ID: 928185749

View in Genome Browser
Species Human (GRCh38)
Location 2:29109135-29109157
Sequence CCGTTTCAGTGGCAAGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928185743_928185749 27 Left 928185743 2:29109085-29109107 CCTTACATTTTCTATAAAATAAT 0: 1
1: 0
2: 9
3: 100
4: 925
Right 928185749 2:29109135-29109157 CCGTTTCAGTGGCAAGTGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928185749 Original CRISPR CCGTTTCAGTGGCAAGTGCT GGG Intronic
902379697 1:16046905-16046927 CTGTTCCAGTGGCCAGTGCCAGG + Intronic
903162281 1:21497742-21497764 CCTTTTCATTTGCAACTGCTAGG + Intergenic
903884249 1:26531750-26531772 CTTCTCCAGTGGCAAGTGCTAGG + Intronic
904632218 1:31850880-31850902 CCTTTTCAGTGGACAGAGCTAGG + Intergenic
905029155 1:34869934-34869956 CTGGTGCAGTGGGAAGTGCTTGG - Intronic
905681216 1:39872692-39872714 CCCTTTCAGTGGAAAGAGCTAGG - Intronic
906211860 1:44016610-44016632 TGGTTTCAGTGGCAAGGGGTGGG - Intronic
908266889 1:62388061-62388083 CCTTTTCAGTGGACAGAGCTAGG - Intergenic
909731355 1:78895324-78895346 CTGGTGCAGTGGCAAGGGCTAGG + Intronic
910806362 1:91192808-91192830 CCGGTTGTGTGCCAAGTGCTGGG - Intergenic
912515687 1:110215303-110215325 CCGTTTCTGTGGCCTGAGCTGGG + Intronic
913552180 1:119926357-119926379 CTCTTTCAGAGGAAAGTGCTTGG - Intronic
916532986 1:165676158-165676180 CCCTCTCAGAGGCCAGTGCTGGG - Intronic
919966743 1:202534420-202534442 CCCTTTCAGTGGACAGAGCTAGG + Intronic
921892847 1:220370380-220370402 CTGAGCCAGTGGCAAGTGCTAGG + Intergenic
923306005 1:232688925-232688947 CCGTTAGAGTAGCAAGAGCTGGG - Intergenic
923421200 1:233817015-233817037 CAGTTTCACTGACAAGTGCTGGG - Intergenic
1064456110 10:15488831-15488853 CCGTTTCAGAGGCAGGTGGGAGG - Intergenic
1067991947 10:51224203-51224225 CGTTTTCAGTGGGAAGTTCTGGG + Intronic
1076163635 10:128265358-128265380 CAGATTCAGTTGCAAATGCTGGG - Intergenic
1080639377 11:34149870-34149892 CACTTTGAATGGCAAGTGCTGGG + Intergenic
1080880918 11:36319724-36319746 CTTTTTCAGTTGCAAGTGTTAGG - Intronic
1080967355 11:37228588-37228610 CTGTTTCAGAGGCAAGTGACAGG - Intergenic
1081422927 11:42893484-42893506 GAGTTTCAGTGGCAAATGATTGG + Intergenic
1086888875 11:92233397-92233419 TCGTTTTGGTGGCATGTGCTGGG + Intergenic
1087017329 11:93566689-93566711 CCTTTTTATTGGCAAATGCTTGG + Intergenic
1088755470 11:112881915-112881937 CCGTTTCTGTGGCAGGCACTGGG + Intergenic
1090389164 11:126376374-126376396 CAGTTTCAGAGGCAGGTGTTTGG + Intronic
1094672277 12:32582070-32582092 CTGCCTCTGTGGCAAGTGCTGGG - Exonic
1097884041 12:64711165-64711187 CAGTTTCAGTGGGAATAGCTGGG + Intergenic
1110130071 13:71997692-71997714 CCCTTTCAGTGGACAGAGCTAGG - Intergenic
