ID: 928180005

View in Genome Browser
Species Human (GRCh38)
Location 2:29062294-29062316
Sequence CAGGGCGAGGCTCCTGCCAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 164}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928180005_928180017 23 Left 928180005 2:29062294-29062316 CCTATGGCAGGAGCCTCGCCCTG 0: 1
1: 0
2: 3
3: 8
4: 164
Right 928180017 2:29062340-29062362 CAAACGTGGAGGTCCTCCAGAGG 0: 1
1: 0
2: 0
3: 6
4: 57
928180005_928180013 12 Left 928180005 2:29062294-29062316 CCTATGGCAGGAGCCTCGCCCTG 0: 1
1: 0
2: 3
3: 8
4: 164
Right 928180013 2:29062329-29062351 TTGGCCCCAAGCAAACGTGGAGG 0: 1
1: 0
2: 2
3: 3
4: 74
928180005_928180018 24 Left 928180005 2:29062294-29062316 CCTATGGCAGGAGCCTCGCCCTG 0: 1
1: 0
2: 3
3: 8
4: 164
Right 928180018 2:29062341-29062363 AAACGTGGAGGTCCTCCAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 82
928180005_928180008 -7 Left 928180005 2:29062294-29062316 CCTATGGCAGGAGCCTCGCCCTG 0: 1
1: 0
2: 3
3: 8
4: 164
Right 928180008 2:29062310-29062332 CGCCCTGTCCTGGCACACGTTGG 0: 1
1: 0
2: 2
3: 4
4: 78
928180005_928180019 30 Left 928180005 2:29062294-29062316 CCTATGGCAGGAGCCTCGCCCTG 0: 1
1: 0
2: 3
3: 8
4: 164
Right 928180019 2:29062347-29062369 GGAGGTCCTCCAGAGGGACAAGG 0: 1
1: 0
2: 1
3: 15
4: 244
928180005_928180012 9 Left 928180005 2:29062294-29062316 CCTATGGCAGGAGCCTCGCCCTG 0: 1
1: 0
2: 3
3: 8
4: 164
Right 928180012 2:29062326-29062348 ACGTTGGCCCCAAGCAAACGTGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928180005 Original CRISPR CAGGGCGAGGCTCCTGCCAT AGG (reversed) Exonic
900109589 1:999915-999937 CTGGCCGGCGCTCCTGCCATCGG + Exonic
900111237 1:1006450-1006472 CAGGGTGAGGCTCCTCCCCATGG + Intergenic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
900553144 1:3266552-3266574 CAGGGAGTGGCTCCTGCCCCTGG - Intronic
902612204 1:17603802-17603824 CAGGGCCATGCTCCGGCTATGGG + Intronic
904171156 1:28592845-28592867 GAGGGCGAGGTCCCTGCCCTGGG + Intronic
905649536 1:39647058-39647080 GAGGGCCTGGTTCCTGCCATTGG + Intergenic
909521544 1:76574448-76574470 CAGGGAGAGGATTCAGCCATGGG - Intronic
915932196 1:160067732-160067754 TAGGCCGAGCCTCCTGGCATTGG - Intronic
920066455 1:203273074-203273096 CAGGGAGACGATCCTGCCTTTGG + Intronic
920872117 1:209803588-209803610 CAGGCTGGGGCTCCTTCCATGGG - Intronic
921899529 1:220435670-220435692 CAGGTCTAGACTCCTTCCATCGG - Intergenic
922748463 1:228060029-228060051 CAGGGCAAGGCCCCTTCCACGGG + Exonic
923313025 1:232754565-232754587 CAGGGCCAGGCTCCCTCCAGAGG - Intergenic
1065797202 10:29318668-29318690 CCGGGCCAGGCTGCTGTCATCGG + Intergenic
1070635398 10:78122479-78122501 TAGGGCGACGCTCCTTCCAAAGG - Intergenic
1072040326 10:91600645-91600667 CAGGCCAAGGCTCCTGCTCTTGG - Intergenic
1073073798 10:100810782-100810804 CAGGGTAGGGCTCCTGCCACAGG + Intronic
