAGCCACCCCTGCCCATGG - Intergenic
954148043 3:48643970-48643992 CCCAGAGTCTCCCATGGCCTGGG - Intronic
954214251 3:49115723-49115745 GCCAGAGACACACCTGGCCTCGG - Exonic
954301951 3:49704942-49704964 CCCTGAGCCAGCCCTGGTCCTGG + Intronic
954432683 3:50479634-50479656 GCCAGGTCCAACCCTGGCCAGGG + Intronic
954439990 3:50516570-50516592 CCCAGGCCCACCCCTGGGCCAGG + Intergenic
954677827 3:52325391-52325413 CCCAGAGCCCACCCAGGCCCTGG + Intronic
954879506 3:53823901-53823923 CTCAGAGCCTGCGCTGGCCAGGG + Exonic
955068427 3:55552256-55552278 CCCAACCCCACCCCTGGCCAAGG - Intronic
956001063 3:64730639-64730661 CCCAGAGTCACCCCTTCCAAAGG + Intergenic
957474890 3:80709976-80709998 CCCACAGCCACCCCTTCCCCTGG - Intergenic
960115030 3:113885130-113885152 CAGAAAGCCACCCCTGGCGAGGG - Intronic
961213646 3:125143672-125143694 CCTAGAGCCCTGCCTGGCCATGG + Intronic
961516865 3:127443576-127443598 CCCAAAGCCAGCCCTAGACAAGG + Intergenic
961627592 3:128274556-128274578 CCCAAGGCCACCCTGGGCCAGGG - Intronic
961682547 3:128608600-128608622 CCCAGAGCCCCACTTTGCCAAGG + Intergenic
962928184 3:140014104-140014126 CTCAGTGCCACCCCTGACAATGG - Intronic
963110479 3:141683908-141683930 CGCATAGCCAGCCCTGGCCCTGG + Intergenic
964442438 3:156726245-156726267 CCCAAAGCCACCCCTTGGCACGG - Intergenic
966561405 3:181324833-181324855 CCCACAGCCACCCCTTCCCCTGG + Intergenic
967557815 3:190878138-190878160 CGCAGAGCCCTCCCTGGCCCTGG - Intronic
967848413 3:194063090-194063112 CTCAGAGCCAGCCCTGGGCAAGG + Intergenic
968331535 3:197874600-197874622 CCCAGCTCCAGCCCTGTCCATGG + Intronic
968540304 4:1164940-1164962 CTCAGAGACACCCGTGGACATGG - Intergenic
968571873 4:1346520-1346542 CCCAGGGCCAGCCCGGGCCCAGG + Intergenic
968573912 4:1356139-1356161 CCCAAATCCAGCCCTGGCCTAGG + Intronic
968599269 4:1501515-1501537 CCCAGAGCTCTCCCTGGCCTGGG + Intergenic
968663762 4:1809922-1809944 CCCAGAGGCAGGCCTGGCCATGG + Intergenic
968895729 4:3401985-3402007 CCCAGCTCCACCCCTGGGAAGGG + Intronic
968964135 4:3761011-3761033 CAGAGAGCCAGCCCAGGCCACGG + Intergenic
970670046 4:18386231-18386253 CCAAAAGCCACACATGGCCAAGG + Intergenic
972480023 4:39488097-39488119 CCCAGAGCCTCCCCTGCCAGAGG + Intergenic
977014080 4:91670537-91670559 CCAAGAAACAGCCCTGGCCATGG - Intergenic
977060850 4:92255267-92255289 CTGAGAGCCACACCTGGCAAGGG - Intergenic
977187740 4:93961235-93961257 CCCATAGCCACTCCTCGGCAGGG + Intergenic
977561288 4:98536593-98536615 CCCATAGCCACCCCTTTCCCCGG + Intronic
979421441 4:120509657-120509679 CCCACAGCCACCCCTTCCCCAGG - Intergenic
979448050 4:120838565-120838587 CCCAGCCCCATCCCTGTCCATGG - Intronic
981051602 4:140314807-140314829 CCCAGTGGCACCCCTGGCCCTGG - Intronic
981348425 4:143700672-143700694 CCAGGAGCCATCCGTGGCCATGG - Exonic
