ID: 928175805

View in Genome Browser
Species Human (GRCh38)
Location 2:29033634-29033656
Sequence GTCCACCCCAGAGCCACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 284}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928175805_928175810 11 Left 928175805 2:29033634-29033656 CCAGGGGTGGCTCTGGGGTGGAC 0: 1
1: 0
2: 4
3: 26
4: 284
Right 928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG 0: 1
1: 0
2: 0
3: 4
4: 55
928175805_928175811 12 Left 928175805 2:29033634-29033656 CCAGGGGTGGCTCTGGGGTGGAC 0: 1
1: 0
2: 4
3: 26
4: 284
Right 928175811 2:29033669-29033691 GGTATCGCTGAGACCTAGTTGGG 0: 1
1: 0
2: 0
3: 2
4: 23
928175805_928175809 -9 Left 928175805 2:29033634-29033656 CCAGGGGTGGCTCTGGGGTGGAC 0: 1
1: 0
2: 4
3: 26
4: 284
Right 928175809 2:29033648-29033670 GGGGTGGACATATGGATCTGGGG 0: 1
1: 0
2: 1
3: 14
4: 223
928175805_928175808 -10 Left 928175805 2:29033634-29033656 CCAGGGGTGGCTCTGGGGTGGAC 0: 1
1: 0
2: 4
3: 26
4: 284
Right 928175808 2:29033647-29033669 TGGGGTGGACATATGGATCTGGG 0: 1
1: 0
2: 2
3: 16
4: 160
928175805_928175812 13 Left 928175805 2:29033634-29033656 CCAGGGGTGGCTCTGGGGTGGAC 0: 1
1: 0
2: 4
3: 26
4: 284
Right 928175812 2:29033670-29033692 GTATCGCTGAGACCTAGTTGGGG 0: 1
1: 0
2: 0
3: 1
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928175805 Original CRISPR GTCCACCCCAGAGCCACCCC TGG (reversed) Intronic
902396696 1:16135759-16135781 GTCCTGCCCAGAGCCCCCCAAGG - Exonic
902990883 1:20186257-20186279 GGCCTCCCCAGACCCAGCCCGGG + Intronic
903236040 1:21951414-21951436 CTCCAAGCCAGAGCCACTCCGGG + Intergenic
903260033 1:22126603-22126625 GGCCAGACCAGACCCACCCCGGG - Intronic
903330969 1:22597222-22597244 CCCCACCCCAGACCCATCCCAGG + Intronic
904497028 1:30892907-30892929 ATCCTCCCCTGAGCCTCCCCCGG + Intronic
904827880 1:33286887-33286909 GTCCAAAACAGAGCCAGCCCCGG + Intronic
905032906 1:34899711-34899733 TCCCACCCCGGATCCACCCCCGG - Exonic
905179174 1:36156073-36156095 GTCCACCCCAGCAGCGCCCCGGG - Intronic
905936607 1:41828999-41829021 GGCCACCCCTGAGCCAGCTCAGG - Intronic
906954184 1:50358887-50358909 GCCCACCCGAGAGCCACACGGGG + Intergenic
907919195 1:58896967-58896989 GTCTCCCCCAGAGCCTTCCCAGG + Intergenic
912213403 1:107579954-107579976 GTCCAGCCCAGACCCCTCCCAGG + Intronic
916080565 1:161229461-161229483 TTCCATCCCAGAGCCTCCCAAGG + Exonic
918030151 1:180799725-180799747 CTGAACCCCAGAGTCACCCCTGG - Intronic
918192758 1:182191921-182191943 TTCCACCCCAGAGTTCCCCCTGG - Intergenic
918372981 1:183880521-183880543 GTGGACCCCAGGGGCACCCCTGG - Intronic
919900721 1:202042511-202042533 GACCACCCTAGTGCCAACCCAGG - Intergenic
921023956 1:211260204-211260226 GTCCACCCCAAACCAAGCCCAGG - Intronic
921031648 1:211339724-211339746 GGCTACCCCAGACACACCCCAGG - Intronic
924639071 1:245816290-245816312 GTCCACCCCCTAGCCACCCCGGG - Intronic
1063257307 10:4342419-4342441 GTCCTCCCCATTCCCACCCCTGG - Intergenic