1074934822 10:118167459-118167481 CAGGGCCTGGTTCCTGCCAAGGG - Intergenic
1075222965 10:120600586-120600608 GAGGGGGAGGCAGCTGCCATAGG + Intergenic
1075468605 10:122671175-122671197 CAGCCCAAGGATCCTGCCATGGG - Intergenic
1075643715 10:124084175-124084197 CAGCGCGTGGCCCCTGCCCTTGG - Intronic
1078065435 11:8075972-8075994 CAGGGTGAGACTCCAGCGATGGG - Intronic
1078405843 11:11069290-11069312 CATGGTGAGTTTCCTGCCATGGG - Intergenic
1079084225 11:17433720-17433742 GAAGGCAAGGCTCCTGCAATTGG + Intronic
1082714959 11:56600860-56600882 CAGGGAGAAGCTTCTGCAATTGG + Intergenic
1082838192 11:57667198-57667220 TAGGGCGAGGCTCCTGCCAAGGG - Intergenic
1084324281 11:68390628-68390650 CAGGGCGAGGCTGCGTCCACGGG - Intronic
1084324293 11:68390680-68390702 CAGGGCGAGGCTGCGTCCACGGG - Intronic
1084324305 11:68390732-68390754 CAGGGCGAGGCTGCGTCCACAGG - Intronic
1084324316 11:68390784-68390806 CAGGGCGAGGCTGCGTCCACGGG - Intronic
1084324328 11:68390836-68390858 CAGGGCGAGGCTGCGTCCACAGG - Intronic
1086886482 11:92211777-92211799 CAGGTGGAGTCTCTTGCCATGGG + Intergenic
1090381928 11:126333516-126333538 CAGGGAGAGGATCCTCCCCTTGG + Intronic
1090799070 11:130159652-130159674 CTGGGGGAGGCTCCTCCCCTCGG - Exonic
1094045159 12:26159080-26159102 TAGAGCCAGGCTCCAGCCATGGG - Intronic
1096558820 12:52421613-52421635 CTGGGCCAGGGTCCTGCCCTGGG - Intergenic
1099864230 12:88258813-88258835 GAGAGCAAAGCTCCTGCCATAGG - Intergenic
1110174350 13:72538235-72538257 CCCGCCCAGGCTCCTGCCATCGG - Intergenic
1112143569 13:96673023-96673045 CAGGGCCATGCTCCTTCCAGGGG + Intronic
1117058064 14:51933082-51933104 CAGAGCCATGCTCCTGCCAGAGG - Intronic
1119322160 14:73738723-73738745 GAGCGAGAGGCTCCTGCCATGGG - Exonic
1129329286 15:74818732-74818754 AAGGGCTGGGCTCCTGTCATTGG + Exonic
1129738255 15:77977486-77977508 CAGAGCCAAGCTCCTGCAATCGG - Intergenic
1129814928 15:78543435-78543457 CAGGGCTAGGCTCCTACTAGAGG - Intronic
1129847819 15:78776107-78776129 CAGAGCCAAGCTCCTGCAATCGG + Intronic
1130062133 15:80577725-80577747 CAGAGAGAGGCCCCTGCCACGGG + Intronic
1130254088 15:82317808-82317830 CAGAGCCAAGCTCCTGCAATCGG - Intergenic
1130600884 15:85272163-85272185 CAGAGCCAAGCTCCTGCAATCGG + Intergenic
1130882107 15:88064205-88064227 CAGAGCCATGCTCCTGCCAAAGG - Intronic
1131144299 15:90001585-90001607 CCGGGCGCGGCTCCTGCGCTGGG - Exonic
1132516094 16:366689-366711 CAGGGAGAGGCTCCTGACTCAGG + Intergenic
1133025685 16:2988115-2988137 CAGAGCTAGACTCCTGCCACAGG + Intergenic
1133090596 16:3401130-3401152 CAGGGCCCGCCTCCTGCCAAGGG - Intronic
1136291231 16:29272686-29272708 CAAGGCGGAGCTCCTGCCCTTGG - Intergenic
1139551077 16:67673425-67673447 CAGGCCGAGGCTCCTGCCACAGG + Intergenic
1140467276 16:75192595-75192617 CAGGGCAAAGCTGTTGCCATTGG + Intergenic