981918849 4:150064732-150064754 CCCAGAGGCACCACTGACCCAGG - Intergenic
982325624 4:154125956-154125978 CCCACCGCCACCCCTGGGCTGGG - Intergenic
983248118 4:165311962-165311984 CCCCAACCCACCCCTGTCCATGG - Intronic
983560365 4:169095312-169095334 CCCAAAGCCACTACTGACCAAGG - Exonic
984945929 4:184968865-184968887 CCCAGGGCCTGCCCTGCCCAGGG - Intergenic
985292721 4:188403400-188403422 GCCAGAGCCAGCCCAGACCATGG - Intergenic
985386119 4:189450151-189450173 TCCAGAGGCACCCCTGTCCATGG + Intergenic
985510209 5:309236-309258 CCCTGACACACCCCTTGCCAAGG - Intronic
985656022 5:1131701-1131723 CCCAGAGCCTTGCCTAGCCATGG + Intergenic
985763787 5:1765722-1765744 ACCAGACCCAGCCCTGGCAATGG - Intergenic
986553596 5:8986248-8986270 CCCATAGCCATCCCAGGCCCTGG + Intergenic
986706909 5:10460123-10460145 CCCACAGCTTACCCTGGCCAGGG + Intronic
987032237 5:13986695-13986717 CCCCGAGACAACCCTGGCCCAGG + Intergenic
988709163 5:33756212-33756234 CCCAGTGCCACCAGAGGCCATGG - Intronic
991355695 5:65766960-65766982 GGCAGAGCCACCCAAGGCCATGG - Intronic
994143983 5:96372377-96372399 AGAAGAGCCACCCCTGGCCAAGG - Intergenic
995808616 5:116080722-116080744 CCCACAGCCACCCCTCCCCCAGG - Intergenic
996854240 5:127987246-127987268 CCCAGAGGAACCCGAGGCCATGG + Intergenic
997191917 5:131945523-131945545 TCCAGAGGCACCCGTGGCCTGGG - Intronic
999144897 5:149385864-149385886 CCCAGAGCCGCTCCTGGCAGAGG + Intronic
999318448 5:150599057-150599079 CCGAGGGCCACCCATGGGCAAGG + Intergenic
1001058931 5:168471733-168471755 CCCAAGGCTACCTCTGGCCATGG + Intronic
1001540603 5:172534970-172534992 CCCAGACCCCGCCCTAGCCAGGG + Intergenic
1004289450 6:14352838-14352860 CCCTGAGCCTCTCCTGGCCTGGG + Intergenic
1005093095 6:22079990-22080012 CCAAGAGCCACATGTGGCCACGG - Intergenic
1006298288 6:33179680-33179702 CCCAGAGCCTTCCCTTTCCAGGG + Intronic
1006645388 6:35511750-35511772 CCCAGACCCAGCCCAGGCCCGGG - Exonic
1006855073 6:37127092-37127114 CCCAGGGCCAGGGCTGGCCACGG + Intergenic
1007647713 6:43395770-43395792 CCCAGAGCCAGGCTGGGCCAGGG + Intergenic
1007777946 6:44234240-44234262 CCCAGGTCCAGTCCTGGCCAGGG - Intergenic
1008253055 6:49264597-49264619 AGCAGAGGCACCCCTGGTCACGG - Intergenic
1008475459 6:51931413-51931435 ACCAGACCCACCTCTGGCCCCGG + Intronic
1009725378 6:67530991-67531013 CCCAGAGGCAACCCTGGCAGTGG - Intergenic
1010916781 6:81628827-81628849 CCCAGTGCCAGCCCTCCCCAAGG - Intronic
1011621838 6:89250613-89250635 CCCAGTTCCAGCCCTGGCCCTGG + Intergenic
1017450273 6:154548539-154548561 CCCAAAGCCACTCCTGCCCCAGG + Intergenic
1017635183 6:156436437-156436459 CCCAGAGGGACCAATGGCCATGG - Intergenic
1018239883 6:161763354-161763376 CCGAGACCCACCCCTGTCCCTGG + Intronic
1019150821 6:170004505-170004527 GGCAGAGCTACCCATGGCCATGG - Intergenic
