ID: 928186649

View in Genome Browser
Species Human (GRCh38)
Location 2:29115958-29115980
Sequence CAGAGCCCAGCTCCGCCGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 449}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928186649_928186661 28 Left 928186649 2:29115958-29115980 CCCGGCGGCGGAGCTGGGCTCTG 0: 1
1: 0
2: 1
3: 39
4: 449
Right 928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
928186649_928186653 -2 Left 928186649 2:29115958-29115980 CCCGGCGGCGGAGCTGGGCTCTG 0: 1
1: 0
2: 1
3: 39
4: 449
Right 928186653 2:29115979-29116001 TGGGCCACGACCGCCAGCCGCGG 0: 1
1: 0
2: 2
3: 12
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928186649 Original CRISPR CAGAGCCCAGCTCCGCCGCC GGG (reversed) Intronic
900584769 1:3427519-3427541 CAGAGCCCATCCCCTCCTCCAGG + Intronic
900610618 1:3543101-3543123 CAGAGCTCAGCTCCTGCCCCAGG + Intronic
900657501 1:3766864-3766886 CAGAGTCCTGCTCCGTCACCAGG + Intronic
900867495 1:5278685-5278707 CGGAGCCCTGCCCTGCCGCCTGG + Intergenic
900877031 1:5350195-5350217 CAGAGTCCAACTCCCCCGTCTGG + Intergenic
900935725 1:5765217-5765239 CAGAGCCCAGATTCGCACCCAGG - Intergenic
900959833 1:5911859-5911881 CAGAGGACAGCGCGGCCGCCAGG + Intronic
901129712 1:6954729-6954751 GAAAGCCCTGCCCCGCCGCCTGG + Intronic
901511685 1:9720927-9720949 CTGCCCCCAGCTCCGCCCCCAGG - Intronic
901570697 1:10157749-10157771 CAGAGTCCCGCTCTGTCGCCAGG - Intronic
901832081 1:11898807-11898829 CAGAGCCCATCTTGGCTGCCGGG + Intergenic
902416302 1:16241854-16241876 CAGAGCCTTGCTCTGTCGCCAGG + Intergenic
902458174 1:16551173-16551195 CAGAGCACAGCCCCTCCACCAGG + Intergenic
902475480 1:16682188-16682210 CAGAGCACAGCCCCTCCACCAGG + Intergenic
902493985 1:16856746-16856768 CAGAGCACAGCCCCTCCACCAGG - Intronic
902682744 1:18055153-18055175 CAAAGGCCAGCTCAGCCCCCAGG - Intergenic
902732442 1:18378116-18378138 CGAAGCCCAGCTCTGCCACCTGG - Intronic
902793348 1:18784189-18784211 CAGGCCCCAGCTGGGCCGCCTGG + Intergenic
903059699 1:20661327-20661349 TGGAGCCCAGCACCGCGGCCCGG - Exonic
903628245 1:24746017-24746039 CAGCGCTCCGGTCCGCCGCCCGG + Intronic
904215495 1:28915177-28915199 GACAGCCCAGCTCCCTCGCCAGG - Intronic
904800028 1:33086026-33086048 CAGAACCAAGCTCCTCCCCCTGG - Intronic
904841075 1:33372303-33372325 CAGCGCCCAGCTCCAGAGCCTGG - Exonic
906146591 1:43564198-43564220 GAGAGCCCAGCCCCACCCCCAGG - Intronic
906640777 1:47439200-47439222 CGCAGCCCAGCTCCGCGCCCAGG - Exonic
906960944 1:50419201-50419223 CAGGGCCCAGGCCGGCCGCCAGG + Exonic
907449292 1:54532876-54532898 CAGGGTCTAGCTCCGTCGCCCGG - Intergenic
910683327 1:89890110-89890132 CACTGCCAAGCTCCGCCTCCCGG - Intronic