1110613421 13:77514345-77514367 CCCTTTCAGTGGACAGAGCTAGG + Intergenic
1112764193 13:102723338-102723360 ACGTCTCAGTTGCATGTGCTGGG - Intergenic
1113363705 13:109656087-109656109 CCTATTCACTGGTAAGTGCTAGG - Intergenic
1115301544 14:31890897-31890919 CCTTTTCAGTGGACAGAGCTAGG + Intergenic
1117287878 14:54304956-54304978 CCTTTTCAGTGGATAGAGCTGGG + Intergenic
1120557587 14:85948140-85948162 CCGTCTCAGTTGTAGGTGCTGGG - Intergenic
1121625061 14:95378246-95378268 TCTTTTCAGTGGCCAGAGCTAGG + Intergenic
1122843045 14:104476033-104476055 CAGCCTCAGTGGCAGGTGCTGGG + Intronic
1124454669 15:29830702-29830724 CCTTTTCAATGGCCAGAGCTAGG - Intronic
1125179853 15:36870335-36870357 CAGTTTCAGTGGCAAGGCATGGG - Intergenic
1125295430 15:38197763-38197785 CCTATTCAGTGGCAAGGGCTGGG + Intergenic
1130646561 15:85732395-85732417 CCTTTTCAGTGGACAGAGCTTGG + Intronic
1132700422 16:1219913-1219935 CCCTGTCAGTGGCCAGGGCTCGG - Intronic
1132855028 16:2040917-2040939 CCGCTGCAGTGGCAGGTGCTAGG - Intronic
1133982187 16:10641365-10641387 ACGTCTCAGTGGCTGGTGCTTGG - Intronic
1136554463 16:30999669-30999691 CCGATTCAGAGGCATTTGCTGGG + Intronic
1139477035 16:67207943-67207965 CCGACTCAGTGACAAGGGCTGGG - Exonic
1140033081 16:71353949-71353971 CCGTTTCCATGGAAACTGCTGGG + Intergenic
1141969269 16:87469485-87469507 CCGTCTCGGCGGCCAGTGCTGGG + Intronic
1142246835 16:88974053-88974075 AAGTTTCAGTGCCATGTGCTGGG - Intronic
1143700233 17:8653824-8653846 CCTTTTCAGTGGGCAGGGCTAGG - Intergenic
1144315617 17:14058426-14058448 CCATCTCAGTGGCATGTGGTTGG - Intergenic
1144492473 17:15725683-15725705 CCGTTTCAGTAGACAGAGCTAGG - Intergenic
1144908001 17:18653504-18653526 CCGTTTCAGTAGAAAGAGCATGG + Intronic
1146253589 17:31374042-31374064 CTGTTACAGTGGCCAGTGGTAGG - Exonic
1148219796 17:45853283-45853305 CCGTTCCAGGGGCAAGGACTGGG - Intergenic
1152606852 17:81295627-81295649 CCGATTCTGGGGCGAGTGCTTGG + Intergenic
1156381323 18:36564061-36564083 CCGAGTCAGTGACAAGGGCTTGG - Intronic
1156384767 18:36595150-36595172 GTGTTTCAGTGGCAGGAGCTGGG - Intronic
1157168838 18:45383752-45383774 CCATCCCAGTGGCATGTGCTAGG + Intronic
1157676326 18:49571407-49571429 CTGTTTGAGTGGCATCTGCTGGG + Intronic
1157710672 18:49847689-49847711 CCGTTTTTCTGGGAAGTGCTTGG + Intronic
1158910649 18:62058060-62058082 CACCTTCAGTGGCAGGTGCTGGG - Intronic
1159813155 18:73041307-73041329 CCATTTCAGAGACAACTGCTAGG + Intergenic
1160857453 19:1223934-1223956 CTGTTTCAGCGGGAAGTGGTGGG + Intronic
1162494683 19:11017013-11017035 CCCTCTCAGTGGTCAGTGCTAGG + Intronic
1166619526 19:44283760-44283782 CCATTCCAGTTGTAAGTGCTGGG - Intronic
