ID: 928186608

View in Genome Browser
Species Human (GRCh38)
Location 2:29115832-29115854
Sequence CGGTGTCGCTGGCCGCGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 379}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928186595_928186608 2 Left 928186595 2:29115807-29115829 CCCCGCGGCCGCCTCCCGTGGGC 0: 1
1: 0
2: 1
3: 18
4: 232
Right 928186608 2:29115832-29115854 CGGTGTCGCTGGCCGCGGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 379
928186597_928186608 0 Left 928186597 2:29115809-29115831 CCGCGGCCGCCTCCCGTGGGCAC 0: 1
1: 0
2: 1
3: 17
4: 236
Right 928186608 2:29115832-29115854 CGGTGTCGCTGGCCGCGGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 379
928186600_928186608 -9 Left 928186600 2:29115818-29115840 CCTCCCGTGGGCACCGGTGTCGC 0: 1
1: 0
2: 0
3: 5
4: 97
Right 928186608 2:29115832-29115854 CGGTGTCGCTGGCCGCGGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 379
928186596_928186608 1 Left 928186596 2:29115808-29115830 CCCGCGGCCGCCTCCCGTGGGCA 0: 1
1: 0
2: 1
3: 14
4: 167
Right 928186608 2:29115832-29115854 CGGTGTCGCTGGCCGCGGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 379
928186599_928186608 -6 Left 928186599 2:29115815-29115837 CCGCCTCCCGTGGGCACCGGTGT 0: 1
1: 0
2: 0
3: 8
4: 133
Right 928186608 2:29115832-29115854 CGGTGTCGCTGGCCGCGGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928186608 Original CRISPR CGGTGTCGCTGGCCGCGGGG AGG Intronic
900431217 1:2604069-2604091 CGGTGTGGCTGGCCAAGGTGAGG - Intronic
900574597 1:3376833-3376855 CTGTGTCCCTGGCCGTGGTGTGG + Intronic
901726956 1:11250024-11250046 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
901849848 1:12008397-12008419 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
902018811 1:13328812-13328834 CGGGGCGGCTGGCCGGGGGGGGG - Intergenic
903103435 1:21053429-21053451 CGGGGCGGCTGGCCGGGGGGTGG - Intronic
903148183 1:21388172-21388194 CGGGGTGGCTGGCCGGGTGGGGG - Intergenic
903324700 1:22563346-22563368 CGGCGGCGGTGGCCGCGGGCCGG + Intergenic
903519445 1:23935823-23935845 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
903634105 1:24799888-24799910 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
903634234 1:24800186-24800208 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
903894903 1:26596616-26596638 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
904532194 1:31176875-31176897 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
904760958 1:32804348-32804370 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
906770666 1:48479625-48479647 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
907767371 1:57424166-57424188 CGGTGCCGCGGGGCGCCGGGCGG - Intronic
908523521 1:64966573-64966595 GGGTGGGGCCGGCCGCGGGGCGG - Intergenic
910777517 1:90891777-90891799 CGGGGTGGCTGGCCTCGCGGGGG + Intergenic
911486534 1:98512488-98512510 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
912116346 1:106412686-106412708 CGGGGTGGCTGGCCGGGTGGGGG - Intergenic
912808249 1:112774120-112774142 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
915616990 1:157046224-157046246 CGGTGGCGGTGGCGGCGGCGGGG - Intergenic
916050102 1:161029837-161029859 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
917006228 1:170419172-170419194 CGGGGTGGCTGGCCGGGTGGGGG - Intergenic
917304688 1:173613564-173613586 CGGGGCGGCTGGCCGGGGGGGGG - Intronic
917553328 1:176058095-176058117 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
917837771 1:178954368-178954390 TGCTGTCGGTGGCGGCGGGGTGG - Intergenic
919080039 1:192857275-192857297 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
919080064 1:192857324-192857346 CGGGGTGGCTGGCCGGGCGGAGG - Intergenic
920002698 1:202810808-202810830 CGGTGTGGCTGTCAGCTGGGAGG - Intergenic
920152162 1:203919171-203919193 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
920385751 1:205569323-205569345 GGGTGCCGGGGGCCGCGGGGCGG - Intronic
920612467 1:207454725-207454747 CGGTGTGGCTGGCGGCGTGCGGG + Intronic
921198262 1:212779569-212779591 CGGGGTGGCTGGCCGGGTGGGGG - Intronic