1064158019 10:12919745-12919767 GCCCACCCCCCACCCACCCCGGG - Intronic
1064179422 10:13101170-13101192 GTCCACTCCAGGGCAATCCCTGG - Intronic
1065343089 10:24723991-24724013 TTCAGCCCCAGAGCCTCCCCTGG - Intergenic
1065879469 10:30026772-30026794 CTGCACCCCAGAGTCCCCCCAGG - Exonic
1067532200 10:47082230-47082252 GTCCACCTCATAACCACCCAGGG - Intergenic
1067555217 10:47264857-47264879 CTCCAGCCCAGAGGCCCCCCGGG - Intergenic
1067825100 10:49565690-49565712 GTCAAGCCCAGAGCCACACCAGG + Intergenic
1068827092 10:61452707-61452729 GGGCACCCCAGGGCCACCCTAGG - Intronic
1069831392 10:71284366-71284388 GTGCAGCTCAGAGCCACTCCTGG + Intronic
1069911927 10:71765225-71765247 TCCTACCCCAGAGCCACCCCAGG + Intronic
1070528877 10:77318901-77318923 GCCCACCCCACATCCTCCCCTGG + Intronic
1070646308 10:78204496-78204518 GCCCCTCCCAGAACCACCCCTGG - Intergenic
1072188610 10:93063422-93063444 GTCCAGCCCAGCGCCAGCCCCGG + Intronic
1073469044 10:103711528-103711550 GTCCACCTCAGAGCTGCACCGGG + Intronic
1073606379 10:104899982-104900004 GTCTGCCCCAGAGCCTCCCTGGG + Intronic
1076628068 10:131834078-131834100 GTCCAGCCCACAGCAGCCCCAGG + Intergenic
1076795154 10:132794745-132794767 GTCCACCCCAGGGCCTCACCGGG + Intergenic
1077014097 11:392394-392416 GTCCACCCCAGGCCCACCTGGGG - Intergenic
1077160341 11:1109754-1109776 GTCCAGCCTCCAGCCACCCCAGG - Intergenic
1077440624 11:2567062-2567084 GTCTCCCCCAGAGCCTCCCGTGG - Intronic
1077533485 11:3108057-3108079 CTCCATCCCAGACCCACCCCTGG + Intronic
1077719171 11:4609723-4609745 GTCCACGACAGAGCCTCACCTGG - Intergenic
1079507489 11:21169837-21169859 TTGCACCCCAGAGTCCCCCCAGG + Intronic
1083328448 11:61885634-61885656 TTCCACCCCAGAGACACAGCAGG + Intronic
1083890863 11:65595230-65595252 GGCCTCCCCAGTCCCACCCCAGG - Intronic
1084412653 11:69013379-69013401 GCCCCCCCCAGAGCCCCACCGGG + Exonic
1084933641 11:72575627-72575649 CTCCACACCAGATCCAGCCCCGG - Intergenic
1085198520 11:74687068-74687090 GTCCACCTCCGCTCCACCCCAGG - Intergenic
1088736398 11:112731318-112731340 GTCCACCGAAGAGCCTCTCCAGG - Intergenic
1088794989 11:113260302-113260324 GCCCAGCCCACAGCCATCCCAGG + Exonic
1089112159 11:116065465-116065487 GTCATCCCTAGAGACACCCCAGG + Intergenic
1089628840 11:119770749-119770771 GTCCAGCCCAGTGCCAACACAGG - Intergenic
1090445321 11:126759966-126759988 GCCAACCCCAGCGCAACCCCAGG + Intronic
1090746700 11:129711093-129711115 TTCCACCCAAGAGGCACCACTGG + Intergenic
1091603783 12:1933915-1933937 GTCCACGGCAGAGCCAAACCAGG + Intergenic
1091822769 12:3489069-3489091 ATCCAACCCAGAGCCAGCCTGGG - Intronic
1091830952 12:3551051-3551073 GGCCATCCCATAGCCAGCCCTGG + Intronic
1092131897 12:6118728-6118750 GACAACCCCAGAGCCATCACAGG + Intronic
1097187899 12:57205306-57205328 GCCCTCCCTTGAGCCACCCCAGG - Intronic
1097194649 12:57236758-57236780 GCCCACCCCAACCCCACCCCGGG + Intronic
1098201904 12:68064648-68064670 GTCCACCTGAGAGCCACACGGGG - Intergenic
1099365270 12:81759522-81759544 GTCTCCCCCAGAGCCGCTCCCGG + Intronic