1142097103 16:88246151-88246173 CAAGGCGGAGCTCCTGCCCTTGG - Intergenic
1144874937 17:18392559-18392581 CATGGGGAGGCTTCTGCCCTTGG + Intergenic
1145157287 17:20551862-20551884 CATGGGGAGGCTTCTGCCCTTGG - Intergenic
1149789153 17:59462173-59462195 TGGGGCGAGGCTGCTGCCACAGG + Intergenic
1150706582 17:67492473-67492495 CAGGGCCAGGCTCCCTCCAAAGG - Intronic
1151551385 17:74824432-74824454 CAGGGGCAGCCTCCCGCCATCGG - Intronic
1152558941 17:81068327-81068349 GAGGGGGAGACCCCTGCCATGGG - Intronic
1153758433 18:8306691-8306713 CAGGGCCAGGGTCTAGCCATTGG - Intronic
1155113045 18:22735466-22735488 CAGGGCCAGTCCCATGCCATGGG + Intergenic
1158540708 18:58351457-58351479 CAGAGCGGGCATCCTGCCATAGG - Intronic
1158970755 18:62664153-62664175 AAGGGAGAGGCTTCTGCCCTTGG - Intergenic
1159188996 18:65017352-65017374 CAGGGCGGGGCTCCTGGGACTGG + Intergenic
1161371310 19:3913514-3913536 CAGGGCCATGCACCTGACATGGG - Intronic
1161654808 19:5507704-5507726 CAGGGCGAGCCACCGGCCTTGGG + Intergenic
1162849347 19:13418647-13418669 CCGGGGGAGGATCCTTCCATTGG - Intronic
1163366173 19:16877241-16877263 CCGGGCGGTGCTCCTGCCAAAGG + Intronic
1167410166 19:49339607-49339629 CAGGGAAAGCCTCCTGCTATTGG + Intronic
925318290 2:2941480-2941502 CAGGGCCAGGCTCCTGGTGTCGG - Intergenic
925341160 2:3137501-3137523 GTGGGCGTGGCTCCTGCCCTTGG - Intergenic
926147541 2:10405747-10405769 CAGGGCGCTGCTCCTGCCCGAGG - Intronic
927779708 2:25929357-25929379 CATGGAGAGGCTCATGCGATTGG - Exonic
928180005 2:29062294-29062316 CAGGGCGAGGCTCCTGCCATAGG - Exonic
931856272 2:66304784-66304806 CAGGGCTAGACTTCTGTCATGGG - Intergenic
936289354 2:111208125-111208147 CAGGCAGAGGCCCTTGCCATGGG - Intergenic
937032619 2:118753140-118753162 AAAGGCCAGGCTCCTGCCCTGGG - Intergenic
937291789 2:120786207-120786229 CAGGGAGAGGAGCCTCCCATTGG - Intronic
941080887 2:161059295-161059317 CAGCGCCAGGCTACTGCCACAGG + Intergenic
942321337 2:174739161-174739183 CAGGGAGAGGATGGTGCCATGGG - Intergenic
942604067 2:177672034-177672056 CTGGGGGAGGCTCCTGTAATAGG - Intronic
944352596 2:198746366-198746388 CAGGGCCAGGGTCCTGCTGTGGG - Intergenic
945529285 2:210930590-210930612 CAGGGCTAAGCTCCTTCCAGTGG + Intergenic
947828982 2:233125579-233125601 GAGGGAGAGCCTCCTGCCACAGG - Intronic
948487820 2:238291846-238291868 CAGGGACAGGCACCTGCCCTCGG - Intergenic
948527410 2:238580237-238580259 CAGGGCGTGGGTCCTGCCCAAGG + Intergenic
948797368 2:240411898-240411920 TAGGGCAAAGCACCTGCCATGGG + Intergenic
948853119 2:240718014-240718036 CAGGGCGAGGTTGCTGCCATGGG - Intronic
1169316054 20:4592127-4592149 CAGGGCGTTGCTCCTGGGATGGG + Intergenic
1170569189 20:17623319-17623341 CACCGCAAAGCTCCTGCCATTGG + Intronic
1172426464 20:34859571-34859593 CCGGGAGACGTTCCTGCCATCGG - Exonic
1172447188 20:34999424-34999446 CAGGGCCAGGGTGCTGCCCTGGG + Intronic
