ID: 928181612

View in Genome Browser
Species Human (GRCh38)
Location 2:29072279-29072301
Sequence GTTGCTTGGACTGACCCTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928181609_928181612 -4 Left 928181609 2:29072260-29072282 CCTTGAGCCTGCTGGTGGTGTTG 0: 1
1: 0
2: 1
3: 22
4: 262
Right 928181612 2:29072279-29072301 GTTGCTTGGACTGACCCTGCAGG 0: 1
1: 0
2: 1
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928181612 Original CRISPR GTTGCTTGGACTGACCCTGC AGG Exonic
904689023 1:32280025-32280047 TCTGCTTGGCCAGACCCTGCAGG - Intronic
907766784 1:57421048-57421070 GATGCTTGGAGCCACCCTGCAGG - Intronic
911508264 1:98781017-98781039 GTTGCTTAGACTATACCTGCAGG - Intergenic
912776646 1:112509757-112509779 GTTCCTTGAACTCACCCTGAGGG - Intronic
915076439 1:153311827-153311849 GTTGCTTGTCCTGACCCAGGAGG - Intergenic
919115724 1:193278151-193278173 GATGCTTGGACTGATCTTGAAGG + Intergenic
922757632 1:228105405-228105427 GTTGCATGGCCTGTGCCTGCTGG + Intronic
922948591 1:229538472-229538494 GTTTCCTGGATTGAGCCTGCTGG - Intronic
923062728 1:230490663-230490685 GTTCCCTGGCCTGACCCTGTAGG + Intergenic
1066310208 10:34188826-34188848 GTTTCTTGGAATGACCATGGTGG - Intronic
1067434463 10:46267026-46267048 GATGCTGGGACTGATCCTGTGGG + Intergenic
1070841643 10:79491658-79491680 GGTGCTGGGAGTGACCCTGGGGG + Intergenic
1071905060 10:90163877-90163899 GTTGATTGGGCTGATCCAGCTGG - Intergenic
1074079020 10:110152749-110152771 GTTGAATGGAGTGACCATGCTGG - Intergenic
1074767074 10:116707318-116707340 GTGGCATGGACTGACCCAGGGGG + Intronic
1075375061 10:121972347-121972369 GTTGCTTAATCAGACCCTGCAGG - Intronic
1079201898 11:18383722-18383744 GTAGCTTGGCCTCACTCTGCAGG - Intergenic
1082248236 11:49949972-49949994 GTTTCTTCGTCTTACCCTGCGGG + Intergenic
1085509901 11:77082940-77082962 GCTTCCTGAACTGACCCTGCCGG + Intronic
1085607124 11:77911234-77911256 GTTGCTTGAACTGGTCCTGGAGG + Intronic
1088328860 11:108629301-108629323 GAGGCTTGGCGTGACCCTGCAGG - Intergenic
1090017809 11:123101566-123101588 GCTGCTTGGGCTGAGACTGCTGG + Intronic
1091237158 11:134029994-134030016 TTTGCTTGTACAGACACTGCTGG - Intergenic
1094352933 12:29546469-29546491 CTTCCTGGGACAGACCCTGCAGG + Intronic
1095597988 12:43980710-43980732 GTTGCTTGGCCAGAGTCTGCAGG - Intronic
1102827421 12:115961204-115961226 GTTCCTTGGACTGAGGTTGCAGG + Exonic
1112881131 13:104107746-104107768 GTTTCTTGGGATGACTCTGCAGG - Intergenic
1122946070 14:105010301-105010323 GGTGCATGGGCTGACCCTGATGG + Exonic
1124004244 15:25783850-25783872 GTTCCCTGGACTGACCATGCTGG - Intronic
1129744382 15:78007935-78007957 GTTGCAAGGCCTGGCCCTGCAGG - Intronic
1135825896 16:25728628-25728650 GTTGGTTGCTCTGATCCTGCTGG - Intronic
1135934608 16:26769040-26769062 TTTGCATGGACTGACCTTGATGG - Intergenic