910935411 1:92482441-92482463 CAGCGCCTAGCTCCTCTGCCTGG + Intronic
911073169 1:93847849-93847871 CAGGGCCCAGCTCAGCCGACTGG + Intergenic
912364905 1:109125419-109125441 CAGAGTCTTGCTCCGTCGCCAGG + Intronic
912539341 1:110400946-110400968 CAGAGTCCTGCTCTGTCGCCAGG - Intergenic
912725747 1:112057562-112057584 CAGAGTTCAGCTCCGCCTTCAGG - Intergenic
912845773 1:113073512-113073534 CAGAGACCTGCTCCGGCGGCGGG - Exonic
914323106 1:146584373-146584395 CTCAGCCCAGCTCAGCCACCTGG + Intergenic
914412572 1:147445516-147445538 CAGAGCCTTGCTCTGTCGCCAGG - Intergenic
915636776 1:157193072-157193094 CAGAGGCCAGCTCTCCCTCCAGG + Intergenic
915637096 1:157194955-157194977 CTGGGCCCAGCTCCGCCTCGGGG - Intergenic
915828367 1:159102559-159102581 CAGGGTACAGCTCCCCCGCCGGG - Intronic
916130197 1:161606027-161606049 CAGCGCCGCGCTGCGCCGCCCGG + Intronic
916470676 1:165119332-165119354 CTCAGCCCAGCTCCACCTCCTGG + Intergenic
917932554 1:179833157-179833179 CAGAGTCTAGCTCCGTCACCTGG - Intergenic
919520473 1:198582034-198582056 CAGAGCCCAGCTGCTCTGCTGGG - Intergenic
922817383 1:228459389-228459411 CAGAGCCAGGCACCACCGCCAGG - Exonic
1062857999 10:789150-789172 CAGAGCTCTGCTCCGGGGCCAGG + Intergenic
1062898790 10:1126002-1126024 CAGAGCACAGCAGAGCCGCCAGG - Intronic
1062974538 10:1673806-1673828 CACAGCCCAGCTGCCCCTCCTGG - Intronic
1063311993 10:4961576-4961598 CAGAGTCCTGCTCTGTCGCCAGG + Intronic
1063504020 10:6580180-6580202 CCGCGCCCCGCGCCGCCGCCGGG - Intronic
1063511819 10:6652904-6652926 CAGAGTCTAGCTCTGTCGCCAGG + Intergenic
1063962025 10:11314630-11314652 CTGAACCCAGCTCTGCTGCCAGG + Intronic
1064538759 10:16384953-16384975 CAGAGTCTAGCTCTGTCGCCAGG - Intergenic
1065554795 10:26905175-26905197 CAGAGCCTAGCTCTGTCTCCTGG + Intergenic
1067066302 10:43105958-43105980 CAGAGCCGAGCTCCGAGGCCAGG - Intronic
1069034151 10:63630316-63630338 CAGAGCCGAGCTGGGCCGGCCGG + Intergenic
1069523637 10:69147736-69147758 CAGAGTCCTGCTCTGTCGCCAGG + Intronic
1070328300 10:75401708-75401730 CAGAGCGCAGCGCCGGCGCGGGG - Exonic
1070593412 10:77816476-77816498 CAGAGCCCAGGCCCGCTGCCGGG + Intronic
1071266167 10:83966790-83966812 AAGAGTCCAGCTCCTCCACCTGG + Intergenic
1071527306 10:86366154-86366176 CGGTGCACAGCTCCTCCGCCGGG + Intronic
1071683014 10:87726402-87726424 CAGAGTCTTGCTCTGCCGCCAGG - Intronic
1071832963 10:89390504-89390526 CAGAGCCCAGCTTAGACTCCTGG + Intronic
1072059857 10:91798922-91798944 CAGACCCCACCTGCGCAGCCGGG + Intronic
1072141598 10:92593328-92593350 CAGCGCCCAGGTCCGCGGCCGGG + Exonic
1073320819 10:102615438-102615460 CAGCACCCAGCTCAGCCTCCAGG + Intronic
1074726729 10:116318488-116318510 CAGAGCCCAGCACGGGGGCCAGG - Intergenic
