ID: 928185388

View in Genome Browser
Species Human (GRCh38)
Location 2:29105535-29105557
Sequence CCATCTCAGTGTAACATTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 112}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928185379_928185388 16 Left 928185379 2:29105496-29105518 CCCATGCTGGGTTTTCCCTGTCT 0: 1
1: 0
2: 1
3: 31
4: 277
Right 928185388 2:29105535-29105557 CCATCTCAGTGTAACATTCAAGG 0: 1
1: 0
2: 1
3: 13
4: 112
928185385_928185388 -7 Left 928185385 2:29105519-29105541 CCAGAGGGCAGCCTCTCCATCTC 0: 1
1: 0
2: 2
3: 33
4: 304
Right 928185388 2:29105535-29105557 CCATCTCAGTGTAACATTCAAGG 0: 1
1: 0
2: 1
3: 13
4: 112
928185384_928185388 0 Left 928185384 2:29105512-29105534 CCTGTCTCCAGAGGGCAGCCTCT 0: 1
1: 1
2: 2
3: 36
4: 293
Right 928185388 2:29105535-29105557 CCATCTCAGTGTAACATTCAAGG 0: 1
1: 0
2: 1
3: 13
4: 112
928185383_928185388 1 Left 928185383 2:29105511-29105533 CCCTGTCTCCAGAGGGCAGCCTC 0: 1
1: 0
2: 5
3: 33
4: 306
Right 928185388 2:29105535-29105557 CCATCTCAGTGTAACATTCAAGG 0: 1
1: 0
2: 1
3: 13
4: 112
928185380_928185388 15 Left 928185380 2:29105497-29105519 CCATGCTGGGTTTTCCCTGTCTC 0: 1
1: 0
2: 0
3: 33
4: 372
Right 928185388 2:29105535-29105557 CCATCTCAGTGTAACATTCAAGG 0: 1
1: 0
2: 1
3: 13
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928185388 Original CRISPR CCATCTCAGTGTAACATTCA AGG Intronic
904991986 1:34600520-34600542 CAAGCTCAGTGTATCAATCAGGG + Intergenic
907733685 1:57091343-57091365 GTATCTCATTGTATCATTCAAGG + Intronic
908619386 1:65960504-65960526 AAAGCTCAGTCTAACATTCAAGG - Intronic
910235931 1:85036593-85036615 CTCTCTCAGAATAACATTCAAGG + Intronic
913050595 1:115113868-115113890 GCATCTCAGTCTCACATTCAAGG + Intergenic
916198642 1:162249036-162249058 CCAGCTCAGTGCAACTTTGAAGG + Intronic
918612184 1:186505620-186505642 CAATATCAGTGTAACAATCATGG + Intergenic
919122566 1:193359540-193359562 CATACTCTGTGTAACATTCAAGG + Intergenic
920951047 1:210572064-210572086 CCGTGCCAGTGTAACATTTACGG - Intronic
922011996 1:221598092-221598114 CCATCTCAGTAAAATATTTAGGG - Intergenic
924311883 1:242752358-242752380 CCATCTAAGTTTAACATACATGG - Intergenic
1063636051 10:7784276-7784298 GCATCTCAGTTTAACATTTAAGG + Intronic
1064578306 10:16768278-16768300 CCACCTCATTTTAACATTCTAGG + Intronic
1069900522 10:71704265-71704287 CCACTTCAGTAAAACATTCAGGG + Intronic
1070341822 10:75504960-75504982 CCATCTCACTGCAACAGCCAAGG - Intronic
1072794511 10:98344174-98344196 CCATCTCAGTGTCAAATCCCGGG + Intergenic
1075590477 10:123687648-123687670 CCATCTCTGTTTTACATGCAAGG - Intronic
1077509154 11:2946809-2946831 CCATGTCAATCTGACATTCAAGG + Intronic
1079589519 11:22165175-22165197 TGATCTCAGTTTAACCTTCAGGG - Intergenic
1080201081 11:29670899-29670921 GCATCACAGTGTCACACTCAAGG - Intergenic
1082902398 11:58268999-58269021 CCACCTCAGTGTCACAAGCATGG + Intergenic
1085070754 11:73542675-73542697 TCATCTCAGAGTAAAATACAAGG + Intronic
1085811121 11:79681834-79681856 CCATCTCAGGGTGTCATTGAAGG + Intergenic
1086539027 11:87885561-87885583 CCATTCCTGTGTAAAATTCAGGG + Intergenic
1088075364 11:105842051-105842073 CCATCTGAGTGCAACATGAAAGG + Intronic
1088424459 11:109687125-109687147 TTCTCTCAGTTTAACATTCATGG - Intergenic
1089922175 11:122219776-122219798 CCATCTGAGTTTAACATTCGAGG - Intergenic
1090142197 11:124277187-124277209 CCATCTCTGTGTAATCTTCAGGG - Intergenic
1092467047 12:8742394-8742416 CCTTCTCATTGTAACTTACAGGG + Intronic