1099502732 12:83433030-83433052 GTCCACCTGAGAGCCACACAGGG - Intergenic
1101745660 12:107539507-107539529 GTGCACCCCAAAGGGACCCCAGG + Intronic
1102058403 12:109914029-109914051 GACCACCCCAGCTCCACCTCTGG + Intronic
1102241136 12:111325567-111325589 GTCTACCCCAGAGCCTACCTGGG + Intronic
1103781987 12:123404936-123404958 TTCCACCACAAAGTCACCCCGGG - Exonic
1104726804 12:131082912-131082934 CTCAAACTCAGAGCCACCCCTGG + Intronic
1104805278 12:131585980-131586002 GTCCACCCCAGGAGCCCCCCTGG + Intergenic
1104963213 12:132497935-132497957 GTCCTCCCCGGCCCCACCCCAGG + Intronic
1105217627 13:18298384-18298406 TTCCACCACAAAGGCACCCCGGG - Intergenic
1106410282 13:29506519-29506541 GAACACCCCAGGGCCACCTCTGG + Intergenic
1107250032 13:38349470-38349492 GTCCGCCCCAGCCCCGCCCCCGG + Intergenic
1107542458 13:41403821-41403843 GTCCTCCCCAGGGCCCCACCAGG - Intergenic
1107630830 13:42341517-42341539 CCCCACTCCAGAGCCAGCCCTGG - Intergenic
1108880416 13:55107628-55107650 GTCCACCTAAGAGCCACACAGGG + Intergenic
1113779008 13:112965399-112965421 CTGCACCTCAGAGCCAGCCCTGG + Intronic
1113809030 13:113126409-113126431 ATCCACCCCCGAGCATCCCCAGG - Intronic
1113957457 13:114106993-114107015 GGCCCCCCCAGAGCCACATCTGG + Intronic
1119484395 14:74978427-74978449 GGCCACCCCAGAGCCAGAGCTGG - Intergenic
1119620990 14:76131684-76131706 CTCCTCCCCAGAGGCACCACAGG + Intergenic
1120307520 14:82789449-82789471 ATCCACCCCAGCCCCAACCCTGG - Intergenic
1120523971 14:85556433-85556455 GTCCTCCCCAGATCAAGCCCAGG - Intronic
1121257248 14:92539897-92539919 CACCACGCCAGACCCACCCCAGG - Intronic
1121833027 14:97068054-97068076 ATACACCCCAAAGCCAGCCCTGG - Intergenic
1122151653 14:99729150-99729172 GTCCAGGCCAGAGCCACAGCTGG + Intergenic
1122907028 14:104806306-104806328 CTCCACTCCACAGACACCCCTGG + Intergenic
1123948871 15:25251919-25251941 AACCACCCCAGGGCCACACCAGG - Intergenic
1124014075 15:25861953-25861975 GTCCATCGCAGGGTCACCCCTGG + Intronic
1124220834 15:27848310-27848332 GTGAACCCCACAACCACCCCAGG - Intronic
1124688067 15:31799098-31799120 ATCCACCCCAGACTCACTCCTGG - Intronic
1128462513 15:67881867-67881889 GCCCACCTTAGAGCCAGCCCTGG + Intergenic
1129597020 15:76973316-76973338 GTTCCCCTCAGACCCACCCCAGG - Intergenic
1129692057 15:77719249-77719271 CTCCACCACCCAGCCACCCCAGG - Intronic
1129743451 15:78001513-78001535 TTCCAACTCAGAGCCATCCCCGG - Intronic
1131174517 15:90201475-90201497 GTCCGCCCCCGAGTCGCCCCGGG - Exonic
1131292491 15:91118726-91118748 GTCCAAACCAGAGCCATGCCAGG + Intronic
1132476596 16:142322-142344 TTCCATCCCAGAGGCACTCCTGG - Intergenic
1132556103 16:573344-573366 GACATCCCCACAGCCACCCCAGG - Intronic
1132690321 16:1179131-1179153 AACCACAGCAGAGCCACCCCTGG + Intronic
1133029093 16:3001207-3001229 GTCCACCCCAGCTTCAACCCAGG - Intergenic
1133678585 16:8099040-8099062 GCCCAACCCAGAGTCAGCCCAGG - Intergenic
1135839965 16:25867185-25867207 GTCCACCCCAGATCCAGGGCTGG + Intronic
