ID: 928184540

View in Genome Browser
Species Human (GRCh38)
Location 2:29097709-29097731
Sequence ACGCTGGCTGGTGCTCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928184531_928184540 17 Left 928184531 2:29097669-29097691 CCTCCACAATGCCATTATTGTGT 0: 1
1: 0
2: 0
3: 17
4: 193
Right 928184540 2:29097709-29097731 ACGCTGGCTGGTGCTCTCAAAGG 0: 1
1: 0
2: 0
3: 6
4: 77
928184533_928184540 6 Left 928184533 2:29097680-29097702 CCATTATTGTGTTCGTGCTGCCT 0: 1
1: 0
2: 2
3: 4
4: 95
Right 928184540 2:29097709-29097731 ACGCTGGCTGGTGCTCTCAAAGG 0: 1
1: 0
2: 0
3: 6
4: 77
928184532_928184540 14 Left 928184532 2:29097672-29097694 CCACAATGCCATTATTGTGTTCG 0: 1
1: 0
2: 0
3: 6
4: 97
Right 928184540 2:29097709-29097731 ACGCTGGCTGGTGCTCTCAAAGG 0: 1
1: 0
2: 0
3: 6
4: 77
928184530_928184540 25 Left 928184530 2:29097661-29097683 CCATAGCACCTCCACAATGCCAT 0: 1
1: 0
2: 0
3: 16
4: 151
Right 928184540 2:29097709-29097731 ACGCTGGCTGGTGCTCTCAAAGG 0: 1
1: 0
2: 0
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928184540 Original CRISPR ACGCTGGCTGGTGCTCTCAA AGG Intronic
901763259 1:11484316-11484338 CCGCTGGCTGGTTCTCTCTGGGG + Intronic
901911104 1:12458937-12458959 AAGCTGGCTGGGACCCTCAATGG - Intronic
907603378 1:55792245-55792267 CCTCTGGCTGGTGTACTCAAGGG - Intergenic
910272503 1:85411805-85411827 ATGCTGGCTTCTGCTCTGAAAGG + Intronic
922892967 1:229075671-229075693 ACCCTGGCTGATGCTCCCAGGGG - Intergenic
1067532713 10:47086108-47086130 ATGGTGGCTGGTGTTCTAAAGGG + Intergenic
1067685104 10:48462048-48462070 ACGCGGGCATGTGTTCTCAAAGG - Intronic
1069728484 10:70596285-70596307 ACGGTGGCTGCTGCGCTCATTGG - Intergenic
1080427467 11:32169174-32169196 TTGCTGACTGGTGCTCTCAACGG + Intergenic
1081114754 11:39186466-39186488 ACGCTAGCTGTTGCTTCCAAAGG - Intergenic
1081770289 11:45646179-45646201 AAGCTGGCTGGAGCTTTCAGAGG - Intergenic
1084615188 11:70231205-70231227 ATGCTGGCTGGCGCTTTCAGTGG - Intergenic
1085746329 11:79117650-79117672 ACAGTGGCTGCTGCTCTCCAGGG - Intronic
1092231713 12:6779332-6779354 GCCCTGGCTGGCCCTCTCAAGGG + Intergenic
1092289225 12:7149224-7149246 ACACTGGCTGGTTCTCTGGATGG - Intronic
1098946435 12:76594422-76594444 ACGGTGGGTGGTGCTGACAAAGG + Intergenic
1102667483 12:114587805-114587827 ACTCCAGCTGGTGCTCTCAGAGG + Intergenic
1107747035 13:43521366-43521388 ATACTGGCTGCTGCTCTCTAGGG - Intronic
1120722883 14:87906779-87906801 TCTCTGGTTGGAGCTCTCAAGGG + Intronic
1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG + Intronic
1125746799 15:42002593-42002615 CGGCTGGCTGCTGCTCTCAGGGG - Intronic
1127875235 15:63106279-63106301 ACGCTGGCTGGTGTTTCCAGTGG - Intergenic
1129601963 15:77004372-77004394 ACACTGGCTGCTGGTCTCCAGGG - Intronic
1130229262 15:82084113-82084135 ACCCTGGGTGGTTCTTTCAATGG - Intergenic
1133015568 16:2937993-2938015 ACGCTGGCTGGCCCTTTCCAAGG - Intronic
1133506327 16:6415975-6415997 ACGCTGGCAGGTGTTAACAATGG - Intronic
1134467280 16:14490652-14490674 ACGCTGGTGGGTGCTCTGAGGGG - Intronic
1138561118 16:57801746-57801768 ACTCTGGCTGGTGCAGTGAAGGG - Intronic
1139068578 16:63351112-63351134 ATCCTGACTGATGCTCTCAAGGG - Intergenic
1142371963 16:89687393-89687415 CTGCTGGCTGGTGCTCTGAGAGG + Intronic
1147923737 17:43934102-43934124 ACGCTGCCTGCTGCTCTCTGAGG - Intergenic
1149468691 17:56899154-56899176 ACGCTGGGTCATGCTCTCCAGGG + Exonic
1151956766 17:77384047-77384069 AAGCTGGCTCCTGCCCTCAAGGG + Intronic
1158636739 18:59165590-59165612 AGGCAGGCTGCTGCACTCAAAGG + Intergenic