1092898742 12:13039055-13039077 CCATCTCAGTTTACCTTCCATGG + Intergenic
1092908873 12:13127638-13127660 CCATCAGACTGTAACATTCTCGG + Intronic
1100358254 12:93852231-93852253 ACAGCTCAGAGTCACATTCATGG + Intronic
1103269798 12:119663888-119663910 ACATTTCAGTGTAAGATTTAGGG - Intergenic
1113583128 13:111442933-111442955 CCTACTCAGTGTCACATGCAGGG - Intergenic
1115365722 14:32554792-32554814 CCATCTCAGTGAAGCATTTCAGG + Intronic
1115945399 14:38654154-38654176 CCATCTCAGAGTTAAAATCAAGG + Intergenic
1118593712 14:67420103-67420125 CCCTCTCAGTGCAACAACCATGG + Intergenic
1125328011 15:38556295-38556317 GCCTCTCAGTGTCACATACAAGG - Intronic
1125514767 15:40312071-40312093 TCATCCCAGTGTGACATTCTTGG + Intergenic
1129477683 15:75797109-75797131 CCATCTCAGCCTGGCATTCAAGG - Intergenic
1129682833 15:77667607-77667629 CCTTGTCAGTGTGACATTAATGG + Intronic
1130086936 15:80785502-80785524 CCTTCTCAGTGACTCATTCAGGG - Intronic
1140792854 16:78408852-78408874 CCATCTCAGTGGACCACTCAAGG + Intronic
1142025748 16:87812591-87812613 CCATCTCAGTGTGGAAGTCATGG + Intergenic
1143132233 17:4686131-4686153 GCATCTCAGTGTAGCCTTGATGG - Intronic
1143691064 17:8566446-8566468 CCATGTCATGGCAACATTCAAGG + Intronic
1148189509 17:45668663-45668685 ACCTCTCAGTGTGACATTCAAGG - Intergenic
1148807104 17:50269432-50269454 CCATCTCAGAGAGACCTTCAGGG - Intergenic
1151170313 17:72240371-72240393 CCCTCTCACTGTATCAGTCAGGG - Intergenic
1153129233 18:1835177-1835199 ACATCTCAGAGTCTCATTCAAGG - Intergenic
1156638121 18:39055701-39055723 CCACCTCAGGGTATCACTCAGGG + Intergenic
1158080970 18:53590332-53590354 TCATCACAGTGTAAGTTTCAAGG - Intergenic
1161660836 19:5545081-5545103 CCACCTCAGTGCAAAATTTAAGG - Intergenic
1166376306 19:42329202-42329224 GCTGCTCAGTGTGACATTCAAGG - Intronic
928185388 2:29105535-29105557 CCATCTCAGTGTAACATTCAAGG + Intronic
929091270 2:38219447-38219469 ACTTCTTAGTGTGACATTCAAGG - Intergenic
933896304 2:86813515-86813537 CCATCTGAGTCTTACATTTAAGG + Intergenic
934992943 2:98934159-98934181 CAATCTCAGTGCACCATTCAGGG - Intronic
937952273 2:127397779-127397801 CCCTCTCAGTGCACCATCCAGGG + Intergenic
938096917 2:128470300-128470322 CCATCCCACTCTAACATTCCAGG - Intergenic
939300758 2:140334487-140334509 CCTTCTCAGTGTACCATCCATGG + Exonic
943752351 2:191523172-191523194 ACATCCCAGTGTAATTTTCAGGG - Intergenic
944023628 2:195137230-195137252 CCATCTCAGAGTCAGATTCCTGG + Intergenic
945040060 2:205736423-205736445 CTATCTGAGTATAACATACAAGG + Intronic
948079724 2:235195861-235195883 CCTACTCAGTGGAACAGTCATGG - Intergenic
948759489 2:240181984-240182006 TCAACCCAGTGTAGCATTCAGGG + Intergenic
949084365 2:242138082-242138104 ACATCACAGTCCAACATTCACGG - Intergenic
1168914784 20:1476812-1476834 ACATCTCATGTTAACATTCAAGG - Intronic
1169367813 20:5005071-5005093 CTTTCCCAGTGTAGCATTCAAGG + Intronic
1169962499 20:11177299-11177321 CCATCTAAGTGTAGGTTTCATGG - Intergenic
1174703421 20:52632120-52632142 CGATCTCGGTGTAACAGTGAAGG - Intergenic
1179264665 21:39792664-39792686 CCAACTCCCTGTTACATTCAAGG - Intronic
1182716346 22:32358825-32358847 CCATCTTAATGTCAGATTCATGG - Intronic
1183467623 22:37987549-37987571 TCATCTCAGTGTATCCTTCAGGG - Intronic
1184182522 22:42840138-42840160 CCAGGTCAGTCTTACATTCATGG + Intronic
950103544 3:10374165-10374187 CCAGCTCTGTGCAACTTTCAAGG + Intronic
952218812 3:31304021-31304043 CCATCCCAGGGTAACAGCCAGGG - Intergenic
960333043 3:116386358-116386380 CCATCTCAGGCAGACATTCAAGG + Intronic