921638330 1:217523828-217523850 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
922102668 1:222488277-222488299 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
922307533 1:224357134-224357156 CGGTGGCGCGGGCCCCGGAGCGG + Intronic
1067354542 10:45512408-45512430 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1069052604 10:63811426-63811448 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1069157805 10:65052306-65052328 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1069365732 10:67691900-67691922 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1069769485 10:70888364-70888386 CTCTGTCGCTGGCGGCGGGGAGG - Intronic
1070966551 10:80534375-80534397 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1072648679 10:97276662-97276684 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1072949913 10:99839441-99839463 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1073000054 10:100278123-100278145 CGGGGTGGCTGGCCGGGAGGGGG - Intronic
1073865634 10:107800921-107800943 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1074588097 10:114787543-114787565 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1077079978 11:720928-720950 CGGGGTCGCAGGGGGCGGGGAGG + Intronic
1077100457 11:820060-820082 CCGGGTCGCTGGCCTGGGGGCGG + Intronic
1077115561 11:883095-883117 AGGTGTCACTGGGCGCGGGTGGG - Intronic
1077668782 11:4138050-4138072 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1080098135 11:28430610-28430632 CGGGGTGGCTGGCCGGGCGGAGG - Intergenic
1081288994 11:41304683-41304705 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1081637036 11:44727773-44727795 TGGGGTCCCTGGCAGCGGGGCGG + Intronic
1081950423 11:47038656-47038678 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1083130964 11:60622809-60622831 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1083618159 11:64036367-64036389 CGGTGGCGCTGGCCCCGCCGCGG + Intronic
1083682251 11:64357077-64357099 CGGTGTCACTGGCTGAGGGATGG - Exonic
1084049136 11:66588308-66588330 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1085359913 11:75877535-75877557 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1086017283 11:82182204-82182226 CGGGGTGGCTGGCCGGGAGGGGG - Intergenic
1086366141 11:86110908-86110930 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1089262642 11:117232897-117232919 GGGGGTGGCTGGCAGCGGGGTGG + Intronic
1091358358 11:134955508-134955530 CAGTGTCGCAGCCGGCGGGGCGG - Intergenic
1202828157 11_KI270721v1_random:99790-99812 CGGTGGAGCTCGCCACGGGGGGG + Intergenic
1095068689 12:37814766-37814788 CGGGGTGGCTGGCCGGGTGGGGG + Intergenic
1095571133 12:43685323-43685345 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1096082511 12:48842461-48842483 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1097110027 12:56651693-56651715 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1099255467 12:80308023-80308045 CGGGGCGGCTGGCCGCGCGGGGG + Intronic
1100995163 12:100294674-100294696 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1100995188 12:100294723-100294745 CGGGGTGGCTGGCCGGGTGGGGG + Intronic
1101606075 12:106248203-106248225 GGGGGTGGCTGGGCGCGGGGCGG + Intronic
1102294079 12:111723571-111723593 CGGGGTGGCTGGCCGGGTGGGGG + Intronic
1102973478 12:117189957-117189979 GGGTGACGCTGGCGGCGGCGCGG - Intronic
1103092064 12:118104290-118104312 CTGTGTCCCTGGGCGCAGGGCGG + Intronic
1103457090 12:121076259-121076281 CGGGGTGGCTGGCCGGGTGGGGG - Intergenic
1103457142 12:121076385-121076407 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1103457297 12:121076740-121076762 CGGGGTGGCTGGCCGGGTGGGGG - Intergenic
1103892508 12:124250415-124250437 GGGTGTGGCTGGCCGCAGGATGG + Intronic
1104712683 12:130996937-130996959 CGGGGTGGCTGGCCGGGTGGGGG + Intronic
1104842123 12:131830304-131830326 TGCTGTCGCAGGGCGCGGGGCGG - Intronic
