ID: 928176334

View in Genome Browser
Species Human (GRCh38)
Location 2:29036753-29036775
Sequence CCCACGTGGGACACTCACCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928176334_928176339 -8 Left 928176334 2:29036753-29036775 CCTGGGTGAGTGTCCCACGTGGG 0: 1
1: 0
2: 0
3: 13
4: 109
Right 928176339 2:29036768-29036790 CACGTGGGCCTGTGTGGCTCTGG 0: 1
1: 1
2: 2
3: 19
4: 218
928176334_928176346 29 Left 928176334 2:29036753-29036775 CCTGGGTGAGTGTCCCACGTGGG 0: 1
1: 0
2: 0
3: 13
4: 109
Right 928176346 2:29036805-29036827 CTCCTGCTTGGAAATCTGCAAGG 0: 1
1: 0
2: 2
3: 31
4: 2057
928176334_928176341 17 Left 928176334 2:29036753-29036775 CCTGGGTGAGTGTCCCACGTGGG 0: 1
1: 0
2: 0
3: 13
4: 109
Right 928176341 2:29036793-29036815 ACCATGTCCACCCTCCTGCTTGG 0: 1
1: 0
2: 5
3: 12
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928176334 Original CRISPR CCCACGTGGGACACTCACCC AGG (reversed) Exonic