ID: 928176329

View in Genome Browser
Species Human (GRCh38)
Location 2:29036722-29036744
Sequence CATCGCATCCAGCACAGCCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 140}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928176329_928176336 17 Left 928176329 2:29036722-29036744 CCGTGGCTGTGCTGGATGCGATG 0: 1
1: 0
2: 1
3: 10
4: 140
Right 928176336 2:29036762-29036784 GTGTCCCACGTGGGCCTGTGTGG 0: 1
1: 0
2: 2
3: 15
4: 179
928176329_928176331 -10 Left 928176329 2:29036722-29036744 CCGTGGCTGTGCTGGATGCGATG 0: 1
1: 0
2: 1
3: 10
4: 140
Right 928176331 2:29036735-29036757 GGATGCGATGGTTGAGAGCCTGG 0: 1
1: 0
2: 4
3: 9
4: 105
928176329_928176332 -9 Left 928176329 2:29036722-29036744 CCGTGGCTGTGCTGGATGCGATG 0: 1
1: 0
2: 1
3: 10
4: 140
Right 928176332 2:29036736-29036758 GATGCGATGGTTGAGAGCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 96
928176329_928176339 23 Left 928176329 2:29036722-29036744 CCGTGGCTGTGCTGGATGCGATG 0: 1
1: 0
2: 1
3: 10
4: 140
Right 928176339 2:29036768-29036790 CACGTGGGCCTGTGTGGCTCTGG 0: 1
1: 1
2: 2
3: 19
4: 218
928176329_928176335 8 Left 928176329 2:29036722-29036744 CCGTGGCTGTGCTGGATGCGATG 0: 1
1: 0
2: 1
3: 10
4: 140
Right 928176335 2:29036753-29036775 CCTGGGTGAGTGTCCCACGTGGG 0: 1
1: 0
2: 0
3: 13
4: 99
928176329_928176333 7 Left 928176329 2:29036722-29036744 CCGTGGCTGTGCTGGATGCGATG 0: 1
1: 0
2: 1
3: 10
4: 140
Right 928176333 2:29036752-29036774 GCCTGGGTGAGTGTCCCACGTGG 0: 1
1: 0
2: 1
3: 7
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928176329 Original CRISPR CATCGCATCCAGCACAGCCA CGG (reversed) Exonic