961479548 3:127171190-127171212 CCATCTCAGTGTCTGCTTCATGG - Intergenic
962987230 3:140546772-140546794 CCATTTCTGTGTAACGTTCCAGG - Intronic
964495409 3:157284156-157284178 ACATCACATTTTAACATTCAAGG + Intronic
966163491 3:176991769-176991791 TCATCTAAGGTTAACATTCATGG + Intergenic
967036475 3:185652022-185652044 CCACCTCAGAGGCACATTCAAGG - Intronic
969987735 4:11229119-11229141 CCTTCTTAGTGTGGCATTCAAGG - Intergenic
971086694 4:23285743-23285765 CTATCTCTGTGTTACATTCTGGG + Intergenic
973861019 4:55064872-55064894 GCAGCTCAGTGAAACCTTCAAGG - Intergenic
975143815 4:70945366-70945388 CCATGACAGTTTAAAATTCAGGG - Intronic
975394062 4:73854431-73854453 CAAGCTAATTGTAACATTCAAGG - Intergenic
975408141 4:74015462-74015484 ACATTTCACTGTAAAATTCAAGG - Intergenic
977524956 4:98132590-98132612 CCATTTTAGTGTAACATAAAAGG - Intronic
978645253 4:110923025-110923047 CAACCTCAGTTTGACATTCAAGG - Intergenic
980874237 4:138644882-138644904 CCATTTCAGGGTAACAGGCAGGG + Intergenic
981168115 4:141587184-141587206 CAATGTTAGTGTAACAATCATGG + Intergenic
986481644 5:8194826-8194848 CCATATCAGTATAAAATTCAGGG + Intergenic
991051610 5:62278787-62278809 TCATCTCAAGGTAAAATTCACGG - Intergenic
993922888 5:93829122-93829144 ACTCCTCAGTGTGACATTCAAGG + Intronic
993970142 5:94409438-94409460 TCATCTCAGTGAGACTTTCATGG - Intronic
994483971 5:100372163-100372185 CCATCTTTTTGTAACACTCACGG - Intergenic
994674802 5:102807163-102807185 ACATGTCAATGTAATATTCATGG + Intronic
995088975 5:108150007-108150029 AAATCTGAGTGAAACATTCATGG - Intronic
996912935 5:128676293-128676315 CCTTCTCTGTGGAAGATTCAAGG + Intronic
1002136979 5:177113668-177113690 ACTTCTCAGTGTGGCATTCAAGG - Intergenic
1004692202 6:18002280-18002302 CCATCTCAATGGAAGTTTCACGG + Intergenic
1006042628 6:31268906-31268928 CCATCTCTGTCTCAAATTCATGG - Exonic
1008723732 6:54391377-54391399 CCTTCTCAGTGTTCCCTTCATGG - Intergenic
1017124789 6:151055391-151055413 CCATCTCGGTTTTACATGCAAGG + Intronic
1019493592 7:1326066-1326088 ACATCTCAATGTCACATTCCGGG - Intergenic
1020287568 7:6696678-6696700 CCATGACAGGGTATCATTCAAGG + Intronic
1028377844 7:90166018-90166040 GCACCTCAGTGAAACTTTCAGGG + Intergenic
1030148423 7:106379353-106379375 CCATCTAAGTTTAGCATTCTAGG + Intergenic
1030214043 7:107025140-107025162 CCATCTCTGTGTAACACCAAGGG + Intergenic
1030313633 7:108092532-108092554 CCATCTCAGAGAAACCTTCCTGG + Intronic
1032120495 7:129151917-129151939 CCATCTCAGTGTATCATGTGAGG - Intronic
1033591510 7:142812573-142812595 CCAGCTCAGTGTGACACTCCAGG + Intergenic
1033855506 7:145556557-145556579 ACAGCTCAGTGTATCAGTCAGGG - Intergenic
1038785575 8:30612097-30612119 CCATCTCTGTGTAACTTTGACGG - Intronic
1047023909 8:120806974-120806996 CCATCTCAGGCAAACATTCCAGG + Intronic
1047798548 8:128284413-128284435 CGATTTTAGTGCAACATTCAGGG - Intergenic
1050647423 9:7735669-7735691 CCATTTCAGTGTAAAATTCAAGG + Intergenic
1051925059 9:22315703-22315725 CCCTCTCACTATAACACTCAGGG - Intergenic
1189415307 X:40807475-40807497 CCCTCTCAGTGGAACGTTCTGGG - Intergenic
1190951999 X:55155223-55155245 ACTTCTTAGAGTAACATTCAAGG - Intronic
1192785643 X:74332250-74332272 ACATATCAGTGTCACAGTCATGG + Intergenic
1195419667 X:104660193-104660215 CCAGCTCAGCATATCATTCATGG + Intronic
1195528138 X:105918120-105918142 CCATCACTCTGTAACATTTAGGG - Intronic
1198614426 X:138440244-138440266 CCAACTCAGTGTCACAGTAAGGG + Intergenic
1201349572 Y:13024362-13024384 CCATCTCTGTGTAATCTCCAGGG + Intergenic