1172962033 20:38806322-38806344 CAGGTGGAGGCGCCTGCCTTGGG - Intronic
1174161126 20:48551222-48551244 CAGGGCTGGGCTCCTCCCATTGG - Intergenic
1175269456 20:57723569-57723591 CAGGGCCAGGCTCCCTCCAGAGG - Intergenic
1175723935 20:61303998-61304020 TAGGGATAGGCTCCTGCCAGTGG + Intronic
1175909657 20:62398688-62398710 CAGTGGGAGGCTCCTGGCAAGGG - Intronic
1176057590 20:63156730-63156752 CAAGGGGAGGCTCCTGCCTTGGG + Intergenic
1176060033 20:63168483-63168505 CATGGCGAGGCTCCCGCCCCAGG + Intergenic
1176085729 20:63294642-63294664 CAGGGCGAGGCTGGGGCCACAGG + Intronic
1178454075 21:32730500-32730522 CAGGGCCATGCTCCTTCCAAAGG - Intergenic
1180902622 22:19385695-19385717 GATGGCTAGGCTCTTGCCATAGG + Exonic
1181256590 22:21566873-21566895 CAGAGCCAGGCTCCTGTCACAGG - Intronic
1181631311 22:24153060-24153082 CAGAGCTAGGCTGCTGCCAAAGG - Intronic
1182555175 22:31125284-31125306 CAGGGCCAGGCTCAGGCCAGAGG - Exonic
1182665399 22:31955244-31955266 CAGGGCGAAGCTCTGGCCACTGG + Intronic
1183257434 22:36771467-36771489 CAGGGCTGGGCTCCTCCCAGTGG + Intronic
1184839056 22:47041935-47041957 CAGGGCCAGGCACTTGCTATAGG - Intronic
1185246318 22:49775132-49775154 CAGGGGGAGCCTCCTGTGATGGG + Intronic
1185286060 22:50000385-50000407 GAGGGCCAGGCCCCTGCCCTGGG + Intronic
949308052 3:2665638-2665660 TAGGGTGAGGCTCATCCCATAGG - Intronic
949369827 3:3322589-3322611 CAGGGCCAGGCTCCCTCCAGGGG - Intergenic
950370372 3:12524391-12524413 CAGGGCCAGGCTCCCTCCAAAGG + Intronic
954152419 3:48664047-48664069 CAGGGTGCGGCTCCCGCGATGGG + Intergenic
954807068 3:53226775-53226797 CACGGTGAGGATCCTGCCCTTGG + Exonic
958615937 3:96493787-96493809 CAAGGCGTGGCTGGTGCCATGGG + Intergenic
961647282 3:128399406-128399428 AAGAGCGAGGCTCCTGCGAAGGG + Intronic
961817075 3:129556584-129556606 CAGGGTGAGGCACCTGCCCTCGG - Intronic
962294875 3:134174203-134174225 CAGGGCTGGGCTCCTTCCAGAGG - Intronic
962686824 3:137856006-137856028 CAGGGCCATGCTCTTGCCAAAGG + Intergenic
962844412 3:139262329-139262351 AAGGGCCAGGCTCCACCCATAGG - Intronic
963029826 3:140958469-140958491 GAAGGCGAGGCCCCTGACATTGG - Intronic
964517744 3:157531138-157531160 CAGGCCGAGGAGCCTGCCAAGGG + Intronic
966853893 3:184181018-184181040 CAGGCCCAGGATCCTGCCCTGGG - Intronic
968929819 4:3572938-3572960 CAAGGCCAGGCTCCTGTCAAGGG + Intergenic
969486422 4:7474845-7474867 CAGGGCCAGGCTCCCTCTATGGG + Intronic
969657240 4:8505362-8505384 CAGGAGGAGCCTCCTGCCCTGGG + Intergenic
972561352 4:40231741-40231763 AAGTGGGAGGCTCCTGCCGTTGG - Intronic
973717684 4:53693379-53693401 AGGGAGGAGGCTCCTGCCATAGG + Intronic
979282906 4:118887265-118887287 CAGGGAGAGGCTCAAGCCACTGG + Intronic
983748094 4:171226559-171226581 CAGGGCCAGACTGCTCCCATGGG + Intergenic
985479915 5:103074-103096 CAGGGCAAGGCTCCTGTCCTGGG - Intergenic