1019348719 7:543238-543260 CCCGGAGCCACCCCTGCCGAGGG + Intergenic
1019349015 7:544500-544522 CCCAGACCCAGCCCTTGCCTGGG + Intergenic
1019523404 7:1470405-1470427 CCCGGAGCCACCCCAGGGCTCGG + Exonic
1020100728 7:5393037-5393059 CTCAGAGCCAGCCCTGCCCGGGG - Intronic
1022645828 7:32227859-32227881 CCCAGATGCACCCCTCCCCAGGG - Intronic
1023829342 7:44029731-44029753 CCCAGAGCCACCTCTAGCCCAGG - Intergenic
1023940402 7:44765558-44765580 CCCAGCGACTACCCTGGCCAGGG + Exonic
1023994626 7:45151675-45151697 CCCAGAGCAACCCCTGACACCGG - Intergenic
1024003058 7:45203677-45203699 TCCAGAGCAACTTCTGGCCAAGG + Intergenic
1024243780 7:47454590-47454612 CCCAGAGCAGCCCCTCCCCATGG - Intronic
1024526538 7:50354323-50354345 ACCAGAGCCCCCACTAGCCAGGG + Intronic
1025041264 7:55647670-55647692 GCCAGAGCAACACCAGGCCAGGG - Intergenic
1025142744 7:56479276-56479298 CCCAGGACCACCACTGACCAGGG - Intergenic
1025610671 7:63073312-63073334 CCCAGAACCACCACTGCTCAAGG + Intergenic
1025708798 7:63889876-63889898 CCCAGGACCACCACTGACCAGGG - Intergenic
1026804971 7:73423941-73423963 CCCAGAGCCTCCCCCAGGCAGGG + Intergenic
1026835759 7:73638039-73638061 CCCTGAGCTCCCCATGGCCAGGG + Intergenic
1029522531 7:101072657-101072679 CCCAGAGCTTTCCGTGGCCAAGG + Intergenic
1029574902 7:101396945-101396967 CCCAGCGTCACCCCAGGCCTGGG - Intronic
1029739648 7:102483989-102484011 CCCAGAGCCACCTCTAGCCCAGG - Intronic
1029757649 7:102583168-102583190 CCCAGAGCCACCTCTAGCCCAGG - Intronic
1029775585 7:102682229-102682251 CCCAGAGCCACCTCTAGCCCAGG - Intergenic
1032477252 7:132220491-132220513 CCCAGAGCCCCTCCCTGCCATGG + Intronic
1032797412 7:135288938-135288960 CCCAGACCCACACCTGGGCCTGG + Intergenic
1033622911 7:143078037-143078059 GCCAGAGCAAGCCCTGCCCAAGG + Intergenic
1033843614 7:145404496-145404518 CCCGGTGCCACCTCTGGCAATGG - Intergenic
1034072295 7:148198178-148198200 CCCAGAGCCACCACCCCCCATGG + Intronic
1034990142 7:155542886-155542908 CCCAGACCCACCCCCGCCCGAGG + Intergenic
1034994557 7:155569918-155569940 CCCAGACCCAGCCGAGGCCAGGG + Intergenic
1034994565 7:155569935-155569957 CCCAGTGCCTCCGCTGGCCCTGG - Intergenic
1035418232 7:158706853-158706875 AGCAGAGGCACCGCTGGCCACGG - Intergenic
1035957208 8:4094323-4094345 CTCACAGCCACCTCTGGCCTGGG - Intronic
1036660450 8:10705045-10705067 CACAGTGCGTCCCCTGGCCACGG + Intronic
1037000151 8:13707586-13707608 TCTGGATCCACCCCTGGCCATGG - Intergenic
1037473971 8:19237971-19237993 ACCAGAGCCCTCCCTGGCCTAGG - Intergenic
1037817117 8:22118187-22118209 CCTAGTGTCACCCCTCGCCAAGG - Intronic
1037825998 8:22161008-22161030 ACCAGAGCCAGCCCTGTTCAGGG + Intronic
1037827625 8:22168614-22168636 CCCAGGGGGACGCCTGGCCAAGG + Intronic
1040284349 8:46092319-46092341 CCCAGAGCGCCCCCTGGGTAAGG + Intergenic