1136247445 16:28984094-28984116 GGCAGCCACAGAGCCACCCCAGG - Intronic
1136366363 16:29810995-29811017 TTCCACCCCAGCTCCAGCCCTGG + Exonic
1136555574 16:31005909-31005931 TTCCACACCAGAGCCACCACGGG + Intronic
1138095118 16:54205418-54205440 CTCCAGCTCAGAGCCTCCCCAGG - Intergenic
1138421996 16:56904924-56904946 GTCCAGTTCTGAGCCACCCCTGG + Intronic
1141135148 16:81460102-81460124 GGCCACCCCAGAGTCAACACAGG + Intronic
1141500735 16:84442609-84442631 ATTCCCCGCAGAGCCACCCCAGG - Intronic
1141609871 16:85175271-85175293 GGCCACCCCAGACACAGCCCTGG - Intronic
1141659255 16:85433045-85433067 GTCCCCCCCAGAGACTTCCCTGG + Intergenic
1141679971 16:85538172-85538194 GGCCACCCTAGAGCCACCTGTGG + Intergenic
1141754664 16:85983271-85983293 GGACACCCCAGAGCCAACCCAGG + Intergenic
1141950068 16:87334350-87334372 CTCCAGCCCAGATCCACCTCTGG + Intronic
1142232396 16:88905942-88905964 GTCCACCCCACAGCCACAGCAGG + Intronic
1142985856 17:3695162-3695184 GCTCACCCCCGACCCACCCCGGG + Intronic
1143119766 17:4599512-4599534 GTCACCCCCACACCCACCCCAGG + Intronic
1144389983 17:14784469-14784491 GGCCTCCCCATAGCCACCCATGG + Intergenic
1147129661 17:38399677-38399699 CTCCACCTCACACCCACCCCTGG + Exonic
1147359390 17:39921635-39921657 GTCTACCCAACAGCCAACCCAGG + Intronic
1148187936 17:45657988-45658010 TTCAAACCCAGAGCCATCCCAGG + Intergenic
1148339436 17:46864564-46864586 GTCCACCCTTGGGCCACCCAGGG + Intronic
1149775791 17:59355975-59355997 TTTCACTCCACAGCCACCCCCGG + Intronic
1150284822 17:63948809-63948831 GTGCACCCCAAGGCAACCCCAGG - Intronic
1151560801 17:74868603-74868625 GTCCTCTCCAGGGCCACCTCCGG + Intronic
1151944318 17:77311232-77311254 CCCCACCCCAGAGCCTCCCTAGG + Intronic
1151978033 17:77493271-77493293 CTCCACCCCAGACCTCCCCCCGG + Intronic
1152318434 17:79594495-79594517 GTCCACTCCAGGGCCACCCGGGG + Intergenic
1154166035 18:12015197-12015219 GTCCACGCCAGAGACACACAAGG - Intronic
1154254238 18:12768699-12768721 GTCCACCACAGAGCTCCCCAGGG - Intergenic
1155719954 18:28999688-28999710 GTCCACCCCAGAGCTGACCAAGG + Intergenic
1156664485 18:39389662-39389684 GTCCACCTGAGAGCCACACAGGG + Intergenic
1156897510 18:42262937-42262959 ACCCACCCCAAACCCACCCCAGG - Intergenic
1157585209 18:48796665-48796687 CTCAACCCCACAGCCACCCAAGG + Intronic
1157842720 18:50974457-50974479 GACCACAGCAGAGGCACCCCGGG - Exonic
1160147771 18:76378796-76378818 GTGACCCCCAGAACCACCCCCGG - Intronic
1161035068 19:2079910-2079932 CCCCACCCCAGAGCAACCCGTGG - Intronic
1161146640 19:2682802-2682824 GTTACCCCCAGAGCAACCCCTGG - Intronic
1161874500 19:6897322-6897344 ATCCACCCAAGACCCATCCCTGG - Intronic
1162134649 19:8547982-8548004 TTCCACCCCACCCCCACCCCAGG + Intronic
1162474958 19:10894264-10894286 GTGAACCAGAGAGCCACCCCCGG - Intronic
1162489519 19:10984154-10984176 GTCCACTCCAGACCCACCCCTGG + Exonic
1163313096 19:16525618-16525640 GCCCACCCCACTGCCCCCCCTGG - Exonic
1163831276 19:19548219-19548241 GTCCACCCCTGCCCCACCCTAGG - Intergenic
