ID: 928176294

View in Genome Browser
Species Human (GRCh38)
Location 2:29036493-29036515
Sequence TGCCCAGCCTGGGTTCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928176285_928176294 14 Left 928176285 2:29036456-29036478 CCAGGTGAGCTCCAAGCTGCCTG 0: 1
1: 0
2: 7
3: 25
4: 244
Right 928176294 2:29036493-29036515 TGCCCAGCCTGGGTTCCCATGGG 0: 1
1: 0
2: 1
3: 28
4: 247
928176288_928176294 3 Left 928176288 2:29036467-29036489 CCAAGCTGCCTGCACTGTGGGAG 0: 1
1: 0
2: 0
3: 43
4: 373
Right 928176294 2:29036493-29036515 TGCCCAGCCTGGGTTCCCATGGG 0: 1
1: 0
2: 1
3: 28
4: 247
928176289_928176294 -5 Left 928176289 2:29036475-29036497 CCTGCACTGTGGGAGTCCTGCCC 0: 1
1: 0
2: 4
3: 46
4: 660
Right 928176294 2:29036493-29036515 TGCCCAGCCTGGGTTCCCATGGG 0: 1
1: 0
2: 1
3: 28
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928176294 Original CRISPR TGCCCAGCCTGGGTTCCCAT GGG Intronic
901014842 1:6222778-6222800 GGCCCAGCCTCCATTCCCATTGG - Exonic
902263418 1:15244415-15244437 TGGCCAGCCTGGGTTTCACTGGG + Intergenic
902275278 1:15335076-15335098 TACCCCGCCTGGATTCCCCTGGG - Intronic
902669991 1:17966558-17966580 TCCCCTGTCTGGGCTCCCATTGG + Intergenic
903370176 1:22830219-22830241 TGCCCAGCCTTTGTCCCCAGAGG + Intronic
903428317 1:23271289-23271311 TGCCCAGACTGGGGTGCAATGGG - Intergenic
904079317 1:27862235-27862257 TGCCCAGCCAGAGTCCCCAGAGG - Intergenic
904518009 1:31071934-31071956 TGCCCAGCCAGTTTTCTCATGGG - Intergenic
905485389 1:38292432-38292454 TGCCCAGCCTGGGGAGCCCTGGG + Intergenic
905569997 1:38996133-38996155 TGCCCAGGCTGGAGTCCAATGGG + Intronic
906528466 1:46510007-46510029 AGCCCAGCCTGGCTTCTCATGGG + Intronic
909740128 1:79018671-79018693 TGCCCAGCCTGACTTTCCATGGG + Intergenic
910346796 1:86248086-86248108 TGCCCGGCTTGGTTTCACATGGG + Intergenic
910356241 1:86359561-86359583 TGCCCAGGCTGGGAGCACATTGG + Intronic
912116963 1:106418893-106418915 TTCCCAGCTTGGGTACCTATGGG + Intergenic
913489812 1:119368413-119368435 AGCACAGCCTGGGAGCCCATGGG - Intergenic
914241484 1:145856029-145856051 TGCCTATCCTGGGTACCCACTGG - Intronic
914921346 1:151849747-151849769 TGGCCAGCCTGGGGACCCATTGG + Intronic
915063258 1:153204084-153204106 TGCCATGAGTGGGTTCCCATGGG - Intronic
915461437 1:156072778-156072800 TCCCCAGCCTCTGTGCCCATGGG + Exonic
916457497 1:164986084-164986106 TGCCCTACCTGGGTTCCCTGGGG + Intergenic
923354168 1:233137339-233137361 TGTCCAGCATGGGTTCCCACTGG + Intronic
923523538 1:234755263-234755285 TTCCCAGCCTGTTTTCTCATTGG - Intergenic
924379226 1:243446508-243446530 TGCCCACCTTGGCCTCCCATTGG + Intronic