1044119008 8:88370913-88370935 CACACACCCACCCATGGCCAGGG - Intergenic
1044234014 8:89809414-89809436 TGCAGAGCCACCCAAGGCCATGG + Intergenic
1044595204 8:93952867-93952889 CCCACAGCCACCCCTTCCCCAGG + Intergenic
1044924371 8:97197403-97197425 CCCAGAGCCAAGGCTGGCCAAGG + Intergenic
1044940202 8:97334734-97334756 CCCAGAGCCGCCCCTTCCCCTGG + Intergenic
1045026181 8:98089254-98089276 CCAAGAACAGCCCCTGGCCAAGG + Exonic
1045034635 8:98167630-98167652 ACCACAGCCACCCCTGCCCCTGG - Intergenic
1045061912 8:98418390-98418412 CCCAGAGCCAACTCAGGCCCTGG + Intronic
1047382159 8:124373199-124373221 GCCAGTTCCACCCCTGCCCAAGG + Intergenic
1048372400 8:133790817-133790839 CCCAGAGCTACAGCTGTCCAAGG - Intergenic
1048866845 8:138767735-138767757 CACAGAGCCCCTCCAGGCCAAGG + Intronic
1049098697 8:140563986-140564008 GCCAGAGCCAGCCCAGGCCCAGG - Intronic
1049320344 8:141992859-141992881 CCCAGAGCCACACCCAGCCCTGG + Intergenic
1049477286 8:142802619-142802641 CCCAGAGCCACACCTGCCCTAGG - Intergenic
1049744177 8:144256226-144256248 CACACAGCCACGCCTGCCCAGGG - Intronic
1049830505 8:144698762-144698784 CCCTGACCCACTCATGGCCAAGG - Intergenic
1050091836 9:2023255-2023277 CCCAGAGTCAGACCTGGCAAAGG - Intronic
1050138166 9:2490180-2490202 ACCAGAGCCACATCTGGCAAGGG + Intergenic
1050655440 9:7823448-7823470 CTAAGAGTGACCCCTGGCCAAGG + Intronic
1053016996 9:34667561-34667583 GCCAGAGACAGCCCTGGCCTGGG - Intergenic
1053054545 9:34986771-34986793 CCCACCCCCACCCCTGCCCACGG + Intergenic
1053139955 9:35676081-35676103 CCCAGAGCCATCTCTAGCCCAGG - Exonic
1053431190 9:38042827-38042849 CCCAGAGCCTGGCCTGGCCTGGG - Intronic
1053620410 9:39809156-39809178 CCCAGAGACTCGCCTGCCCAGGG + Intergenic
1053626290 9:39874778-39874800 CCCAGAGACTCGCCTGCCCAGGG - Intergenic
1053723485 9:40973304-40973326 CCCAGGGCTACCCATGCCCATGG - Intergenic
1053878579 9:42568455-42568477 CCCAGAGACTCGCCTGCCCAGGG + Intergenic
1053894087 9:42725923-42725945 CCCAGAGACTCGCCTGCCCAGGG - Intergenic
1054217598 9:62375923-62375945 CCCAGAGACTCGCCTGCCCAGGG + Intergenic
1054233111 9:62533240-62533262 CCCAGAGACTCGCCTGCCCAGGG - Intergenic
1054263746 9:62898287-62898309 CCCAGAGACTCGCCTGCCCAGGG - Intergenic
1054342478 9:63878692-63878714 CCCAGGGCTACCCATGCCCATGG + Intergenic
1055144994 9:72922631-72922653 TTCAAAGCCATCCCTGGCCATGG + Intronic
1055270901 9:74557176-74557198 CCCAGAGCAATCCCAGGCAAAGG - Intronic
1056831096 9:89918148-89918170 CCCAGAGCAGCACCTGGCCAGGG + Intergenic
1057225194 9:93289326-93289348 CCCACAGCCACCCTCGGCCCTGG + Exonic
1057776968 9:98019175-98019197 CCCAGCGCCAGCCCTGGCAGAGG + Intergenic
1058626494 9:106939006-106939028 CCCTGACCCTCCCCAGGCCACGG + Exonic
1059152273 9:111959748-111959770 ACCAGAGCCACACCTCTCCATGG - Intergenic