1164159685 19:22618149-22618171 GTCCACCCCTGCGCGACCTCAGG + Intergenic
1165428688 19:35759439-35759461 GGCCATCCCAGAGCCAGACCTGG + Exonic
1165750400 19:38256110-38256132 GACCACCCCCGAGCCCTCCCCGG + Intronic
1166405685 19:42520329-42520351 GTCAACACCTGAGCCTCCCCTGG - Intronic
1167250632 19:48396779-48396801 GTCCACCCCACAGACAGCCAGGG - Intronic
1167560249 19:50222693-50222715 GTCTACCCCAGCGCCTGCCCTGG - Intronic
925021107 2:568644-568666 TGCCAGCCCAGAGCCTCCCCTGG + Intergenic
925025826 2:606320-606342 TCCCACCCCAGGGGCACCCCTGG + Intergenic
925262756 2:2542588-2542610 GTCACCCCCAGGGACACCCCTGG - Intergenic
925266268 2:2568702-2568724 CTCCTCACCACAGCCACCCCAGG - Intergenic
925971541 2:9110007-9110029 GTCCACCCCAGGTCCCCCCCAGG - Intergenic
928175805 2:29033634-29033656 GTCCACCCCAGAGCCACCCCTGG - Intronic
929453655 2:42051841-42051863 ACCCTCCCCAGAGCCACTCCAGG - Intronic
930618953 2:53624737-53624759 GGCCACCCCACCGCCATCCCAGG + Intronic
932447093 2:71787744-71787766 GCCCACCCCACAGCAAGCCCTGG + Intergenic
933782896 2:85814127-85814149 GACCACACGTGAGCCACCCCAGG + Intergenic
934296681 2:91748267-91748289 TTCCACCACAAAGGCACCCCGGG + Intergenic
937987593 2:127645449-127645471 CCCCAGCCCGGAGCCACCCCAGG + Intronic
939997385 2:148932523-148932545 GTCCTCCCCAGCGCCAACCCTGG - Intronic
942063261 2:172247548-172247570 GGCCACACACGAGCCACCCCAGG - Intergenic
942173896 2:173312809-173312831 GTTCCCCCCAGCCCCACCCCAGG + Intergenic
944908234 2:204284241-204284263 AACTACCCCAGACCCACCCCAGG + Intergenic
945143955 2:206716297-206716319 AACCAGGCCAGAGCCACCCCAGG + Intronic
946044518 2:216810345-216810367 GTCTCCCCCACAGCCACCTCCGG - Intergenic
946531598 2:220576568-220576590 CTCCAGCCCAGAACCACCACAGG + Intergenic
946621994 2:221571793-221571815 GTCCTCTCCTGAGCCAGCCCGGG - Intronic
946691598 2:222312433-222312455 TTCCACCCGAGAGCCTCCCCCGG + Intergenic
946885654 2:224219947-224219969 TGCCACCCCAGCGGCACCCCAGG - Intergenic
947698771 2:232215421-232215443 GTCCACCCCAGAGGCCCCTTAGG - Intronic
948423387 2:237874080-237874102 GACCAGCCCAGAGCCAGGCCAGG + Intronic
948495203 2:238344295-238344317 TTTCACCCCAGAGCCGCCCATGG + Intronic
948857093 2:240735267-240735289 CTCAACCCCAGAGGCACCCTGGG + Intronic
1170401814 20:15993976-15993998 TTCCACCCCAGTGACACCCAGGG + Intronic
1170666543 20:18391669-18391691 GACCACCCCACAGCCATGCCCGG - Intronic
1172303259 20:33864279-33864301 ATCCAGCCCAGAGCAACCCCTGG - Intergenic
1172531317 20:35633036-35633058 GTCCACCCCCGTGACACCCAAGG + Intronic
1172805001 20:37605389-37605411 GTCCTCCCCAGAGCCCCCTCTGG - Intergenic
1173021906 20:39274146-39274168 GTCCCACCCTGAGCCACCACAGG + Intergenic
1173495522 20:43514860-43514882 CTCCACCCCAGGACCACCCCGGG - Intronic
1173580317 20:44142492-44142514 GCCCACCTCAGAGCCTTCCCTGG + Intronic
1174340297 20:49891110-49891132 TTCCAGCCCTGAGCCACCCCAGG - Exonic
1175762960 20:61573583-61573605 GGGCACCCCAGGGCCATCCCAGG + Intronic