1062878841 10:962254-962276 TGCCCAGGCTGGAGTCCCAATGG - Intergenic
1064267215 10:13834736-13834758 AGACCAGCCTGTGTTGCCATGGG + Intronic
1064535037 10:16349799-16349821 TGCCCAACCTGGGCTGCCAGAGG + Intergenic
1064986910 10:21219952-21219974 TGCCCAGGCTGGAGTACCATGGG + Intergenic
1065282253 10:24151378-24151400 TGCCCAGCATAAGTGCCCATGGG - Intronic
1067069402 10:43120848-43120870 TGCCCTGCCTGGGCTGCCACTGG - Intronic
1068858423 10:61821478-61821500 TGCACAGCCTTAGTTACCATGGG - Intergenic
1068935017 10:62627106-62627128 TGCCCTGCCTAGGTTCCCAGGGG - Intronic
1069509304 10:69029690-69029712 TCCCCAGGCTGGGTTCCCCTTGG - Intergenic
1069772040 10:70906238-70906260 GCCCCAGCCTGGGATCCCAGAGG + Intergenic
1073471205 10:103723395-103723417 TCCCCAGCATAGGTTCTCATTGG - Intronic
1074687067 10:115971243-115971265 AGGCCAGCCTTGGTGCCCATGGG - Intergenic
1075310850 10:121412426-121412448 TGCCCAGCCGGGCTTCCCTTTGG + Intergenic
1075949977 10:126468701-126468723 TGCCCTGCATGGGTTTCCACAGG - Intronic
1076365492 10:129919012-129919034 TGCCCAGGCTGGGCTTCCATGGG - Intronic
1076371789 10:129960032-129960054 TCCCCAGCTCGGGTTCCCAGCGG - Intronic
1077323867 11:1954986-1955008 TGCCAAGCATGGTTTCCCAGGGG - Intronic
1077840261 11:5966673-5966695 TGGCCAGCATAGCTTCCCATAGG - Intergenic
1078064349 11:8068226-8068248 TGTCCTGCCTCGGGTCCCATGGG + Intronic
1079314984 11:19399894-19399916 TACCCAGCCTGGGGTCAGATGGG + Intronic
1079756834 11:24274591-24274613 TGTGCAGCCCGGGTTCCCACTGG + Intergenic
1080631282 11:34079161-34079183 TGCCCACCTTGGCTTCCCAAAGG - Intronic
1083693882 11:64429737-64429759 TGCCCTGCCTGGGCTGCCCTTGG - Intergenic
1083920235 11:65778477-65778499 GGCTGAGCCTGGGGTCCCATCGG - Exonic
1084566125 11:69930142-69930164 GGGCCAGCCTGGGTTCTCATTGG + Intergenic
1084607970 11:70183655-70183677 TGCACAACCTGCTTTCCCATGGG - Intronic
1084940506 11:72610226-72610248 TGGACAGCCTGGGGACCCATAGG + Intronic
1085215503 11:74827028-74827050 TGCCCACACTGAGTCCCCATTGG - Intronic
1085216515 11:74837497-74837519 TGCCCAGCCTAGCTTCCCCTAGG - Exonic
1088303536 11:108384543-108384565 TGCCCATCTTGGCTTCCCAAAGG - Intronic
1090305825 11:125690125-125690147 GTCCCTGACTGGGTTCCCATGGG - Intergenic
1202806853 11_KI270721v1_random:10181-10203 TGCCAAGCATGGTTTCCCAGGGG - Intergenic
1093491889 12:19714348-19714370 TGCCCACCCTGGCCTCCCAAAGG + Intronic
1093939204 12:25034237-25034259 TCCCCAGCCTGGGATCCCAAAGG + Intronic
1095901505 12:47333393-47333415 TGCGCAGCCCCGGTTCCCACTGG - Intergenic
1096693181 12:53333487-53333509 TGCCCAGCCTGGCCTCCCAGCGG + Intronic
