ID: 928176339

View in Genome Browser
Species Human (GRCh38)
Location 2:29036768-29036790
Sequence CACGTGGGCCTGTGTGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928176334_928176339 -8 Left 928176334 2:29036753-29036775 CCTGGGTGAGTGTCCCACGTGGG 0: 1
1: 0
2: 0
3: 13
4: 109
Right 928176339 2:29036768-29036790 CACGTGGGCCTGTGTGGCTCTGG 0: 1
1: 1
2: 2
3: 19
4: 218
928176329_928176339 23 Left 928176329 2:29036722-29036744 CCGTGGCTGTGCTGGATGCGATG 0: 1
1: 0
2: 1
3: 10
4: 140
Right 928176339 2:29036768-29036790 CACGTGGGCCTGTGTGGCTCTGG 0: 1
1: 1
2: 2
3: 19
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928176339 Original CRISPR CACGTGGGCCTGTGTGGCTC TGG Intronic