1175810113 20:61853248-61853270 GCCCACCCCAGTCCCACTCCGGG - Intronic
1175940844 20:62536899-62536921 CCCCACCCCAGAGCCACCCTTGG + Intergenic
1176179128 20:63741359-63741381 ATCTCCTCCAGAGCCACCCCAGG + Exonic
1178847644 21:36187002-36187024 CTCCACAGCAGAGCCACCTCTGG + Intronic
1180067221 21:45418485-45418507 CGCCGCCCCAGAGCCAGCCCGGG - Intronic
1180789511 22:18567159-18567181 CTCCACCCCACACCCTCCCCTGG - Intergenic
1181232231 22:21428153-21428175 CTCCACCCCACACCCTCCCCTGG + Intronic
1181246420 22:21506704-21506726 CTCCACCCCACACCCTCCCCTGG - Intergenic
1183084589 22:35478710-35478732 CTCCACCCCACAGCCTCCGCTGG + Intergenic
1183305298 22:37079924-37079946 GGCCACCCCATAGCCAGGCCAGG + Intronic
1184225822 22:43128365-43128387 TCCCACCCCACAGCCACCCGGGG - Intronic
1184900541 22:47444051-47444073 GGCCACCCCACACCCAGCCCTGG + Intergenic
1185009346 22:48304599-48304621 GTGCACCCAAGTCCCACCCCAGG - Intergenic
1185081228 22:48710480-48710502 ACCCACCCCAGAGCCAGACCAGG + Intronic
1185130877 22:49037954-49037976 GGCCACCTCTGAGCCACCCAAGG + Intergenic
1185277564 22:49956437-49956459 CTCCACCCCAGGCCCAACCCTGG + Intergenic
1185315886 22:50178962-50178984 GTACCCCACAGAGCCAGCCCGGG + Exonic
1185414786 22:50704084-50704106 GTCCACCCTGCAGTCACCCCGGG - Intergenic
950554976 3:13689894-13689916 AACCACCCCATATCCACCCCAGG - Intergenic
950745289 3:15083068-15083090 GTACACCCCAGAGCTGCCCTAGG + Intronic
952897530 3:38087850-38087872 CTCCAACCCTGACCCACCCCTGG - Intronic
953466028 3:43120235-43120257 GTGCTCCTCAGAGCCACCCTAGG + Intergenic
954457769 3:50609242-50609264 GTCCACCCCAGACCCTCCACTGG - Intronic
956382126 3:68675557-68675579 GTAGACCCCAGAGACACACCAGG - Intergenic
956649595 3:71492002-71492024 GTCCAGCCCAGACCAACCCCAGG + Intronic
961002405 3:123383046-123383068 CCCCACCCCATGGCCACCCCAGG + Intronic
962966401 3:140358275-140358297 CCCCAGCCCAGAGCCACCTCTGG - Intronic
963039611 3:141059131-141059153 GTCCACCCTTGAGCCAGCCAGGG - Intronic
963348488 3:144124707-144124729 GTCAACCCGAGAAGCACCCCAGG - Intergenic
963939482 3:151085527-151085549 GTTCACCCCAGGGCCAGCCTCGG + Intergenic
966250607 3:177860681-177860703 GCCCACCTGAGAGCCACACCGGG - Intergenic
967877554 3:194277385-194277407 GGCCTCCCGAGAGCCAGCCCAGG + Intergenic
967878203 3:194281006-194281028 GTCCTCCACACAGGCACCCCAGG - Intergenic
968518542 4:1024826-1024848 GAGCACCCCAGACCCATCCCAGG - Intronic
968588570 4:1446314-1446336 GGCCACCCCAGCTCCAGCCCTGG - Intergenic
968628754 4:1639443-1639465 CTGCTCCCCAGAGCCACCCCTGG - Intronic
968813016 4:2808655-2808677 GTCCGCTCCACAGCCATCCCTGG - Intronic
969276665 4:6140412-6140434 GCCCACCACAGACCCACCCCAGG + Intronic
969360040 4:6657728-6657750 CTCCACCCCAGAGCCCGCGCAGG + Intergenic
969453151 4:7286343-7286365 CCCAGCCCCAGAGCCACCCCAGG - Intronic
969518392 4:7661496-7661518 GTCCACCCCAGACACAGACCTGG - Exonic
969713765 4:8858827-8858849 GCCCACCCCAGTGTCCCCCCAGG - Intronic