1076371782 10:129960017-129960039 CTCAGCCCGGCTCCGCCGCTGGG + Intronic
1076696053 10:132247909-132247931 CAGTGCCCAGCTCTGATGCCTGG - Intronic
1076754705 10:132563147-132563169 CAGGGCCCAGCTCCACAGCCTGG - Intronic
1077106494 11:844609-844631 CAGTGCCCTGCCCCGCCACCAGG - Intronic
1077360351 11:2138005-2138027 CCACCCCCAGCTCCGCCGCCAGG + Intronic
1078326769 11:10387634-10387656 CAGAGCCCAGCTCCAGCATCTGG + Intronic
1078521740 11:12069190-12069212 AAGATCCCTGCTCCGCCTCCTGG + Intergenic
1079454770 11:20626777-20626799 CAGATCCCAGCTCCAGCTCCAGG - Exonic
1080406882 11:31987527-31987549 CCGAGTCCGGATCCGCCGCCCGG + Intronic
1081636219 11:44724062-44724084 CAGAGTCTAGCTCTGTCGCCAGG + Intergenic
1081743268 11:45455668-45455690 CCAAGCCCAGCTCCTCCTCCTGG + Intergenic
1083186645 11:61021707-61021729 CAGTGCCCAGCTCTGCCTGCGGG + Intergenic
1083838042 11:65285375-65285397 CAGAGTCTAGCTCTGTCGCCAGG - Intronic
1083885877 11:65573297-65573319 CCCAGCCCAGCCCCGCCCCCTGG - Intronic
1083886144 11:65574360-65574382 CCGAGCCTGGCTCAGCCGCCGGG + Intergenic
1083983522 11:66193731-66193753 CTGAGCCCAGCTCTGCCTCTTGG + Intronic
1084165573 11:67373402-67373424 CCGAGCCCAGCTCCCTGGCCCGG + Intronic
1084475647 11:69387151-69387173 CAGAGCCCAGCTCCTCACCCTGG + Intergenic
1084485313 11:69444578-69444600 CAGAGCCCAGCGCCCCCTGCCGG - Intergenic
1085423610 11:76383751-76383773 CAGAGTCTAGCTCTGTCGCCAGG - Intronic
1086046845 11:82542949-82542971 CAGAGCCTCGCTCTGTCGCCAGG + Intergenic
1088132665 11:106513048-106513070 CAGAGTCTAGCTCTGTCGCCAGG + Intergenic
1088921166 11:114260656-114260678 CAGGGCCCAGCTCTGCCTCAGGG - Intronic
1089282300 11:117382850-117382872 CAGGGCCCAGCTCCTCGGCCTGG - Exonic
1089604978 11:119636470-119636492 GAGGGCCCAGCTCTGCTGCCTGG - Intronic
1090241924 11:125189949-125189971 CAGAGTCTTGCTCCGTCGCCAGG + Intronic
1090296253 11:125591241-125591263 CGGAGTCCAGCTCTGTCGCCAGG + Intergenic
1090933963 11:131325201-131325223 CAGAGCCCAGGTGCACTGCCTGG + Intergenic
1091280971 11:134381437-134381459 CAGAGCCCACCTCAGCTCCCAGG - Intronic
1091656143 12:2348176-2348198 CACTGCCCAGCTCCTCCGGCTGG - Intronic
1092535001 12:9379138-9379160 CTCAGCCCAGCTCCCCTGCCTGG - Intergenic
1092821882 12:12360334-12360356 CAGAGCCTCGCTCTGTCGCCAGG - Intronic
1094667074 12:32530975-32530997 CAGAGCCTTGCTCTGTCGCCAGG + Intronic
1098288569 12:68933368-68933390 CTCCGCCCAGCTCAGCCGCCCGG - Intronic
1100600659 12:96109090-96109112 CCGAGCCCTGCTCCGCCGGAAGG - Intergenic
1102577091 12:113862711-113862733 CTGAGCCCAACTCTGCCGCTCGG + Intronic
1102814930 12:115858116-115858138 CAGAGCTCAGCCCTGCCTCCAGG + Intergenic
1104761620 12:131300249-131300271 GAGAGCCCAGCTCTGCTCCCCGG - Intergenic