1060424714 9:123494521-123494543 CCTTGAGCCACCCCTGACCAAGG - Intronic
1060827158 9:126693857-126693879 CCTAGGCCCACCCCTGGCCCCGG - Intronic
1060969671 9:127730950-127730972 ACCAGGGCCACCCAGGGCCAGGG + Exonic
1061179092 9:129013570-129013592 CCCAGAGCCAGCACTGCCCCTGG - Intronic
1061206473 9:129166852-129166874 CCCAGGACCACCCCTACCCAGGG - Intergenic
1061368766 9:130186317-130186339 CCCAGATGCACCCCAGACCAGGG - Intronic
1061401705 9:130372023-130372045 CCCAGAGCCAGGGGTGGCCAGGG + Intronic
1061520122 9:131112847-131112869 CCCAGAGCCACCCCTGGGAGTGG - Intronic
1061539512 9:131270516-131270538 CCCAGGACCAGCCCTGGCCAAGG - Intronic
1062136764 9:134933223-134933245 CCCAGTGGCAGCCCAGGCCAGGG + Intergenic
1062162776 9:135088895-135088917 CCCAGAAGCAGCCCCGGCCACGG - Intronic
1062286170 9:135773473-135773495 CCCTGTGCAACCCCTGGGCAAGG + Intronic
1062339850 9:136089192-136089214 CCCAGAGCCTCCCCCTGCCAGGG + Intronic
1062350722 9:136137453-136137475 CCCGGAGTCTCCCCTGCCCAGGG + Intergenic
1062398807 9:136363530-136363552 CCCAGAGCCGCCGCGGGCCCCGG + Exonic
1062403220 9:136381540-136381562 CCCACAGCCACGCCTGGACAAGG + Intronic
1062454955 9:136631678-136631700 CACACAGCCACCCGGGGCCAGGG + Intergenic
1062565910 9:137163935-137163957 CCCAGGGCCCGGCCTGGCCACGG + Intronic
1062602354 9:137323623-137323645 CCCAGACCCACCACTGTCTAGGG + Intronic
1062631603 9:137465484-137465506 CTCGGAGCCACCTCTGCCCATGG + Intronic
1185894312 X:3844029-3844051 CCCAGGGCCGCGCCTGCCCACGG - Intergenic
1185899431 X:3882453-3882475 CCCAGGGCCGCGCCTGCCCACGG - Intergenic
1185904548 X:3920882-3920904 CCCAGGGCCGCGCCTGCCCACGG - Intergenic
1190495035 X:51020668-51020690 CCCATAGCCACCCCTTCCCCAGG + Intergenic
1190691301 X:52915661-52915683 CCCAGAGCCCCCACAGGGCATGG - Intergenic
1190694682 X:52940131-52940153 CCCAGAGCCCCCACAGGGCATGG + Intronic
1191153301 X:57243295-57243317 CCCACAGCCACCCCTTTCCCAGG - Intergenic
1191762576 X:64661795-64661817 CCCATAGCCACCCCTTCCCCAGG + Intergenic
1191839546 X:65501921-65501943 CCCTGTGCCACACTTGGCCAGGG - Exonic
1192953124 X:76039214-76039236 CCCACAGCCACCCCTCCCCCAGG + Intergenic
1193724223 X:85020952-85020974 TCCAGAGCCACCCCAGGGCAAGG + Intronic
1198310531 X:135423695-135423717 CCCAGGGGCACCTCTGGCCCTGG + Intergenic
1200060221 X:153480723-153480745 CTCAGGGCCAGCCCTGGCCTGGG - Intronic
1200106616 X:153717155-153717177 CCCAGAGCTATCCCAGGCCCTGG - Intronic
1200177417 X:154126549-154126571 CCCACAGCCACCACTGCCCCAGG - Intergenic
1200232477 X:154450971-154450993 ACCAGAGCCACCACCGCCCAAGG - Intergenic
1200787562 Y:7273789-7273811 CCCAGCGCCGCCCCTGCCCTTGG + Intergenic
1202368520 Y:24182674-24182696 GCCAGAGCCACGTGTGGCCAAGG - Intergenic
1202502265 Y:25487443-25487465 GCCAGAGCCACGTGTGGCCAAGG + Intergenic