1142876619 17:2854940-2854962 GTAGCTTCCAGTGACCCTGCTGG + Intronic
1146548611 17:33761298-33761320 GGTGCTTGGATTGAATCTGCTGG + Intronic
1147471554 17:40666799-40666821 ATTGCCAGGACTGACCCTCCAGG - Intergenic
1150811906 17:68363412-68363434 GGAGTTTGGATTGACCCTGCAGG + Intronic
1150816656 17:68397178-68397200 GTTCCTGGGCCTAACCCTGCTGG - Intronic
1152942508 17:83180363-83180385 GCTGCCTGGTGTGACCCTGCTGG + Intergenic
1154069174 18:11137650-11137672 TTTCCCTGGACTGTCCCTGCCGG - Intronic
1156020561 18:32595147-32595169 GTTGCTTGGACACAAGCTGCTGG + Intergenic
1156443020 18:37210603-37210625 TTAGCTTGGCCTGATCCTGCTGG - Intronic
1157410712 18:47460653-47460675 GTTGCTCAGACTCTCCCTGCAGG - Intergenic
1158728352 18:59995575-59995597 ATTGCTTGGTATGGCCCTGCAGG + Intergenic
1160516098 18:79480032-79480054 GTGGCCTGGGCTGACCCTGCAGG - Intronic
1164468885 19:28511807-28511829 GTTCTTTGGACTGTCCCTTCTGG - Intergenic
1164858875 19:31546842-31546864 GTGCCTTGGTCTGACCCTGTTGG - Intergenic
1165385518 19:35508240-35508262 GTTTCTTTGTCTCACCCTGCAGG - Intronic
1166069567 19:40379219-40379241 GGGGCTTGGACTGGCCCTGGGGG - Intronic
1167036943 19:47000324-47000346 GTTGTTGTGGCTGACCCTGCGGG - Exonic
925366027 2:3312754-3312776 GTTGCTTTGTCTGCCTCTGCTGG + Intronic
925796232 2:7546118-7546140 GTTGTTTGAAGTGACCCTGTGGG - Intergenic
926249775 2:11147966-11147988 TTTGCTGGCACTGACCCTGCAGG - Intergenic
927212915 2:20649724-20649746 GGCGTTTGGACTCACCCTGCAGG + Intronic
928181612 2:29072279-29072301 GTTGCTTGGACTGACCCTGCAGG + Exonic
937092866 2:119218114-119218136 CCTGCATGGACTGCCCCTGCTGG + Intergenic
941466470 2:165833387-165833409 ATGGCTTGGACTGACCAGGCTGG + Intergenic
946355297 2:219180802-219180824 TTTCCTTGGACTGACCCAGAGGG + Intronic
946972823 2:225114543-225114565 AATGCATGCACTGACCCTGCAGG + Intergenic
948383320 2:237566609-237566631 GATGCTGGGCCTGGCCCTGCGGG + Exonic
1168970804 20:1929575-1929597 GTACCTTGGACTCACACTGCTGG - Intronic
1173748502 20:45456988-45457010 CTTGCTGGGAATGTCCCTGCAGG + Intergenic
1174445470 20:50587964-50587986 CATGCTAGGACTGGCCCTGCAGG - Intronic
1179928738 21:44552580-44552602 GCTGCTTTGACTGGCCCTGTAGG - Intronic
1183668310 22:39257542-39257564 GCTTCTTGGCCTGGCCCTGCTGG - Intergenic
1185214121 22:49588915-49588937 GTTGCTTGGACTGAACCCATGGG - Intronic
1185417407 22:50717832-50717854 GTTCCTGGGCCCGACCCTGCAGG + Intergenic
952449069 3:33413787-33413809 ATTGCTTGGACAGGCCCTGCAGG - Intronic
953879853 3:46685996-46686018 ATGGCATGGACTGCCCCTGCAGG - Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954628604 3:52036212-52036234 GCTGCTTGGACAGCCCCTGACGG + Intergenic
959605910 3:108241826-108241848 GTCGCTTGGACCTACCCTGATGG + Intergenic
