ID: 928181363

View in Genome Browser
Species Human (GRCh38)
Location 2:29071115-29071137
Sequence GGAAGTTCGCCGCTTTGTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 37}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928181363 Original CRISPR GGAAGTTCGCCGCTTTGTGG TGG Exonic
901489316 1:9588742-9588764 TGACCTTCGCCGCTTTGTAGCGG - Intergenic
908749149 1:67402933-67402955 GTAAGTTGGCCCCTTTGTGGAGG + Intergenic
915235860 1:154481218-154481240 GGGAGTTCACAGCTGTGTGGTGG - Exonic
922461590 1:225817640-225817662 GGAAGTCTGCCACTTTGGGGAGG - Intronic
922865005 1:228852305-228852327 GGAAGTTCACGTCTTTGAGGGGG + Intergenic
1065803101 10:29370426-29370448 AGCAGTTCCCCACTTTGTGGAGG + Intergenic
1072363807 10:94688234-94688256 GGAAGCCCGCTGCCTTGTGGAGG + Exonic
1072372250 10:94775499-94775521 GGAAGCCCGCTGCCTTGTGGAGG + Exonic
1072387141 10:94942301-94942323 GGAAGCCCGCTGCCTTGTGGAGG + Exonic
1072398172 10:95067226-95067248 GGAAGCTCACTGCCTTGTGGAGG - Exonic
1073194043 10:101673516-101673538 GGACGTTTGCCACTTTGTGCTGG - Exonic
1077084632 11:742856-742878 GGTAGTGCTCCACTTTGTGGAGG + Intergenic
1083297671 11:61723942-61723964 GGAAGTTGACAGCTGTGTGGTGG - Intronic
1098284802 12:68896185-68896207 GGAGGTTGGCCGCTTTGATGGGG - Intronic
1100015704 12:90008452-90008474 CAGAGTTCCCCGCTTTGTGGGGG + Intergenic
1104613206 12:130246832-130246854 GGAAGTTCTCGGCTTGATGGGGG - Intergenic
1115157518 14:30357865-30357887 GGATGTTCACCACTTTGTAGCGG + Intergenic
1130879843 15:88045540-88045562 GGAAGTTCACAGCTTTGGAGAGG - Intronic
1135072572 16:19364868-19364890 GGAAGTTCTGCACTCTGTGGAGG + Intergenic
1142618623 17:1151539-1151561 GGAAGAACGCGGCTTTGAGGTGG - Intronic
1167365993 19:49055255-49055277 GGAAGGACGCCTCTTTCTGGAGG - Intronic
925282603 2:2695279-2695301 GGAAGCTGGCGGCTTTGTTGTGG - Intergenic
926630646 2:15133201-15133223 GGAAGTTCACAGCCTTGTGGAGG + Intergenic
928181363 2:29071115-29071137 GGAAGTTCGCCGCTTTGTGGTGG + Exonic
941720471 2:168807215-168807237 GGAACTTACCTGCTTTGTGGGGG - Intronic
947670214 2:231930959-231930981 GGAAGTGAGCCTATTTGTGGAGG - Intergenic
1174845367 20:53938208-53938230 GGAGGTTGGCCACTTTGGGGAGG - Intronic
1179183093 21:39061955-39061977 GGAAGTTCGTCCCCTGGTGGTGG - Intergenic
1181491588 22:23263607-23263629 GGACGTTTGCCACTTTGTGCTGG + Intronic
950139734 3:10607327-10607349 GGGAGTGCCCAGCTTTGTGGGGG - Intronic
951381644 3:21991374-21991396 GAAAATTCACGGCTTTGTGGTGG - Intronic
968842139 4:3015321-3015343 GGAGGTTAGCTGCTTTGTGCAGG + Intronic
1005626783 6:27669902-27669924 GGAAGGTGGCAGCTTTGGGGCGG - Intergenic
1011352330 6:86435975-86435997 GGTGGTTCTCCGCTTTGGGGAGG - Intergenic
1014674713 6:124349295-124349317 GGAAGTTCCCGCCTTTGTAGGGG - Intronic
1033713928 7:143980231-143980253 GGAAGTTGGCCACCTTGTGTTGG + Intergenic
1033901472 7:146146368-146146390 GGAAGTTCGCCATTTATTGGAGG + Intronic
1050018643 9:1261499-1261521 TGAAGATAGCCGCTTTTTGGTGG + Intergenic
1050365763 9:4872359-4872381 GGAAGTCAGCTGCTTTGTGGAGG - Intronic
1197996324 X:132378859-132378881 TGAAGTTCTCTGCTTTGTGCAGG + Exonic
1198051450 X:132956638-132956660 GCACGTTCGCCGCGCTGTGGCGG - Intronic