1104818153 12:131660543-131660565 GAGAGCCCAGCTCTGCCCCCCGG + Intergenic
1104937836 12:132375984-132376006 CAGAGCCCAGCGCCCCGGGCAGG + Intergenic
1104952940 12:132450615-132450637 CAGGGCCCAGCTCCCCAGGCCGG + Intergenic
1104953059 12:132451090-132451112 CGGAGCCCAGCACGCCCGCCCGG + Intergenic
1105828046 13:24139991-24140013 CACTGCCAAGCTCCGCCTCCCGG - Intronic
1107595782 13:41961284-41961306 CAGAGCCCAGCGCCGCAGCTCGG - Intergenic
1108600590 13:51991060-51991082 CAGAGTCTCGCTCCGTCGCCAGG - Intronic
1109284870 13:60397626-60397648 CGGGGCCCAGGCCCGCCGCCCGG - Intronic
1109451015 13:62514351-62514373 CAGAGCCTCGCTCTGGCGCCAGG + Intergenic
1110030537 13:70605998-70606020 CAGAGTCTAGCTCTGTCGCCAGG - Intergenic
1111101204 13:83589232-83589254 CAGAGTCCTGCTCTGTCGCCAGG - Intergenic
1111249968 13:85589820-85589842 CAGAGCCTTGCTCTGCCCCCAGG + Intergenic
1112028356 13:95433838-95433860 CAGAGCCCAGATCTGCGCCCTGG - Intronic
1112032914 13:95473815-95473837 CAAAGGCCAGCTCTGCCGCCAGG + Intronic
1113399855 13:109981364-109981386 CAGAGCCTTGCTCTGTCGCCAGG + Intergenic
1115065391 14:29253906-29253928 CAGAGCCTTGCTCTGTCGCCAGG - Intergenic
1115581293 14:34761249-34761271 CAGAGTCTAGCTCTGTCGCCAGG - Intronic
1116102897 14:40464713-40464735 CAGAGTCATGCTCCGCGGCCAGG - Intergenic
1116464375 14:45214515-45214537 CAGAGACCAGGGGCGCCGCCCGG + Intronic
1117722098 14:58638136-58638158 TAGCGCCCTGCTCCTCCGCCTGG + Intronic
1118823433 14:69359997-69360019 CAGAGTCCCACTCCGTCGCCAGG - Intergenic
1119351921 14:73973010-73973032 CAAAGCCCACCTCCCCTGCCAGG + Exonic
1120487985 14:85138898-85138920 CAGAGTCCTGCTCTGTCGCCAGG + Intergenic
1121044140 14:90775603-90775625 AGGAGCCCAGCTCCTCCACCTGG + Intronic
1121249084 14:92486291-92486313 CAGAGCCAAGACCAGCCGCCAGG + Intronic
1122725009 14:103744778-103744800 CACAGCCCAGCTCCACCTCTGGG + Intronic
1122880311 14:104687902-104687924 CACTGCCCAGCACCGCTGCCAGG + Intergenic
1122884845 14:104706379-104706401 CAGGGCCCAGCCCGGCCCCCAGG - Intronic
1202828501 14_GL000009v2_random:2465-2487 CAGAGCCTTGCTCTGTCGCCCGG + Intergenic
1124713137 15:32031114-32031136 CCCAGCCGAGCTCCACCGCCTGG - Intronic
1124983496 15:34584121-34584143 CAGGGCGCAGCGCCGCGGCCGGG - Intronic
1125969851 15:43903045-43903067 CAGAGATCAGCTCCGGCTCCAGG + Intronic
1127982794 15:64046596-64046618 GAGAGCCCAGCTTCCCGGCCGGG + Intronic
1128310882 15:66631255-66631277 CGGAGCCCAGCTCAGCCGGGTGG - Intronic
1129221487 15:74134110-74134132 CACAGCGCTGCTCCTCCGCCGGG - Exonic
1129799769 15:78405438-78405460 CCGGGCCCAGCTCCGCGTCCAGG - Intergenic
1131035895 15:89221828-89221850 CAGATCCCAGCCCCACAGCCGGG - Intergenic