961588252 3:127953524-127953546 GTGGCTAGCACTGACCCTGGAGG + Intronic
962688399 3:137869065-137869087 GTTACCTGGACTCACCCTTCAGG - Intergenic
966863857 3:184245453-184245475 GTAGCATGGACTCACCTTGCAGG + Exonic
977458147 4:97289429-97289451 GCTGCTTAGACTGCTCCTGCAGG + Intronic
979387974 4:120092527-120092549 GTTGCTTTGGTTGACCTTGCGGG - Intergenic
982090086 4:151872803-151872825 GGTGAGTGGACTGAACCTGCAGG + Intergenic
985655593 5:1129977-1129999 GTAGCTTTGACTGCCCCAGCTGG - Intergenic
988492745 5:31718358-31718380 GTTGCATGGTCTGAGTCTGCAGG + Intronic
992847919 5:80772868-80772890 GGTCCTTGGACTGATCCTGAGGG - Intronic
997531025 5:134581396-134581418 ATTGCCCGGTCTGACCCTGCAGG + Exonic
1003967987 6:11271528-11271550 GCTGCTTAGACTGAACCTACTGG - Intronic
1004358447 6:14950014-14950036 GTTGCTTAGTCTGACCATTCAGG + Intergenic
1008601018 6:53094810-53094832 GTTGCTTTGACTGTGACTGCAGG + Intronic
1008649663 6:53549407-53549429 TTTGCTTAGATTGACCCAGCAGG - Intronic
1017698311 6:157041724-157041746 GGTGCTGGGGCTGACACTGCTGG - Intronic
1024506762 7:50168429-50168451 GTTTCATGGACTGTACCTGCAGG - Intergenic
1024582297 7:50809870-50809892 GTGGCCTGGTCTGGCCCTGCAGG - Intergenic
1025845879 7:65196984-65197006 GTTGCTTGAACTGGTCCTGGAGG - Intergenic
1025896104 7:65702697-65702719 GTTGCTTGAACTGGTCCTGGAGG - Intergenic
1027443436 7:78245463-78245485 GTTGTTTGGACTGTCCTTGTGGG - Intronic
1032123249 7:129171981-129172003 GTAGCTGGGACTGACCCAGGAGG - Intergenic
1033685139 7:143632792-143632814 GGCGCTTGGACTGACCCAGCAGG + Intronic
1033688312 7:143712011-143712033 GGCGCTTGGACTGACCCAGCAGG + Intronic
1033699475 7:143824829-143824851 GGCGCTTGGACTGACCCAGCAGG - Intergenic
1037898887 8:22676058-22676080 GTTGCTTGGTCTGACCTTCCTGG - Intergenic
1038565714 8:28618701-28618723 CGTGCCTGGCCTGACCCTGCGGG - Intronic
1039614779 8:38946636-38946658 ATGGCTTGGACTGACCCTGCAGG - Intronic
1041390712 8:57345043-57345065 GTTGTTCGGACTGACCATGTAGG - Intergenic
1042668329 8:71232284-71232306 GCCGCTTGGACTGACAGTGCAGG - Intronic
1044474523 8:92610645-92610667 GCAACTTGGACTCACCCTGCCGG - Intergenic
1047288418 8:123508038-123508060 GTTCCTTGTCCTGCCCCTGCTGG + Intronic
1050740622 9:8815425-8815447 GTTGCCTGAAATGACCCTGCTGG - Intronic
1055574688 9:77648832-77648854 GTGGCTGGGCCTGAGCCTGCTGG + Intergenic
1057180265 9:93026016-93026038 GCTGCTTGAAATGACCCAGCAGG - Intronic
1061755198 9:132807497-132807519 GTTGCTTGGACTTCCTCTGGAGG - Intronic
1062525782 9:136977599-136977621 GTGGATGGGACTGGCCCTGCTGG + Exonic
1186584716 X:10860482-10860504 GAGGCTTGAACTGACCCTTCAGG + Intergenic
1189390246 X:40570461-40570483 GTTTCCTGGAATGGCCCTGCTGG + Intergenic
1197610604 X:128634167-128634189 GTTTCTTGGCCTCACACTGCAGG - Intergenic