926269100 2:11351656-11351678 CAGTGTCAGTGGCAAGCCCTTGG + Intergenic
927813265 2:26192281-26192303 CCGTTTGAGTGGCTAATGCCTGG - Intronic
928185749 2:29109135-29109157 CCGTTTCAGTGGCAAGTGCTGGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935414036 2:102796413-102796435 CAGCTTCTGTGCCAAGTGCTAGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937120605 2:119437817-119437839 CTGTTTCATTGACACGTGCTGGG + Exonic
938295049 2:130172724-130172746 CCCGCTCAGTGTCAAGTGCTGGG + Intronic
940630423 2:156230730-156230752 CTGTTTCAGTGGAAAGATCTGGG - Intergenic
941967706 2:171315946-171315968 CAGTGTCATTGGCAAGTGCCTGG - Intergenic
942098265 2:172554439-172554461 CCGTTTCAATGGGATGTGCTTGG - Intergenic
942204821 2:173609747-173609769 CCGTTTGAGTGGAAGTTGCTAGG - Intergenic
942781512 2:179648515-179648537 CCTTCTTAGTGGCCAGTGCTCGG - Intronic
948238417 2:236408264-236408286 CCTTCTCTGTGGCACGTGCTGGG - Intronic
1168848202 20:959474-959496 CCGTTTCAGTGGCCTCTTCTGGG + Exonic
1171395182 20:24828574-24828596 CCATTTCAGTTCCCAGTGCTAGG - Intergenic
1173021612 20:39272281-39272303 CCGTGTCAGTGGAAAGGGGTGGG - Intergenic
1174637711 20:52016254-52016276 CTGTCTCAGTGCCAAGTGCAGGG + Intergenic
1176049164 20:63107590-63107612 CAGCTTCAGTGCCAGGTGCTGGG + Intergenic
1179723214 21:43327198-43327220 CCCTTTCAGTGGCATGAACTAGG + Intergenic
1181468358 22:23122868-23122890 CCTTGCCAGTGGCAAGTGCTTGG - Intronic
1184433098 22:44453192-44453214 CCGTTACAGTGGAAAGGGGTAGG - Intergenic
1184653534 22:45930229-45930251 CCTTTTCTGTGCCAGGTGCTAGG - Intronic
957702725 3:83738507-83738529 CCAAATTAGTGGCAAGTGCTAGG - Intergenic
962517204 3:136163382-136163404 CCTCTTCAGTGGATAGTGCTAGG - Intronic
962796019 3:138850281-138850303 CTCTTTCAGTGGCAAGATCTTGG - Intergenic
966553838 3:181235621-181235643 CCGGTTCAGTGCCAAGCACTGGG - Intergenic
970793143 4:19882725-19882747 TAGGTACAGTGGCAAGTGCTAGG - Intergenic
970949148 4:21732248-21732270 CCTTTTCAGTGCTACGTGCTAGG + Intronic
972983452 4:44734060-44734082 CCATTTCACTGGCAAATTCTAGG - Intergenic
974029443 4:56762968-56762990 CCCTCTCAGTGGCATGTGATTGG - Intergenic
976337182 4:83902880-83902902 CCTTTTCAGTGGACAGAGCTAGG + Intergenic
980756248 4:137166163-137166185 CTTTTTCAGTGGCAAGAGCTAGG - Intergenic
980785649 4:137550569-137550591 CCTTTTCAGTGGCAAGAAATAGG - Intergenic
981454940 4:144942394-144942416 GCTTTTCAGTGGCCAGAGCTAGG - Intergenic
983909721 4:173224483-173224505 CCTTTTCAGTGGACAGTGCAAGG + Intronic
986564505 5:9098318-9098340 TAATTTCAGTAGCAAGTGCTCGG + Intronic
988864033 5:35315425-35315447 CCGTCTTAGTCTCAAGTGCTGGG + Intergenic