1096876661 12:54634938-54634960 TCTCCAGGCTTGGTTCCCATTGG - Intergenic
1100921012 12:99486935-99486957 TACCCATGCTGAGTTCCCATGGG + Intronic
1101395480 12:104343238-104343260 TGACCAGGCTGGGTTACCATGGG - Intronic
1101680114 12:106956163-106956185 TGCCCGGCCTGGCTGCCCAGCGG + Intronic
1101922010 12:108940835-108940857 TGCCCAGCCTGGGCTGGCGTTGG - Exonic
1102717285 12:114985321-114985343 TGCCCAGTCTGGGTAGACATTGG - Intergenic
1102979361 12:117229243-117229265 TGCCAGGCCTGGCTTCCCACAGG + Intronic
1103213114 12:119180797-119180819 TGCCCAGCCTGTGTTTGCAATGG - Intronic
1104183467 12:126405197-126405219 TGCCCAGCCAGTTTTCCAATTGG + Intergenic
1107847685 13:44533740-44533762 TGCCCAGGCTGGAGTGCCATGGG - Intronic
1111078203 13:83265775-83265797 TGCCCAGCCTTGGTTTCTTTTGG + Intergenic
1111436531 13:88216967-88216989 GGCTCCGGCTGGGTTCCCATGGG + Intergenic
1112001936 13:95218808-95218830 TGCCCAGACTGGATTCCAGTGGG - Intronic
1112860204 13:103820713-103820735 TGCCCAGGCTGGTTTCTCCTGGG + Intergenic
1113916990 13:113880170-113880192 ATCCAAGCCTGGGTTGCCATTGG - Intergenic
1116746291 14:48823486-48823508 TGTCCAGAATGGTTTCCCATAGG - Intergenic
1117875543 14:60248080-60248102 TCACCAGCACGGGTTCCCATTGG - Intronic
1118571922 14:67202397-67202419 TGCCCAGGCTGGAGTGCCATGGG - Intronic
1119439914 14:74621282-74621304 TGCCTAGCATAGGTTCACATAGG - Intergenic
1121409096 14:93737186-93737208 AGCCCAGCTGGGGTTCCCTTCGG + Intronic
1122051902 14:99066438-99066460 TGCCCAGCCATTGTTCCCACAGG - Intergenic
1122774198 14:104110075-104110097 TGCCCAGCCTGGGCTGCCCGAGG + Intronic
1123435073 15:20248470-20248492 TTCCCAGGCTGTGTTCTCATGGG - Intergenic
1123682684 15:22773839-22773861 TGACCAGTTTGTGTTCCCATTGG - Intronic
1124334435 15:28846363-28846385 TGACCAGTTTGTGTTCCCATTGG - Intergenic
1124597206 15:31101371-31101393 TGTTCAGCCTGGGTTCCAAGAGG - Intronic
1125398688 15:39276846-39276868 TTACTAGCCTGGGTTCCCACGGG - Intergenic
1126452662 15:48826486-48826508 TGCCCACCTTGGCTTCCCAAAGG + Intronic
1128992265 15:72271143-72271165 TGTCCAGCCTGGGTTGCCCTGGG + Exonic
1129172441 15:73816497-73816519 TGGGCAGCCTGGGGTCACATTGG - Intergenic
1131150759 15:90046035-90046057 CGTCCAGCCAGGGTTCCCAGGGG + Intronic
1131183214 15:90254591-90254613 TGCCCACCTTGGCTTCCCAAAGG - Intronic
1131254703 15:90854438-90854460 TGCCCATTCTGGCTTCCCAAGGG - Intergenic
1131480056 15:92773121-92773143 TGCCCAGGCTGGAGTCCCAGTGG + Intronic
1132497621 16:271184-271206 TGCCCCGCCTGGGCTCACGTGGG + Exonic
1132827816 16:1913780-1913802 GGCCCAGCCTGCGTTTCCCTGGG - Intronic