992598275 5:78368262-78368284 CAGGGGAAGGCTGCTGCCATAGG + Intronic
994661846 5:102663172-102663194 GAGAGCAAGGCTCCTTCCATGGG - Intergenic
997372399 5:133370388-133370410 CAGGGAGAGGCTCCTTAAATAGG - Intronic
997505287 5:134412037-134412059 CAGCCCGTGGCTCCTGCCCTGGG + Intergenic
998193160 5:140043559-140043581 CAGGGCGTGCCCCCTGCCTTTGG + Intergenic
998523945 5:142825498-142825520 CAAGGAGAGGCTGCTGACATAGG - Intronic
1000121599 5:158203267-158203289 TGGGACAAGGCTCCTGCCATTGG + Intergenic
1002066568 5:176654837-176654859 CAGGGTGAGGCTCCTGGGATGGG + Intronic
1002096036 5:176831534-176831556 CACGGCTAGGCCCCTTCCATGGG - Intronic
1002098783 5:176847170-176847192 CAGGGCCTGGCTCCAGCCGTCGG - Intronic
1004279485 6:14268922-14268944 CAGGGCCATGCTCCTTCCAAAGG + Intergenic
1005087510 6:22022110-22022132 CAGGGCTGAGCTCCTGCCAGAGG + Intergenic
1006098665 6:31672032-31672054 CAGGGCCAGGGGCCTGTCATGGG - Exonic
1014778112 6:125533739-125533761 GAGTGCGTGGCTCCTGCCCTGGG - Intergenic
1018432684 6:163735326-163735348 CAGGGTGAGGTTGCTGCCCTCGG + Intergenic
1019188311 6:170234426-170234448 CAGGGTGAGCCTTCTGCCCTGGG - Intergenic
1019570351 7:1708551-1708573 CAGGGAGAGGGCCCTGCCAGGGG + Intronic
1019619050 7:1980626-1980648 CAGGGCGGGGGTGCTGCCAGGGG - Intronic
1021678642 7:23106453-23106475 TGGGGCGAGGATCCTTCCATTGG + Intronic
1024582091 7:50808648-50808670 CAGGGCCACGCTCCTTCCAGGGG - Intergenic
1024948361 7:54834028-54834050 CAGGGCCGGCCTCCTGCCCTAGG + Intergenic
1025019107 7:55466874-55466896 CATGGTAAGGCTCCTGGCATGGG - Intronic
1025236508 7:57238234-57238256 CAGGGCTGGGCTCCTCCCATTGG - Intergenic
1029566633 7:101342880-101342902 CAGGCCGAGGCTACTGCACTCGG - Intergenic
1031337640 7:120555429-120555451 CAGGGACATGCTCCTGCAATTGG + Intronic
1036638521 8:10567590-10567612 CAGGGAGAGGGTCCTGGCTTTGG - Intergenic
1036662148 8:10715512-10715534 TAGGGCCAGTCTCCTGCCCTGGG - Intergenic
1045650997 8:104341597-104341619 CAGGGCCAAGCTGTTGCCATGGG - Intronic
1049449472 8:142652585-142652607 CAGGGAGGGGCTCATTCCATAGG + Intergenic
1050413313 9:5388624-5388646 GAGGGCTAGGCTCATGCCCTTGG - Intronic
1054460460 9:65459534-65459556 CAAGGCCAGGCTCCTGTCAAGGG - Intergenic
1055599172 9:77897566-77897588 CAGCACTGGGCTCCTGCCATGGG + Intronic
1060053099 9:120391007-120391029 CAGGGCAAAGTTCCTGACATGGG + Intronic
1060987774 9:127829642-127829664 CAGGCTGAGGCTCTGGCCATGGG - Intronic
1061422728 9:130480843-130480865 CAGGGCGAAAATCCTGCCAGGGG + Intronic
1061940752 9:133882594-133882616 CAGGGCCACGCTCCTTCCAGAGG - Intronic
1061954616 9:133955317-133955339 CAAGGCGAGGCTCCTGGCTGCGG + Intronic
1196746113 X:119073013-119073035 CAGCGGGAGGCTCCTGGGATCGG + Intergenic
1200081570 X:153579354-153579376 CAGGTCCCGGCTCCAGCCATGGG + Intronic