1105368144 13:19780200-19780222 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1105980360 13:25512661-25512683 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1105980506 13:25512985-25513007 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1106114620 13:26806366-26806388 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1106495403 13:30270262-30270284 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1106559932 13:30839189-30839211 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1107493369 13:40901158-40901180 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1108608796 13:52064411-52064433 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1114165196 14:20212779-20212801 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1114517217 14:23307851-23307873 CTGTGGAGCTGGCCCCGGGGAGG + Exonic
1114578734 14:23736936-23736958 CGGGGCGGCTGGCCGGGGGGGGG - Intergenic
1116191919 14:41674481-41674503 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1117277074 14:54203488-54203510 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1117277099 14:54203537-54203559 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1117277198 14:54203762-54203784 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1117846679 14:59919639-59919661 GGTGGTCGCTGGCCGCGGGAAGG + Intergenic
1118148637 14:63165757-63165779 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1118517631 14:66545712-66545734 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1121306632 14:92911494-92911516 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1122575115 14:102737219-102737241 CGCTGTAGCTGGCTGTGGGGAGG - Intergenic
1122758705 14:104003757-104003779 CGGTGTGGCTGACAGCTGGGAGG + Intronic
1123429666 15:20203942-20203964 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1124132539 15:27003828-27003850 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1125862888 15:43014891-43014913 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1125862948 15:43015031-43015053 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1126517086 15:49550184-49550206 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1127154397 15:56110555-56110577 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1127154475 15:56110732-56110754 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1127154578 15:56110987-56111009 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1127782912 15:62332356-62332378 CGGGGTGGCTGGCCGGGTGGGGG + Intergenic
1128071272 15:64799026-64799048 CGGCGTGGCTGGCCGGGTGGGGG + Intergenic
1128489938 15:68135072-68135094 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1128489986 15:68135169-68135191 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1128490173 15:68135597-68135619 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1128586926 15:68859758-68859780 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1128587083 15:68860111-68860133 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1128597365 15:68964457-68964479 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1129221755 15:74135319-74135341 CGGTGGGGCGGGCTGCGGGGTGG - Exonic
1129341287 15:74888406-74888428 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1132300733 15:100774145-100774167 CGGGGTGGCTGGCCGGGTGGGGG + Intergenic
1133908067 16:10039603-10039625 CGGTGGCGTTGGGCGCGGGGAGG + Intronic
1133916486 16:10113409-10113431 CCCTGTCCCTGGCCCCGGGGAGG + Intronic
1134471863 16:14532833-14532855 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1136180533 16:28548775-28548797 CGGTGTCTGTGGCCCAGGGGTGG - Intergenic
1136383269 16:29906973-29906995 TGGTGGGGCTGGCCGCGGGGAGG - Exonic
1136425934 16:30169339-30169361 CGGGGCCGCTGGCCGGGCGGGGG - Intergenic
1136426378 16:30170338-30170360 CGGGGCCGCTGGCCGGGCGGGGG - Intergenic
1137280495 16:46973061-46973083 CGGGGCCGACGGCCGCGGGGCGG + Intronic
1137284042 16:47000679-47000701 CGGGGTGGCTGGCCGGGTGGGGG - Intergenic
1137303941 16:47181364-47181386 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1138028302 16:53539587-53539609 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1138043462 16:53698330-53698352 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1138043602 16:53698680-53698702 CGGTGCGGCTGGCCGGGCGGGGG - Intronic