1133941950 16:10316763-10316785 GGTCCAGCTTGGCTTCCCATGGG - Intergenic
1135994419 16:27237512-27237534 TGCCCAGCGTTGGCTCCCCTTGG - Intronic
1136562267 16:31046892-31046914 TGCCCAGGCTGGAGTGCCATGGG - Intergenic
1136849530 16:33602479-33602501 TTCCCAGGCTGTGTTCTCATGGG + Intergenic
1138207237 16:55133918-55133940 TGCCTAGGCTGGGCTCCCACTGG - Intergenic
1138968111 16:62110737-62110759 TGCCCAGGCTGGAGTGCCATGGG + Intergenic
1140377931 16:74460262-74460284 TGCCCACCTTGGCTTCCCAAAGG + Intronic
1203111239 16_KI270728v1_random:1451132-1451154 TTCCCAGGCTGTGTTCTCATGGG + Intergenic
1143137251 17:4718820-4718842 TGCCCAGCCTGGAGTGCAATGGG + Intronic
1143441457 17:6977727-6977749 AGACCAGCCTGGGTAACCATAGG + Intronic
1143464885 17:7129989-7130011 GGCCCTGCCTGGCTTCCCACAGG - Intergenic
1144428923 17:15172722-15172744 GACTCATCCTGGGTTCCCATTGG + Intergenic
1146040596 17:29450125-29450147 TGCCCAGGCTGGAATGCCATGGG + Intronic
1147825893 17:43269738-43269760 TACCCAGCCTGGAGTCCAATGGG + Intergenic
1148124864 17:45231363-45231385 GGCCCAGCCTTGGCTCCCAGGGG - Intronic
1148217222 17:45839889-45839911 TGCCCAGCCTCATTGCCCATTGG + Intergenic
1148494575 17:48045626-48045648 TGCCCAGCCTGGAGTCGCAGGGG + Intergenic
1148914108 17:50960179-50960201 TGCCCAGCCTGAGTTCCTCTTGG + Intergenic
1149738894 17:59024171-59024193 TGCCCAGCCTGGAGTGCGATGGG - Intronic
1150041186 17:61863220-61863242 TGCACAGCCTGCGGGCCCATGGG - Intronic
1150338413 17:64346295-64346317 TGCCCAATCTGGGTTCGCAAAGG + Intronic
1150475287 17:65470397-65470419 TGCCCAGGCTGGAGTGCCATGGG + Intergenic
1151645530 17:75428316-75428338 TGCCCGGCCTGGGTTTTAATTGG + Intergenic
1152011953 17:77724301-77724323 TAACCACCCTGGGTTCCCAAGGG + Intergenic
1152311205 17:79551155-79551177 TGCATAGCCTGGATTCCCAAGGG - Intergenic
1153382418 18:4454719-4454741 TCCCCTGCCTGGGTCCCCGTGGG + Intronic
1153468684 18:5417920-5417942 TTCCCAGGCTGGGATCCCCTGGG - Intronic
1156001317 18:32387922-32387944 TGCACAGCCTGGGCAGCCATAGG - Intronic
1157615364 18:48984114-48984136 TGAGCAGCCTGGGGACCCATTGG + Intergenic
1158436504 18:57438270-57438292 CGCCCACCCTGGCTTGCCATAGG - Intronic
1159017859 18:63116416-63116438 GACCCAGGCTGGGTTCCCACAGG - Intergenic
1159804301 18:72937655-72937677 AACACAGCCTGGGTTTCCATAGG - Intergenic
1159917138 18:74197959-74197981 TGCCGAGCCTAGGTTCCCCTGGG - Intergenic
1160612964 18:80103205-80103227 TGCCCACCTTGGCTTCCCAAAGG + Intergenic
1161173521 19:2825677-2825699 TTCCCAGCTTGGCTTCCCAAAGG + Intronic