1131090086 15:89617715-89617737 CAGAGTCTAGCTCTGTCGCCAGG + Intronic
1131231878 15:90665557-90665579 CAAAGCCCGGCTCCTCTGCCCGG + Intergenic
1132005776 15:98225831-98225853 CAGAGCCTTGCTCTGTCGCCAGG + Intergenic
1132045957 15:98562965-98562987 CAGGGCCCAGCTCTGCCTCTGGG - Intergenic
1132177164 15:99725013-99725035 CCGAGCCCTGTTCCCCCGCCTGG + Intronic
1132342942 15:101089538-101089560 CAGAGCCCTACTCTGCCACCAGG - Intergenic
1132676681 16:1123972-1123994 CAGAGCCGAGCCCCTCCCCCAGG - Intergenic
1132865473 16:2090931-2090953 CGGAGCTCAGCTGCGCCACCTGG + Exonic
1132971489 16:2691447-2691469 TAGAACCCAGCTGAGCCGCCGGG - Intronic
1133119039 16:3595164-3595186 CAGAGCACAGCTGAGCAGCCTGG - Intronic
1133808117 16:9140668-9140690 CAGAGTCTAGCTCTGTCGCCAGG - Intergenic
1136508440 16:30721281-30721303 CTGAGCCCAGCCCCACCTCCAGG + Exonic
1138344897 16:56314645-56314667 CCGAGTCCAGCGCCGGCGCCTGG + Intronic
1139327203 16:66161692-66161714 CAGAGCCAAGCTTTGCCTCCAGG - Intergenic
1139355203 16:66363474-66363496 CAGAGCCCAGCTCCTTACCCAGG - Intergenic
1139631702 16:68235511-68235533 AAGAGCCCAGTCCTGCCGCCTGG + Intronic
1139878885 16:70167756-70167778 CCGCGCCCGGCTCCGCCTCCCGG - Intergenic
1140010453 16:71126477-71126499 CTCAGCCCAGCTCAGCCACCTGG - Intronic
1140054756 16:71516176-71516198 CAGAGCCCCGCTGCGGCGCCAGG - Intronic
1140206567 16:72938377-72938399 CAAAGCCCAGCTCCGCTGAGGGG - Intronic
1140373633 16:74427737-74427759 CCGCGCCCGGCTCCGCCTCCCGG + Intergenic
1140860836 16:79016445-79016467 CAGAGTCTCGCTCCGTCGCCTGG + Intronic
1141435431 16:83997160-83997182 CAGAGCCCCACTCCGCCCCGGGG - Intronic
1143021746 17:3920354-3920376 CAGGGCCCAGCCCAGCCCCCAGG - Intergenic
1143189162 17:5029151-5029173 CAGAGCCTTGCTCTGTCGCCAGG + Intergenic
1143342479 17:6224092-6224114 CAGAGTCCTGCTCTGTCGCCAGG - Intergenic
1143390581 17:6556940-6556962 CAGAGCCCGGCTCCGGCTCCGGG + Intergenic
1143962117 17:10729725-10729747 CGGCTCCCAGCTCCGCCCCCTGG - Intronic
1144372564 17:14606021-14606043 CACTGCCAACCTCCGCCGCCCGG + Intergenic
1145083774 17:19917875-19917897 CAGAGTCTAGCTCTGTCGCCAGG - Intronic
1145263347 17:21367605-21367627 CAGAGCCCAGCTCAGCCCCAGGG - Intergenic
1145771287 17:27495029-27495051 CAGAGCCCTGCCCAGCCGCCCGG - Intronic
1146359040 17:32159386-32159408 CAGGGCCCAGCTCCACCTCGGGG - Intronic
1146397814 17:32482819-32482841 CAGAGCCCCCCGCCCCCGCCAGG - Exonic
1147140374 17:38457290-38457312 CAGAGCCCAGCCCAGAGGCCTGG - Intronic
1147150372 17:38510567-38510589 GGGAGGCCAGCGCCGCCGCCGGG - Exonic
1147743778 17:42683081-42683103 CAGAGCCCAGCCCCAGCCCCGGG - Intronic
1148139195 17:45316641-45316663 TAGTGCCCCGCGCCGCCGCCAGG - Intronic