1138467015 16:57200511-57200533 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1138467188 16:57200934-57200956 CGGGGCGGCTGGCCGGGGGGGGG + Intronic
1138655302 16:58487940-58487962 CGGTGTGGCTGGCCCTAGGGAGG - Intronic
1139403011 16:66696865-66696887 CGGCGCCGCGGGCCTCGGGGAGG + Intergenic
1142374900 16:89701727-89701749 CCGTGACGCTGGGGGCGGGGCGG + Intergenic
1142413141 16:89926219-89926241 CGGTGCCGCAGCCCGCGCGGAGG - Intronic
1142590819 17:1005065-1005087 GGGTGTCCCGGGTCGCGGGGAGG - Exonic
1144510030 17:15867584-15867606 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1144559741 17:16312063-16312085 CGGGGTGGCTGGCCGGGTGGGGG + Intronic
1144717170 17:17442964-17442986 CGGGGCCGCTGGCCGGGCGGGGG + Intergenic
1144851707 17:18247163-18247185 CCATGTCGCTGGCCGAGGTGGGG - Exonic
1145684470 17:26638933-26638955 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1147172824 17:38631482-38631504 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1147709085 17:42449373-42449395 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1147865062 17:43546389-43546411 CGGTGTGGCGGGGCGGGGGGTGG - Exonic
1147974220 17:44238299-44238321 CGGGGTGGCTGGCCGGGTGGGGG - Intergenic
1147974445 17:44238829-44238851 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1148404394 17:47398123-47398145 CGGGGTGGCTGGCCAGGGGGGGG - Intronic
1148404447 17:47398250-47398272 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1148406584 17:47421033-47421055 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1149430889 17:56594833-56594855 CGGTGGCGCTGTCAGCGGCGCGG + Exonic
1149950197 17:60977085-60977107 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1150134888 17:62690098-62690120 AGCTGTCGGTGGCCCCGGGGAGG + Intronic
1152175034 17:78781970-78781992 CGGGGTCGCTGGCGGCGCTGAGG - Intronic
1152809999 17:82376853-82376875 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1153634098 18:7098730-7098752 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1153726869 18:7965599-7965621 CAGTGTCGCTGGCCTCAGAGCGG + Intronic
1154398232 18:14010788-14010810 CGGGGTGGCTGGCCGGGGGGGGG + Intergenic
1154496587 18:14965710-14965732 CAGTGTCGCAGCCGGCGGGGCGG + Intergenic
1157629245 18:49080137-49080159 CGGGGCGGCTGGCCGGGGGGGGG + Intronic
1157629319 18:49080312-49080334 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1157639990 18:49203190-49203212 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1157857689 18:51117201-51117223 CGGGGTGGCTGGCCGGGTGGGGG + Intergenic
1159158086 18:64609159-64609181 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1161168390 19:2800839-2800861 CGGTGCGGGTGGCCGCGGGATGG - Intronic
1163143185 19:15363496-15363518 CGGTGCGGCTGGCCGGGCGGGGG - Intronic
1163370319 19:16897643-16897665 GGGTGTGGCAGGCCGCGGTGGGG + Intronic
1164046913 19:21551262-21551284 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1164192375 19:22926789-22926811 CGGGGTGGCTGGCCGGGGTGTGG - Intergenic
1164653130 19:29901017-29901039 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1165199406 19:34132709-34132731 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1165668660 19:37655792-37655814 AGGCGTCGCTGGGGGCGGGGCGG - Intronic
1165727614 19:38123948-38123970 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1166180112 19:41102992-41103014 CGGGGTGGCTGGCCGGGGGGAGG - Intergenic
1166417970 19:42610370-42610392 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1168026628 19:53648096-53648118 AGGTGTCGCCGGGCCCGGGGTGG - Intergenic
1168272639 19:55258489-55258511 CGGAGCCGCCGGCGGCGGGGCGG - Exonic
925373664 2:3365976-3365998 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
926674867 2:15611764-15611786 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
927776849 2:25910322-25910344 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
928186608 2:29115832-29115854 CGGTGTCGCTGGCCGCGGGGAGG + Intronic
928585470 2:32754750-32754772 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