1162420649 19:10564417-10564439 TGCCCAGGCTGGGTTGCAATGGG - Intronic
1162426495 19:10599878-10599900 AGACCAGCCTGGGCACCCATAGG + Intergenic
1163155445 19:15437613-15437635 TGCCCAGGCTGGAGTGCCATGGG - Intronic
1163850907 19:19663144-19663166 TGCCTGGCCTGGATTCCCAGGGG - Intronic
1164039804 19:21484290-21484312 TGCCCAGGCTGGGGTGCAATGGG + Intronic
1165031222 19:32999391-32999413 TTCCCAGGCTGTGTTCTCATGGG - Intronic
1165468691 19:35990345-35990367 TAGTCAGCCTGGCTTCCCATTGG - Intergenic
1166265821 19:41683658-41683680 TGGCCAGCCTGGGTGCCTAGAGG + Intronic
1166272013 19:41720313-41720335 TGGCCAGCCTGGGTGTCCAGGGG - Intronic
1166662248 19:44654548-44654570 TGCACAGCATGGGGTCACATGGG - Intronic
1166731464 19:45061343-45061365 CGCCCAGGCTGGGTGGCCATAGG + Intronic
1166814117 19:45531982-45532004 TGTCCAGCCTGAGTTTACATGGG + Intronic
1167262567 19:48467403-48467425 AGCCCAGCCTGGGTTTCCACTGG + Intronic
1167462410 19:49632679-49632701 TGCCCAGCCTGGGGACACTTAGG - Intergenic
1167688483 19:50970752-50970774 TGCCTGGCCTGGGTGCACATGGG + Intergenic
925341856 2:3143221-3143243 GTCCCAGCCAGGGTCCCCATGGG + Intergenic
925375051 2:3378308-3378330 TGCCCATCCTGGCTACCCAATGG - Intergenic
928176294 2:29036493-29036515 TGCCCAGCCTGGGTTCCCATGGG + Intronic
928509725 2:31991528-31991550 TGCCCAGGCTGGGGTACAATGGG - Intronic
929470606 2:42188768-42188790 TGCCCACCTTGGCTTCCCATAGG + Intronic
930600361 2:53435823-53435845 TGTCCTGCCTGGGTTCACACTGG - Intergenic
932560839 2:72867392-72867414 TGCCCACCCTTGGCTCCCACAGG - Intergenic
932698031 2:73973282-73973304 TTCCCAGCCTGGCTTCACATTGG + Intergenic
934663963 2:96157562-96157584 TGCACAGCCATGGTTCCCACAGG + Intergenic
937039525 2:118810076-118810098 TCCCCAACCTGGTTTCACATGGG + Intergenic
938087779 2:128412563-128412585 GGCCCAGCCTTGGTTCCCTGTGG - Intergenic
938163703 2:129008653-129008675 TGTCCTCCCTGGGCTCCCATGGG - Intergenic
940012804 2:149072779-149072801 TGCCCAGCTTGGTCTCCCAAAGG + Intronic
940853127 2:158706969-158706991 AGCCCAGCTCTGGTTCCCATGGG - Intergenic
945235862 2:207630717-207630739 TGGTTACCCTGGGTTCCCATGGG - Intergenic
946039092 2:216768769-216768791 TGTCAAGCCTGGCTTCCCAGAGG + Intergenic
948582680 2:238998574-238998596 TGCCCAGGCTGGACTCCCCTGGG + Intergenic
948590563 2:239047149-239047171 TGCTCAGCCAGGGTTCCTCTGGG - Intergenic
948890505 2:240904990-240905012 AGCCCAGCCCGGATGCCCATGGG + Intergenic
949009965 2:241672780-241672802 TGCCCAGCCTGGCTTACCAAGGG + Exonic
949026769 2:241770050-241770072 ATCCCAGGCTGGGTACCCATGGG + Intergenic
1169462512 20:5808035-5808057 TGCCCACCCTGGCCTCCCAAAGG - Intronic