1160349743 18:78166663-78166685 TCCCTGGATGGTGCTCTCCACGG - Intergenic
1160511076 18:79453656-79453678 ACGCCGGCTGGTGCTGGCAGAGG - Intronic
1165956620 19:39505242-39505264 ACGCGGGCAGGTGCATTCAAAGG - Exonic
1168117455 19:54231883-54231905 TCGCTCGCTGGTCCACTCAAAGG + Intronic
926734445 2:16062223-16062245 ACGATGGCTTGTCCACTCAAAGG + Intergenic
927918179 2:26949815-26949837 AAGCTGGCTGGAGCTCTGCACGG - Exonic
928184540 2:29097709-29097731 ACGCTGGCTGGTGCTCTCAAAGG + Intronic
932836830 2:75045928-75045950 CCGCTGGCTGGGGCTCTCTAGGG - Intergenic
944932170 2:204530884-204530906 TCGCTGGCTGATGCTCTCCTCGG - Intergenic
946657946 2:221969233-221969255 TGCCTGTCTGGTGCTCTCAATGG - Intergenic
948569545 2:238909345-238909367 CCGCTGGCGGGAGCTGTCAACGG - Intronic
1171431903 20:25088221-25088243 TCGGGGGCTGGTGCTCTCATGGG - Intergenic
1173414582 20:42844578-42844600 CCCCTGGCTGGGGCTCTCAGAGG + Intronic
1178895674 21:36554995-36555017 GGGCTGGCTGTTGCTCTCAGGGG - Intronic
1180194085 21:46183152-46183174 ACCCTGGCTGGGCCGCTCAATGG - Exonic
1183160798 22:36111591-36111613 AAGCTGGCTGGGGGTCTGAAGGG + Intergenic
951597727 3:24336162-24336184 ACTATGGCTGGTCCTCTCTAGGG + Intronic
954360745 3:50121586-50121608 AGTCTGGCTGGGGGTCTCAAGGG + Intergenic
962391934 3:134979500-134979522 ACGCTCACTGTTGCTGTCAATGG - Intronic
962829851 3:139130447-139130469 ACGCTGGGTGCTGGGCTCAAAGG + Intronic
968420100 4:476807-476829 ACACTGGCTGCAGCTCACAAAGG + Intronic
969614186 4:8242698-8242720 ACCCTGGCTGGTGCCATCAGGGG + Intergenic
969948754 4:10811986-10812008 ATGCTGGATGGTGCCGTCAAGGG + Intergenic
970338929 4:15084240-15084262 ACACTGACTGGTGCTTTCACAGG + Intergenic
972820148 4:42692189-42692211 ACACTGCCAGGTGCTCTCATGGG + Intergenic
982091036 4:151880177-151880199 CCGCTGGCTTGAGCTCTGAATGG + Intergenic
982194294 4:152894796-152894818 GCTGTGACTGGTGCTCTCAAGGG + Intronic
985478680 5:93755-93777 AAGCTGGCCGGTGGTCTCAAAGG + Intergenic
991928276 5:71726677-71726699 TCCCTGGCTGGAGATCTCAAAGG + Intergenic
997387292 5:133483459-133483481 AAGCTGGCTGGGGCTCTGACTGG + Intronic
1002173164 5:177386402-177386424 ACGCTGGCTCATGCTCCCCAGGG + Exonic
1002210344 5:177595292-177595314 CCGCTGGTTGGTGCTCTCACTGG - Exonic
1005849005 6:29804760-29804782 ACACTGGCTGGTGCAAGCAATGG - Intergenic
1007078565 6:39083230-39083252 GAACTGGCTGGTGCTCTGAAGGG - Intronic
1010070508 6:71738738-71738760 TGGCTGGCTGGTGTTCTCAAAGG - Intergenic
1013989489 6:116237005-116237027 AACCTGGCTGGTACTCCCAAGGG + Exonic
1016277749 6:142374498-142374520 ATGGTGGCTGCTGCTTTCAAAGG + Intronic
1018193777 6:161336389-161336411 ACTCTGACAGGTGCTCTCGAAGG + Intergenic
1018700294 6:166421043-166421065 GCGCTGGCTGGTCCCCTCCATGG - Intronic
1026894780 7:74003651-74003673 ACCCTTGCTTGTTCTCTCAATGG - Intergenic
1038162693 8:25055224-25055246 ATGCTCTCTGGTGCTCTGAAGGG + Intergenic
1047228673 8:122977579-122977601 TCCCTGACTGGTGCTCTCAGGGG + Intergenic
1048541513 8:135346122-135346144 ACTCTGGCTGGGGATCTGAAAGG + Intergenic
1049405385 8:142449915-142449937 GCGCCGGCGGGTGCTCTCCAGGG + Exonic
1050457952 9:5851550-5851572 ACACAGGGTGGTGCTCTCCAAGG + Intergenic
1053382350 9:37659331-37659353 ATCCTGGCTGCTGCTCTGAAGGG + Intronic
1055813421 9:80178099-80178121 GCTCTGGCTGCTGCTTTCAAGGG - Intergenic
1060533532 9:124364213-124364235 AGGTTGGCTGATGCACTCAAAGG + Intronic
1188009010 X:25038627-25038649 AGGATGGCTGGTGCTCAGAAGGG + Intergenic
1198188012 X:134273121-134273143 AACCTGGCTGGTGCTCCCAAGGG + Intergenic