974741701 4:66014746-66014768 GTCCACCCGAGAGCCATGCAGGG - Intergenic
974885132 4:67809274-67809296 GCCCACCCGAGAGCCACACACGG + Intergenic
981708276 4:147683931-147683953 GGCTGCCCCAGCGCCACCCCCGG + Exonic
982528122 4:156505499-156505521 GCCCACCCGAGAGCCACACGGGG + Intergenic
983297178 4:165880844-165880866 GTGTACCACAGAGCCACCTCTGG + Intronic
984423543 4:179554783-179554805 TTCTTCCCAAGAGCCACCCCAGG + Intergenic
984961166 4:185100058-185100080 GTCCTCCCCAGAGCCCCACGAGG - Intergenic
984961174 4:185100083-185100105 GTCCTCCCCAGAGCCCCACGAGG - Intergenic
984961182 4:185100108-185100130 GTCCTCCCCAGAGCCCCACGAGG - Intergenic
985766164 5:1780569-1780591 GGACACCCGGGAGCCACCCCTGG - Intergenic
986038321 5:3962066-3962088 TTTCACCCCAGAACCACCCTGGG + Intergenic
986140487 5:5025612-5025634 GCCCACCCGAGAGCCACACAGGG + Intergenic
986444315 5:7807980-7808002 GCCCACCCCAGAGACACAGCAGG - Intronic
988787358 5:34577344-34577366 GCCCAGCCCAGAGCTACCACAGG - Intergenic
990242140 5:53826451-53826473 AACCACCCCAGAGTCAGCCCTGG - Intergenic
990620211 5:57550663-57550685 GCCCACCCGAGAGCCACACAGGG - Intergenic
992647971 5:78829988-78830010 TTCCACCCTGGAGCCTCCCCAGG - Intronic
997303687 5:132823950-132823972 GCCCAGCCCAGAGCCACCCCTGG - Exonic
999242550 5:150136282-150136304 CTCCCACCCAGAGCCACCTCTGG - Intronic
1001639235 5:173233551-173233573 GTTCACCCCAGAGCATCACCTGG - Intronic
1001649930 5:173309100-173309122 GTCCCCCCCCAACCCACCCCAGG + Intergenic
1001713609 5:173797137-173797159 GTCCAGCCCTCAGCCACCTCTGG - Intergenic
1006427714 6:33976562-33976584 GACCACCCCAGACTCAACCCTGG + Intergenic
1006579431 6:35068344-35068366 CCCCACCCCAGAGCTTCCCCAGG - Intronic
1006672164 6:35736329-35736351 CTCCACCCTAGATCTACCCCTGG - Intergenic
1007176447 6:39901063-39901085 GTCCACCTTAGAGCCACCCCTGG - Intronic
1007752582 6:44079463-44079485 GGCCACCCCTGAGGCTCCCCAGG - Intergenic
1012550977 6:100464679-100464701 GTCCAACCCAGCGACACCGCCGG + Exonic
1015617878 6:135097693-135097715 TCCCACCCCAAACCCACCCCAGG - Intronic
1015979025 6:138820164-138820186 GTCCAACCCTGACCCACCCTTGG - Intronic
1018705307 6:166460033-166460055 CGCCGACCCAGAGCCACCCCAGG + Intronic
1018790184 6:167142321-167142343 GTCCAGGGCAGAGGCACCCCTGG - Intergenic
1019051471 6:169186835-169186857 TTCCACCTCAGAGCTACCCCTGG - Intergenic
1019349982 7:550075-550097 GTCCTCCCCAGAACCAGGCCAGG - Exonic
1019523400 7:1470399-1470421 GGCCGGCCCGGAGCCACCCCAGG + Exonic
1019725807 7:2602088-2602110 GCCACCCCCAGCGCCACCCCGGG - Intronic
1019779556 7:2931283-2931305 GCCCACCCCAAAGCCACCTGGGG + Intronic
1023330338 7:39108506-39108528 GGGTACCCCAGAGCCTCCCCTGG - Intronic
1023863864 7:44229623-44229645 GGCCACCCCACCTCCACCCCAGG - Intronic
1024472276 7:49775843-49775865 GCCCACGCCCGAGCCACCCGAGG + Exonic
1026020437 7:66700920-66700942 TGCCACCCCAGAGCAAACCCAGG - Intronic
1026106361 7:67424068-67424090 GTTCACCCCAGATCCCACCCTGG + Intergenic