1169499824 20:6148426-6148448 TACCCAGGCAGGTTTCCCATGGG + Intergenic
1170710582 20:18786982-18787004 GGCCTAGCAGGGGTTCCCATGGG + Intergenic
1171239059 20:23550689-23550711 TTCCCAGCCTGGACTCCCACAGG + Intergenic
1171251597 20:23653218-23653240 TGCCCAGACTGGAGTGCCATGGG + Intergenic
1172840483 20:37900277-37900299 GGTCCAGCCTGAGTCCCCATGGG - Intergenic
1175165542 20:57041315-57041337 TGCCCAGAGTGGGTCCCCAAGGG - Intergenic
1175761220 20:61563170-61563192 TGCCAAGCCTGGGCTCCCCGTGG - Intronic
1176137502 20:63530612-63530634 TGCCCAGCCTGGGCTCCCGAGGG + Intronic
1176943479 21:14951956-14951978 TGCCCATCCTGGGTTGGCAGGGG - Intergenic
1180959150 22:19754873-19754895 TACCCAGCCTGGGGTCTCAATGG - Intergenic
1181236656 22:21451081-21451103 TGCCCAACCTGGGTCCCCCCCGG - Exonic
1182898137 22:33875501-33875523 TGCTCAGCCTGGAGTCCCCTTGG - Intronic
1183717115 22:39539978-39540000 GCCCCAGCCTGGCTTCCCAGAGG - Intergenic
1184262612 22:43328065-43328087 TGCCCAGCTTGGGGTCACAGTGG + Intronic
1184565128 22:45287301-45287323 TGCCCAGCCTGGATGCCATTGGG + Exonic
949919569 3:8990482-8990504 TGCCCAGCCTGCCTTCCCGCTGG + Intronic
953194681 3:40721165-40721187 TGCCCACACTGGATTCCCAGGGG - Intergenic
954419651 3:50411984-50412006 AGCCCAGCGTGGCTTGCCATGGG - Intronic
954458186 3:50611358-50611380 GGCTCAGCCTGGGTTCTCATTGG - Intronic
959208237 3:103341089-103341111 TGCCCAGGCTGGGGTGCCAGTGG - Intergenic
961404029 3:126666396-126666418 TGCCCAGCCTGGGTATCTAGGGG + Intergenic
962522330 3:136208957-136208979 TGCCCACCTTGGGCTCCCAAAGG + Intergenic
967822537 3:193851593-193851615 TGCTGAGCCTGTTTTCCCATAGG - Intergenic
967956502 3:194881403-194881425 TCCCCAGCCTGGCTTTCCAATGG + Intergenic
968690456 4:1987334-1987356 TGCCCTGCCATGGTTCCCAGGGG + Intronic
969101774 4:4774840-4774862 TGCCCAGTTTGCATTCCCATTGG - Intergenic
969918253 4:10511115-10511137 TGCCCAGGCTGGAGTGCCATGGG - Intronic
972388427 4:38590066-38590088 TGCAAAGCCTAGGATCCCATCGG + Intergenic
973292030 4:48480892-48480914 TGCCCACCTTGGCCTCCCATAGG + Intergenic
975595222 4:76043637-76043659 TGCGCAGCCCTGGTTCCCACTGG + Intronic
975744922 4:77466395-77466417 TGTGCAGCCCTGGTTCCCATCGG - Intergenic
980208490 4:129754208-129754230 AGCACAGAGTGGGTTCCCATGGG + Intergenic
982728154 4:158927711-158927733 TGCGCAGCCCGGGTTCCCACTGG - Intronic
982902344 4:161023112-161023134 TGCCCAGGCTGGGGTGCAATGGG + Intergenic
983295602 4:165864361-165864383 TGCCCAGTCTGAGTTTCTATAGG - Intergenic
985588364 5:752228-752250 TCCTCAGCCTGAGTTCCCTTTGG - Intronic