929577727 2:43063123-43063145 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
929690256 2:44067404-44067426 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
932710648 2:74061219-74061241 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
932776362 2:74530329-74530351 CGGTGGCGCTGGGCGCTGGGGGG + Exonic
933735213 2:85488440-85488462 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
935645322 2:105329650-105329672 CGGGGCCCCAGGCCGCGGGGCGG - Exonic
937168453 2:119843725-119843747 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
938829037 2:135033802-135033824 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
940299207 2:152160661-152160683 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
942754072 2:179319560-179319582 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
947330545 2:229025182-229025204 TGGGGACGCTGGCCGCAGGGAGG - Exonic
948706413 2:239795958-239795980 CGGGGTGGCTGGCCGGGTGGGGG - Intronic
1169441758 20:5639273-5639295 CGGGGCGGCTGGCCGGGGGGCGG + Intergenic
1170202608 20:13760768-13760790 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1170424889 20:16227547-16227569 CGGGGTGGCTGGCCGGGTGGGGG + Intergenic
1171861503 20:30405669-30405691 CGGTGCGGCTGGCCGGGTGGGGG - Intergenic
1171899833 20:30846999-30847021 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1171956953 20:31470357-31470379 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1172402147 20:34659264-34659286 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1172797433 20:37550706-37550728 CGGGGCGGCTGGCCGGGGGGGGG + Intergenic
1172819332 20:37718262-37718284 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1172819413 20:37718438-37718460 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1173769571 20:45645929-45645951 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1176547647 21:8208546-8208568 CGGTGCCGCCGGCGGCGGTGAGG + Intergenic
1176566598 21:8391593-8391615 CGGTGCCGCCGGCGGCGGTGAGG + Intergenic
1176574473 21:8435780-8435802 CGGTGCCGCCGGCGGCGGTGAGG + Intergenic
1176611086 21:8987072-8987094 CGGTGCCGCCGGCGGCGGTGAGG + Intergenic
1177178169 21:17719835-17719857 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1179455395 21:41496178-41496200 CAGTCTCGCTGGCAGCGGGAGGG - Intronic
1179522461 21:41954009-41954031 AGGAGGCTCTGGCCGCGGGGCGG + Intergenic
1180672127 22:17561419-17561441 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1181082955 22:20426151-20426173 CGCTGTCGGAGGACGCGGGGAGG + Exonic
1181902769 22:26169630-26169652 CGGAGCCGCTGGCTGTGGGGCGG - Exonic
1182199445 22:28553762-28553784 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1182296524 22:29313652-29313674 CGGTGTCTCTGGCCGTAGGAAGG - Intronic
1182616661 22:31592784-31592806 CGGGGCGGCTGGCCGGGGGGAGG + Intronic
1183706826 22:39479393-39479415 CGGGGTGTCTGGCAGCGGGGTGG + Intronic
1203252521 22_KI270733v1_random:124831-124853 CGGTGCCGCCGGCGGCGGTGAGG + Intergenic
1203260577 22_KI270733v1_random:169917-169939 CGGTGCCGCCGGCGGCGGTGAGG + Intergenic
950259070 3:11530889-11530911 CGGTGTTGCTTGCCCCTGGGAGG + Intronic
950754754 3:15162943-15162965 CGGGGTGGCTGGCCGGGTGGGGG + Intergenic
951290407 3:20866813-20866835 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
951290431 3:20866861-20866883 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
954059513 3:48056501-48056523 CGGGGCGGCTGGCCGGGGGGAGG - Intronic
954060394 3:48061848-48061870 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
954223025 3:49166112-49166134 TGGGGTCGCTGGGCGCGGGGTGG + Intronic
954399185 3:50311206-50311228 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
954567030 3:51607948-51607970 CGGGGTGGCTGGCCGGGTGGGGG + Intronic
955434848 3:58890412-58890434 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
957035522 3:75289675-75289697 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
957203316 3:77164723-77164745 CGGGGTGGCTGGCCGGGCGGAGG - Intronic