1026850965 7:73722945-73722967 GTCCACCCAAGTGCCACAGCAGG - Intergenic
1026879848 7:73901439-73901461 TGCCACCCCAGAGCAAACCCAGG + Intergenic
1026899520 7:74029148-74029170 GTCCACACCAGTGTCACACCTGG - Intronic
1026929377 7:74215401-74215423 GCCCACCCCAGAGCAACTCAGGG - Intronic
1026960328 7:74403877-74403899 GTCCACACCAGAGCCCCACGCGG + Exonic
1027183510 7:75955714-75955736 TTGCACCCCAGGGCCACCCTGGG + Intronic
1027257842 7:76442637-76442659 ACCCACCTCAGAGCCACCTCAGG - Intergenic
1027261528 7:76468137-76468159 GTGCTCCCCAGAGCCACACCGGG - Intronic
1027281006 7:76609398-76609420 ACCCACCTCAGAGCCACCTCAGG + Intergenic
1027312909 7:76966246-76966268 GTGCTCCCCAGAGCCACACCAGG - Intergenic
1029206147 7:98870272-98870294 CCCCACCCCAAATCCACCCCCGG + Intronic
1034345655 7:150383878-150383900 GTCCTCCCCATCGCCGCCCCTGG - Intronic
1034846915 7:154454846-154454868 GTCCATCCCAGGGCCATCTCAGG + Intronic
1035957211 8:4094329-4094351 GTCCAGCTCACAGCCACCTCTGG - Intronic
1037487898 8:19365775-19365797 GGTCACCTCAGAGCCACCCCAGG + Intronic
1038865350 8:31433703-31433725 CTTCACCCCAGAGCCAAGCCAGG - Intergenic
1039475590 8:37837832-37837854 GTCCAGCCCCCAGCCTCCCCGGG - Exonic
1039911303 8:41828954-41828976 GTCCTCTCCAGAGCGCCCCCTGG + Intronic
1047644443 8:126855096-126855118 CTCCACCCAGGTGCCACCCCAGG + Intergenic
1048306060 8:133285600-133285622 GGCCACCCCGAATCCACCCCGGG + Intronic
1049411988 8:142477640-142477662 GCCCACTCCAGACCCACCTCAGG + Intronic
1049679088 8:143908816-143908838 GTCCCACCCAAGGCCACCCCTGG - Intergenic
1053737776 9:41112424-41112446 GTACACCCCCAAGCCCCCCCGGG + Intergenic
1057181862 9:93034874-93034896 GTGGACCCCAGAGCCAGCCAGGG + Intronic
1057204513 9:93163263-93163285 GTCCTACCCAAGGCCACCCCAGG - Intergenic
1057566631 9:96170930-96170952 GTTCACCCCAGAGTCCCCTCTGG + Intergenic
1059424248 9:114210894-114210916 AACCAGCCCAGAGCCACCCACGG - Intronic
1059455514 9:114398056-114398078 GCCCACCCCCGAGCTCCCCCGGG + Intergenic
1060817420 9:126642521-126642543 ATCCCCCGAAGAGCCACCCCAGG + Intronic
1061021008 9:128014756-128014778 GTCCAGCCCACAGGCTCCCCAGG + Intergenic
1061232025 9:129320710-129320732 GCCCTGCCCAGAGCAACCCCCGG - Intergenic
1061376267 9:130226523-130226545 ACCCATCCCAGACCCACCCCAGG - Intronic
1061859807 9:133462130-133462152 GTCCAACCCACAGCCAGCCTTGG - Intronic
1062353377 9:136149933-136149955 GTCAGGCCCAGACCCACCCCAGG - Intergenic
1062554787 9:137109030-137109052 GTAAACACCAGAGCCAGCCCTGG - Exonic
1062583352 9:137237820-137237842 GCCCACCCCTGAGGCACCCCTGG - Intergenic
1185523157 X:756884-756906 CACCACCCCAGAGCCTGCCCAGG + Intergenic
1187498116 X:19813996-19814018 GCCCACCACAGAACCACCTCTGG - Intronic
1188037827 X:25338300-25338322 GTCCACCTGAGAGCCACACAGGG - Intergenic
1190913115 X:54790031-54790053 GTCCACCCCAGTGCCTCTCTGGG + Intronic
1190917828 X:54823278-54823300 GTCCACCCCAGTGCCTCTCTGGG - Intergenic
1193090994 X:77494059-77494081 GTCCACCTGAGAGCCACACGGGG + Intergenic