985657601 5:1140227-1140249 GGATCTGCCTGGGTTCCCATGGG - Intergenic
986129315 5:4912374-4912396 AGCCCACCCTGGGTTGCCACAGG + Intergenic
987867787 5:23568646-23568668 TGACCAGTCTGGCTTCCCATGGG + Intergenic
989200637 5:38759250-38759272 GGCCAAGCCTGGGATCCCACAGG + Intergenic
990583269 5:57185300-57185322 TGCCCAGGCTGGGGTGCAATGGG + Intronic
990857061 5:60280034-60280056 TGCCCAGCCTGGAGTGCCCTGGG - Intronic
991293404 5:65055654-65055676 TGCCCAGCCTCAGTTCCTAAAGG + Intergenic
993703692 5:91146915-91146937 TGCCCACCTTGGCCTCCCATAGG - Intronic
996022854 5:118610950-118610972 TGACTTGCCTGGGTTCACATAGG + Intergenic
996530363 5:124521633-124521655 TGCACAGCCCTGGTTCCCACCGG - Intergenic
996585966 5:125088713-125088735 TGCGCAGCCCCAGTTCCCATGGG - Intergenic
997612710 5:135226422-135226444 TGCCAAGCCTGGCCTCCCAGAGG + Intronic
998235182 5:140392448-140392470 TGCCCAGGCTGGAGTCCAATGGG - Intergenic
998413625 5:141929637-141929659 GGCCAAGCCTGGGTTCCCTGAGG - Exonic
998456833 5:142280275-142280297 TGCCCAGCCGGCCTTCCCACGGG + Intergenic
999173320 5:149614006-149614028 TGCCCACCTTGGCTTCCCAAAGG + Intronic
1001400389 5:171442801-171442823 TCCCCAGCCGGGTTTCCCAGAGG - Intronic
1002068763 5:176665943-176665965 TCCCAAGCCTGGCTTCCCTTGGG - Intergenic
1003174767 6:3746412-3746434 TGCCCTGCCAGGGCTCCCATGGG - Intronic
1003309646 6:4958114-4958136 AGCCCATCCTGGCATCCCATGGG + Intergenic
1004264966 6:14141287-14141309 TGCGCTGCCTGGGATCCCACAGG - Intergenic
1004901380 6:20197283-20197305 TTCCCAGCCTGACTTCCCTTTGG - Intronic
1007018870 6:38498602-38498624 TGCCCAGCCTTTGTTGCTATTGG - Intronic
1007790752 6:44306825-44306847 CCCCCAGCCTGGGTGCCCAGAGG - Intronic
1011736170 6:90313022-90313044 CGCCCACCCTGGGTTCCCAGTGG - Intergenic
1013284794 6:108671984-108672006 TGCTTAGCATGGGTACCCATCGG + Intronic
1014253439 6:119138665-119138687 TGCCCAGGCTGGGGTGCAATGGG + Intronic
1015155337 6:130088672-130088694 TCCCCAGCCTGGCTCCCCAGAGG + Intronic
1018778716 6:167043419-167043441 TGCCCAGGCTGGAGTGCCATGGG + Exonic
1018898831 6:168040690-168040712 TTCTCAGCCTGGGATCCCAGTGG - Intronic
1019135919 6:169907684-169907706 GGCCCAGCCTGGGTTCAGCTGGG - Intergenic
1019157988 6:170051768-170051790 AGCCCTGCCTGGGTCCCCACTGG + Intergenic
1019295330 7:270802-270824 TGGCCAGCCTGGGTGGCCGTGGG - Intergenic
1019600367 7:1880268-1880290 TGCCCAGCCTGGGTCACCACAGG - Intronic
1020227297 7:6290372-6290394 TGCCCAGCAAGGGTTACCACGGG - Intergenic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1022575122 7:31489978-31490000 TGCCCAGCCTGGGTTCCCCAGGG - Intergenic