958808257 3:98836750-98836772 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
958957454 3:100478061-100478083 CGGGGTGGCTGGCCGGGTGGGGG + Intergenic
960111547 3:113849997-113850019 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
961120320 3:124367262-124367284 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
961120498 3:124367666-124367688 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
961120600 3:124367891-124367913 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
961784227 3:129339339-129339361 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
962572249 3:136723668-136723690 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
963451166 3:145482947-145482969 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
965302383 3:167018978-167019000 CGGGGTGGCTGGCCGGGCGGAGG - Intergenic
966015430 3:175132635-175132657 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
966919417 3:184602218-184602240 CGGTGTCGCTGACCCCTGGGCGG + Intronic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968506527 4:973585-973607 CGCAGGCGCGGGCCGCGGGGCGG + Intronic
969508312 4:7602277-7602299 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
970216015 4:13761075-13761097 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
972288467 4:37669421-37669443 CGGGGTGGCTGGCCGGGTGGGGG - Intronic
973672996 4:53238156-53238178 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
974076640 4:57173426-57173448 CGGGGTGGCTGGCCGGGTGGGGG - Intergenic
975042558 4:69762376-69762398 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
980895269 4:138854527-138854549 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
981677507 4:147358123-147358145 CGGGGTGGCTGGCCGGGTGGGGG - Intergenic
981942410 4:150296899-150296921 CGGTGGGGGTGGGCGCGGGGGGG - Intronic
982053494 4:151526413-151526435 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
982191994 4:152866522-152866544 CGGGGCGGCTGGCCGCGCGGGGG + Intronic
982820698 4:159939319-159939341 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
984004776 4:174294781-174294803 CGGTGCGGCTGGCCGGGTGGGGG + Intronic
984973612 4:185210557-185210579 CGGTGTCGCTTGCCGTGGGAGGG + Intronic
985736641 5:1586692-1586714 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
989211367 5:38861948-38861970 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
989247744 5:39273031-39273053 CGGGGTGGCTGGCCGGGCGGAGG - Intronic
991373304 5:65940480-65940502 CGGGGCGGCTGGCCGGGGGGGGG - Intronic
991907299 5:71525663-71525685 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
992463765 5:76985047-76985069 CGGGGTGGCTGGCCGGGTGGGGG + Intergenic
992574657 5:78097248-78097270 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
992964111 5:81983437-81983459 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
992978351 5:82140434-82140456 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
995161747 5:108992481-108992503 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
995193764 5:109342486-109342508 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
997874734 5:137537728-137537750 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
997899847 5:137754384-137754406 CGGTGACGCACGCCTCGGGGAGG - Intergenic
997926059 5:138032559-138032581 CCGTGTCCCTGGCTGCCGGGGGG - Intronic
998239226 5:140427250-140427272 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
999322613 5:150624744-150624766 CGGTGGCGGTGGCGGCGGCGAGG + Intronic
999532590 5:152479885-152479907 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
999987036 5:157014381-157014403 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
999987080 5:157014472-157014494 CGGGGTGGCTGGCCGGGCGGAGG - Intergenic
1000815679 5:165919349-165919371 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1001934665 5:175695650-175695672 CGATGTCGCTGGCAGCAGGGAGG - Intergenic
1002638948 5:180621521-180621543 GGGTGAGGCTGGCCGCGGGGAGG - Exonic
1002645059 5:180648964-180648986 CGCCGTCGCCGGCCACGGGGAGG + Intronic
1003319403 6:5037918-5037940 CGGGGCCGCTGGCCGGGCGGGGG + Intergenic
