ID: 928175810

View in Genome Browser
Species Human (GRCh38)
Location 2:29033668-29033690
Sequence GGGTATCGCTGAGACCTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928175798_928175810 26 Left 928175798 2:29033619-29033641 CCTGCTTGTCCATGGCCAGGGGT 0: 1
1: 0
2: 2
3: 7
4: 181
Right 928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG 0: 1
1: 0
2: 0
3: 4
4: 55
928175805_928175810 11 Left 928175805 2:29033634-29033656 CCAGGGGTGGCTCTGGGGTGGAC 0: 1
1: 0
2: 4
3: 26
4: 284
Right 928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG 0: 1
1: 0
2: 0
3: 4
4: 55
928175801_928175810 17 Left 928175801 2:29033628-29033650 CCATGGCCAGGGGTGGCTCTGGG 0: 1
1: 0
2: 3
3: 57
4: 521
Right 928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG 0: 1
1: 0
2: 0
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928175810 Original CRISPR GGGTATCGCTGAGACCTAGT TGG Intronic
902688113 1:18092104-18092126 GGATATAGCTGTGACCTATTAGG - Intergenic
904386732 1:30147583-30147605 GGGAATCGCTGAGAACCTGTGGG + Intergenic
905520189 1:38592680-38592702 GGGTATCACGGAGAAGTAGTGGG - Intergenic
916179574 1:162071616-162071638 GGGTATGGCTGGGACAGAGTGGG + Intronic
923277411 1:232409667-232409689 TGGAATGGCTGAGGCCTAGTGGG - Intronic
1069550450 10:69360463-69360485 GGGTATGGCTGTGGCCTTGTCGG + Intronic
1080389701 11:31833722-31833744 GGGCATCTCTGGGGCCTAGTCGG + Intronic
1081222232 11:40476017-40476039 GGGTATTACTGGCACCTAGTGGG - Intronic
1082856195 11:57809383-57809405 GGTTATCGCTGAGAACTTGGAGG + Exonic
1085460722 11:76691661-76691683 GGGCATCGAAGAGACCTACTGGG - Intergenic
1088214140 11:107489602-107489624 GGGTACTGATGATACCTAGTAGG - Intergenic
1100302640 12:93322063-93322085 GGCTATGGCTGGAACCTAGTGGG + Intergenic
1103298859 12:119911804-119911826 GGGTATTGCTGGCATCTAGTGGG - Intergenic
1103425362 12:120829504-120829526 GGGAATCGCTTGGACCTAGGGGG + Intronic
1104187198 12:126444245-126444267 GAGAATCGCTGAAACCTAGGAGG - Intergenic
1107020078 13:35742256-35742278 GGTTAAGGCTGAGACCTACTGGG - Intergenic
1108746443 13:53399773-53399795 GGGTACTGCTGGCACCTAGTGGG + Intergenic
1122168487 14:99850559-99850581 CGGTATCGCTGAAAACAAGTTGG + Intronic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1130919291 15:88330629-88330651 GGGTGTCGCTGAGACAGGGTGGG + Intergenic
1140273926 16:73491781-73491803 GGGTGTCACTGACATCTAGTAGG + Intergenic
1143774883 17:9192529-9192551 GGGTGTCGCTGGCATCTAGTGGG + Intronic
1146833707 17:36092397-36092419 GGGTATCACTGAGAGCTGGGAGG - Intergenic
1146906908 17:36623796-36623818 GGGTCTCGCTGAGCCTCAGTGGG + Intergenic
1153170116 18:2306750-2306772 AGGTATTGCTGAGAATTAGTGGG - Intergenic
1154286460 18:13061810-13061832 GGGTATTACTGACACCCAGTGGG - Intronic
1158496420 18:57959194-57959216 GAGTATAGCTGAGAGCTATTTGG - Intergenic
1165528514 19:36377197-36377219 GGGGATCAAAGAGACCTAGTGGG + Intronic
1167994859 19:53394269-53394291 GGGAATCGCTGAAACCCAGGAGG + Intronic
928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG + Intronic
931939287 2:67234367-67234389 GGGTCTCACTGAGACCTTGAAGG - Intergenic
932713150 2:74082464-74082486 GGGTGTCACTGAGCCCTGGTGGG + Intronic
933209126 2:79545683-79545705 GGAAATCACTGACACCTAGTGGG - Intronic
940011599 2:149060579-149060601 GGGTTTGGCTGAGACCTGGCTGG + Intronic
944651850 2:201838267-201838289 GGGTATCACTGGCATCTAGTGGG + Intronic
1169016529 20:2297214-2297236 GGGCACTGCTGAGACCTAGCTGG - Intronic
1171363107 20:24604281-24604303 AGGTAACGCTGAGACCTGCTGGG + Intronic
1173928635 20:46799845-46799867 GGGTCTCACTGAGACCTAGGCGG + Intergenic
1176105566 20:63384235-63384257 GGGTATCCCGGAGACCCAGTGGG - Intergenic
1176140720 20:63543572-63543594 GGGTCTGGCTCAGACCTAGCTGG + Intronic
1184225600 22:43127504-43127526 GGGTATCTCTGAATCCAAGTGGG + Intronic
964863479 3:161228277-161228299 GGGGTTGGCTGGGACCTAGTAGG - Intronic
964868234 3:161285287-161285309 GGGGAACGCTGAGGCCAAGTGGG + Intergenic
975938860 4:79616008-79616030 GGGCTTAGGTGAGACCTAGTTGG + Intergenic
979387970 4:120092507-120092529 GGGTGTGGCTGAGACAGAGTGGG - Intergenic
984471609 4:180182829-180182851 GGGAATCGCTGGAACCTAGGAGG + Intergenic
992314606 5:75539583-75539605 GAGTATCTCTGAAGCCTAGTAGG - Intronic
996769843 5:127074135-127074157 GAGTATGGCTGAGACTTAGAGGG + Intergenic
999994771 5:157081721-157081743 GGGAATCGCTTAAACCTAGGAGG + Intergenic
1000218476 5:159187726-159187748 GGGTATCACTGGGGTCTAGTGGG + Intronic
1000250221 5:159487411-159487433 GGGTATCTCTCAGACCTCCTGGG + Intergenic
1001313396 5:170626824-170626846 GGGGATTTCTCAGACCTAGTAGG - Intronic
1021602047 7:22373862-22373884 GGGTATAGCTGAGAGCTTGGAGG + Intergenic
1023495251 7:40788167-40788189 GGGTATCGTGGAGACCAAATGGG + Intronic
1031126688 7:117781646-117781668 GGGTATCGCTTAGACCCAGGAGG + Intronic
1042126404 8:65541575-65541597 GGGCATGGATGAGGCCTAGTTGG - Intergenic
1060997268 9:127882124-127882146 GGGTATTGCCGAGTCCTATTAGG - Intergenic
1187428691 X:19202492-19202514 GGCTCTGGCTGAGACCCAGTTGG + Intergenic
1191054562 X:56228836-56228858 GGGCATAGTTCAGACCTAGTGGG - Intergenic
1198556622 X:137799998-137800020 GGGTATTGCTGGCACCTAGTGGG - Intergenic