1022942016 7:35250136-35250158 TGACCAGCCTGGATGCTCATGGG - Exonic
1026871532 7:73855771-73855793 CTGCCAGCCTGGGTACCCATCGG - Intergenic
1028778288 7:94705505-94705527 CGCGCAGCCCGGGTTCCCACTGG - Intergenic
1029664119 7:101983432-101983454 TGCCCACCCTGGGGTGCCCTGGG + Intronic
1035545396 8:478277-478299 TCTCTAGCCTGGATTCCCATGGG + Intergenic
1037280744 8:17239289-17239311 TGCCCACCCTGGCTTCCAACTGG + Intronic
1040531613 8:48270871-48270893 TGCCCAGCCTGGGCCTCCACTGG - Intergenic
1042308099 8:67352251-67352273 TGCCCACCTTGGCTTCCCAAAGG - Intergenic
1042747877 8:72127176-72127198 TGCCCAACCTGAGATCTCATCGG - Intergenic
1042920746 8:73917151-73917173 TGCCCAGGCTGGAGTGCCATGGG + Intergenic
1046446847 8:114332532-114332554 TGCCCAACCATTGTTCCCATTGG - Intergenic
1047614289 8:126550501-126550523 TGCCCAGGCTGGAGTGCCATTGG + Intergenic
1047966685 8:130050383-130050405 TGCCCAGCCTAGCCCCCCATTGG - Intergenic
1049309601 8:141926629-141926651 TGTCTAGCCTGGGCTCCCTTTGG + Intergenic
1049318297 8:141981384-141981406 TGGACAGCATGGGGTCCCATGGG - Intergenic
1049577089 8:143394408-143394430 TGCCCAGCCAGGGCTCCTAAGGG - Intergenic
1053351014 9:37413260-37413282 TGCCCAACATGGGTCCCCACAGG - Intergenic
1058561763 9:106236802-106236824 TGCCCAGGCTGGAGTGCCATTGG + Intergenic
1059335627 9:113566840-113566862 TGCCCTGGCTGGGATCCCACAGG - Intronic
1059418893 9:114178916-114178938 TGCCCACCCCAAGTTCCCATGGG + Intronic
1059649534 9:116302909-116302931 TGCCCAGGCTGGGTCATCATCGG + Exonic
1060155719 9:121318604-121318626 TGCCCAGCAGGGGTCCCCAGGGG - Intronic
1060985076 9:127815166-127815188 AGCCCAGCCTGGGAGCCCAGAGG - Exonic
1061069908 9:128302976-128302998 TGCCCAGGCTGGGCGCCCAATGG - Intergenic
1062015350 9:134288391-134288413 TGCCCTGCCTGGGTTTACTTGGG - Intergenic
1062280591 9:135750041-135750063 TCCCCAGCCTGAGTCCCCACTGG + Intronic
1185723625 X:2401967-2401989 TGCCCAGCGTGGGATCTCAGAGG + Intronic
1186292181 X:8112500-8112522 TGCCCAGCCTGGAGTGCAATGGG + Intergenic
1186529715 X:10282716-10282738 TGTCTAACCTGGTTTCCCATTGG - Intergenic
1192551397 X:72057017-72057039 GCTCCAGCCTGGGTTCCCAATGG - Intergenic
1195349891 X:103985954-103985976 TGCCCATCGTGGGCTCCCAAGGG - Intergenic
1195357552 X:104052885-104052907 TGCCCATCGTGGGCTCCCAAGGG + Intergenic
1197793960 X:130281433-130281455 GGCCCAGGCTGGGTTCCCTGAGG - Intergenic
1200877360 Y:8172014-8172036 TGCCCAGGCTGGAGTCCAATAGG + Intergenic
1201707546 Y:16953954-16953976 TGCCCAGCCAGGGCCACCATAGG + Intergenic
1202100617 Y:21303917-21303939 TGCCCAGCCCTGGTTCCCGCTGG + Intergenic