1003407334 6:5835652-5835674 CGGGGTGGCTGGCCGGGTGGGGG + Intergenic
1004152514 6:13134169-13134191 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1004414896 6:15415670-15415692 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1004516846 6:16327969-16327991 CGGGGTCCCTGGCTGCGGGGTGG + Exonic
1005860323 6:29895775-29895797 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1006209898 6:32385288-32385310 CGGGGTGGCTGGCCGGGAGGGGG + Intergenic
1011148467 6:84244414-84244436 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1011148636 6:84244813-84244835 CGGGGTGGCTGGCCGGGTGGGGG + Intergenic
1011405140 6:87009987-87010009 CGGGGTGGCTGGCCGGGCGGAGG + Intronic
1011426762 6:87239418-87239440 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1012245794 6:96924517-96924539 CGGTGGCGTTGCGCGCGGGGTGG + Intergenic
1012899573 6:104991210-104991232 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1013204650 6:107934732-107934754 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1013204767 6:107935004-107935026 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1013243991 6:108270196-108270218 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1016802195 6:148178978-148179000 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1016973568 6:149786391-149786413 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1017170418 6:151450414-151450436 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1018400213 6:163414301-163414323 CGGGGCCGACGGCCGCGGGGGGG - Intronic
1019439207 7:1038316-1038338 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1019651578 7:2161940-2161962 CGGGGTGGCTGGCCGGGTGGGGG - Intronic
1021120225 7:16789804-16789826 CGGAGCCGCTGGCCGGGCGGGGG + Intergenic
1021120379 7:16790156-16790178 CGGGGTGGCTGGCCGGGTGGGGG + Intergenic
1022083463 7:27045311-27045333 CGGGGTGGCTGGCCGGGTGGGGG - Intergenic
1022413901 7:30161578-30161600 GGGTGTCCTTGGCAGCGGGGAGG + Exonic
1022700375 7:32754084-32754106 CGGGGTGGCTGGCCGGGTGGGGG - Intergenic
1022943746 7:35262101-35262123 CGGTGTCGCTGGCGGCGGCGGGG + Intergenic
1023039046 7:36156165-36156187 TGGTGAGGCTGGCGGCGGGGGGG + Intronic
1023160592 7:37292749-37292771 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1023791685 7:43758338-43758360 CGGTGTGCCTGGCCCCGGCGTGG - Intergenic
1024580056 7:50793648-50793670 CGGGGGCGCGGGCCGCGGGCCGG + Intergenic
1024931173 7:54667706-54667728 CGGGGCCGCTGGCCGGGCGGGGG + Intergenic
1025209871 7:57014253-57014275 CGGTGTCCCTGGCAGTGGGCGGG + Intergenic
1025795819 7:64738394-64738416 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1025796016 7:64738871-64738893 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1027226040 7:76244151-76244173 CTGTGTCGCTCACCGTGGGGAGG - Intronic
1028227223 7:88266086-88266108 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1028685555 7:93586114-93586136 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1029430085 7:100523678-100523700 CGGGGTGGCTGGCCGGGTGGGGG + Intergenic
1029457214 7:100677419-100677441 GGGTGGCGCGGGCTGCGGGGTGG + Intronic
1030329421 7:108256014-108256036 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1030725745 7:112922842-112922864 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1032042844 7:128576890-128576912 CGGGGTGGCTGGCCGGGTGGGGG + Intergenic
1032291383 7:130591740-130591762 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1032569936 7:132985743-132985765 CGGGGTGGCTGGCCGGGTGGGGG - Intronic
1033294129 7:140115091-140115113 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1033361252 7:140640503-140640525 CGGAGCCGCCGCCCGCGGGGAGG - Exonic
1033376104 7:140763262-140763284 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1034961603 7:155367244-155367266 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1035251042 7:157597165-157597187 CGGTGACGCTAGCCGGGGGCTGG + Intronic
1035403914 7:158586740-158586762 CGGCGGCGCTGCCCGCGGGGGGG + Intronic