992524763 5:77597968-77597990 TCATTTCAGTGGTAATTGCTGGG - Intronic
996126788 5:119735063-119735085 CCCTTTCAGTGGACAGAGCTGGG + Intergenic
1001952279 5:175824571-175824593 CTGTTTCACTGCCAAGTTCTAGG - Intronic
1005305147 6:24506074-24506096 CCTTTTCAGTGGGCAGGGCTAGG + Intronic
1006551471 6:34826978-34827000 CCTTTTCAGTGTCCAATGCTAGG + Intronic
1007342935 6:41203473-41203495 CCTTTTCAGTGACGAGTTCTGGG + Intergenic
1007907507 6:45477126-45477148 CCGTTTCAGTGGCCACTGCATGG + Intronic
1009024295 6:57979772-57979794 CCCTTTCAGTGGACAGAGCTAGG - Intergenic
1011486311 6:87845612-87845634 CAGTTTCAGTGGGCAGAGCTAGG + Intergenic
1012859560 6:104543394-104543416 CCATTTCAGTTGCCAGTGTTTGG + Intergenic
1013213179 6:108004759-108004781 CCTTCTCTGTGGCACGTGCTGGG - Intergenic
1013690694 6:112638777-112638799 CAGTGTCTGTGTCAAGTGCTGGG - Intergenic
1015925737 6:138308644-138308666 CTGTCTCAGTGGAACGTGCTGGG + Intronic
1017915970 6:158831910-158831932 CCTTCTCAGTTGCAAGTTCTAGG - Intergenic
1018752429 6:166819033-166819055 CCCTTTCAGTGGACAGAGCTGGG + Intronic
1019408315 7:895470-895492 ACGTTTCAGAGGCGAGTCCTGGG + Exonic
1030473511 7:109998821-109998843 CCTTCTCTGTGGCATGTGCTGGG - Intergenic
1033939594 7:146635934-146635956 CTGTTCCAGTGGCAAGTGAATGG + Intronic
1034058805 7:148067229-148067251 CCATTTCAGAGGAAAGAGCTGGG + Intronic
1040820260 8:51547705-51547727 CTGTTTCAGTGGAAAGATCTGGG - Intronic
1048301737 8:133256169-133256191 CCGTTTCAGAGGTAAGGACTCGG - Intronic
1048318154 8:133377148-133377170 TCCTTTCTGTGGCCAGTGCTTGG - Intergenic
1048465039 8:134658482-134658504 CCGTTTCATTGAAAGGTGCTGGG - Intronic
1050604973 9:7291416-7291438 CCTTTTCAGTAGAAATTGCTGGG - Intergenic
1050910667 9:11065389-11065411 GGGTTTCAGTGGCAAGATCTTGG + Intergenic
1051803294 9:20961549-20961571 CCGTTTCAGTGGACAGAGCTGGG + Intronic
1053530480 9:38876462-38876484 CAGTTTAAGTGACAAGTGGTTGG - Intergenic
1057631162 9:96720013-96720035 GCGTGTCAGGGGCAGGTGCTTGG + Intergenic
1060561795 9:124551234-124551256 CCCTCTCAGTGGCTAGAGCTTGG + Intronic
1060942328 9:127550068-127550090 CCATTTCACTGGCCAGTGATGGG - Intronic
1186880217 X:13857775-13857797 ACTGTGCAGTGGCAAGTGCTAGG + Intronic
1186915674 X:14217378-14217400 CCTTTTCAGTGGGAAGAGTTGGG - Intergenic
1186966124 X:14788046-14788068 CTGTGTCAGAGGAAAGTGCTAGG + Intergenic
1199391021 X:147279095-147279117 GCCTTTCAGAGGCAAGTCCTAGG - Intergenic
1201916218 Y:19184195-19184217 CCTTGTCAGAAGCAAGTGCTTGG - Intergenic
1202302356 Y:23430188-23430210 CCCTTTCAGTGGACAGAGCTAGG + Intergenic
1202568455 Y:26240410-26240432 CCCTTTCAGTGGACAGAGCTAGG - Intergenic