1039153316 8:34529191-34529213 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1040069981 8:43180209-43180231 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1041070821 8:54125504-54125526 CGGGGTGGCTGGCCGGGCGGAGG - Intergenic
1042134053 8:65617011-65617033 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1042196161 8:66232680-66232702 CGGGGTGGCTGGCCGGGTGGGGG - Intergenic
1043502879 8:80874054-80874076 CGGGGTTGCGGGCCGCGGCGCGG + Intronic
1045098772 8:98825458-98825480 CGGCGCCGGCGGCCGCGGGGCGG - Intronic
1047099153 8:121657235-121657257 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1047266779 8:123315265-123315287 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1047687332 8:127316589-127316611 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1047687503 8:127316963-127316985 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1047848055 8:128826432-128826454 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1048368464 8:133757879-133757901 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1051430611 9:16977475-16977497 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1051629556 9:19128899-19128921 CTGTGTCGGGGGCCGGGGGGGGG - Intronic
1055506686 9:76955657-76955679 CGGGGTGGCTGGCCGGGTGGGGG - Intergenic
1056152654 9:83804409-83804431 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1056564173 9:87758542-87758564 CGGGGTGGCTGGCCGGGAGGGGG + Intergenic
1056564339 9:87758961-87758983 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1057155072 9:92831567-92831589 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1058425842 9:104874833-104874855 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1059120998 9:111641238-111641260 CGGGGCGGCTGGCCGGGGGGAGG - Intronic
1060811661 9:126614048-126614070 CGGCCCCGCGGGCCGCGGGGGGG - Intergenic
1203468924 Un_GL000220v1:107982-108004 CGGTGCCGCCGGCGGCGGTGAGG + Intergenic
1203476745 Un_GL000220v1:151954-151976 CGGTGCCGCCGGCGGCGGTGAGG + Intergenic
1203405535 Un_KI270539v1:257-279 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1203405718 Un_KI270539v1:689-711 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1185584657 X:1235645-1235667 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1186561744 X:10620256-10620278 CGGTTGCGCTGGCGGCGGAGGGG - Intronic
1188942879 X:36261977-36261999 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1189362114 X:40360720-40360742 GGGTGTCGCTGGCAGCATGGCGG - Intergenic
1189837917 X:45041100-45041122 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1189968420 X:46395763-46395785 CGGGGCAGCTGGCCGCGCGGGGG + Intergenic
1190171584 X:48115610-48115632 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1190521194 X:51280308-51280330 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1190521245 X:51280435-51280457 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1191679317 X:63825440-63825462 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1192510421 X:71717799-71717821 GGGTGTCCCTGGACGCTGGGCGG + Exonic
1192516276 X:71763754-71763776 GGGTGTCCCTGGACGCTGGGCGG - Exonic
1192768775 X:74167115-74167137 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1193068158 X:77279691-77279713 CGGGGTGGCTGGCCGGGTGGGGG - Intergenic
1193164539 X:78265450-78265472 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1193345164 X:80396879-80396901 CGGGGTGGCTGGCCGGGCGGGGG + Intronic
1193362242 X:80591310-80591332 CGGGGTGGCTGGCCGGGTGGGGG - Intergenic
1194611561 X:96051118-96051140 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1195923157 X:110002575-110002597 CAGTGGCGGTGGCAGCGGGGAGG + Intergenic
1197455719 X:126674134-126674156 CGGGGTGGCTGGCCGGGCGGGGG - Intergenic
1197897142 X:131327614-131327636 CGGGGTGGCTGGCCGGGCGGGGG - Intronic
1198476213 X:137000084-137000106 CGGGGTGGCTGGCCGGGCGGGGG + Intergenic
1198476441 X:137000585-137000607 CGGGGCGGCTGGCCGGGGGGGGG + Intergenic
1198476465 X:137000636-137000658 CGGTGCGGCTGGCCGGGCGGGGG + Intergenic
1199832999 X:151562893-151562915 GGGTGTCGGTGGTCGGGGGGGGG + Intergenic