1148156583 17:45428188-45428210 CAGTGCCCAGCCCCGCCCGCCGG + Intronic
1148271677 17:46266722-46266744 CAGATCCCCGCTCCGCTCCCAGG - Intergenic
1148439173 17:47702906-47702928 CTGGGCCCAGCTCCCCAGCCTGG + Intronic
1148936245 17:51166459-51166481 CCCAGCGCAGCGCCGCCGCCCGG + Intronic
1149573596 17:57695521-57695543 CAGAGTCCAGCTCCTCAGCCTGG + Intergenic
1149746028 17:59099155-59099177 CAGAGCCTCGCTCTGTCGCCAGG - Intronic
1150520879 17:65865894-65865916 CTGGGCCCAGCTCCGCCTCAGGG - Intronic
1150765096 17:67996077-67996099 CAGATCCCCGCTCCGCTCCCAGG + Intergenic
1151336616 17:73443735-73443757 CAAAGCCTAGCTCTGCCCCCAGG + Intronic
1151658044 17:75504779-75504801 CAGTGCCCAGCACTGCCCCCTGG + Intronic
1151772846 17:76176740-76176762 CAAGGCCCAGCTCCGCCTCGGGG - Intronic
1151821987 17:76501473-76501495 TGGAGCCCAGCCCCGCCTCCCGG - Intronic
1152023454 17:77793959-77793981 CAATGCCCAGCTCTGCAGCCGGG - Intergenic
1152100073 17:78296234-78296256 CAGAGCCCACCTTCTCCTCCAGG - Intergenic
1152111757 17:78360631-78360653 CTGACCCCAGCCCCGCTGCCTGG - Intergenic
1152133211 17:78489751-78489773 GAGAGCCCAGCTCCCCAGCATGG + Intronic
1152680806 17:81666869-81666891 CAGCGCCCAGCCCCGTGGCCCGG + Exonic
1152898638 17:82927769-82927791 CAGAGCCCAGGCACGCTGCCAGG - Intronic
1152935795 17:83135931-83135953 CAGAGCCCTGCCCCGCGGCCCGG - Intergenic
1153201903 18:2655731-2655753 CCGCGACCAGCGCCGCCGCCGGG - Exonic
1154062977 18:11080816-11080838 CAGAGCCTTGCTCTGTCGCCAGG - Intronic
1154147081 18:11875222-11875244 CAGGGCCCAGCTCCTGTGCCTGG + Intronic
1155185985 18:23386932-23386954 CAGAGTCTCGCTCTGCCGCCTGG + Intronic
1156426141 18:37014926-37014948 CAGAGTCTAGCTCTGTCGCCAGG + Intronic
1157694106 18:49707273-49707295 CAAAGCCTAGCTCAGCCTCCTGG + Intergenic
1157894062 18:51447577-51447599 CAGAGCACAGCCCTGCAGCCTGG + Intergenic
1159142421 18:64413688-64413710 CAGAGCCTTGCTCTGTCGCCAGG - Intergenic
1160751988 19:738736-738758 CAGAGTCCAGGGCCGCAGCCGGG + Intronic
1160757025 19:763132-763154 CAGAGGCCCGCTACGGCGCCTGG - Intronic
1160844135 19:1159269-1159291 CAGGCCCCAACTCGGCCGCCAGG + Intronic
1160847444 19:1172815-1172837 CACAGGCCAGCTCCGAGGCCGGG + Intronic
1161124569 19:2548454-2548476 CAGAGCCTCGCTCTGTCGCCCGG - Intronic
1161249037 19:3270705-3270727 TAAAGCCGAGCTCCGCGGCCCGG - Intronic
1161284943 19:3464039-3464061 CAGAGCCCACCCCCGCGCCCCGG - Intronic
1161424980 19:4198385-4198407 CAGCGCCCAGCCCCGCCCTCCGG + Intronic
1161516628 19:4700083-4700105 CAGGCCCCAGCCCTGCCGCCCGG - Intronic
1161663590 19:5561625-5561647 CAGAGTCCTGCTCTGTCGCCAGG + Intergenic
1161666501 19:5580220-5580242 CAGAGCCCAGCTCTTGAGCCTGG + Intergenic
1161676243 19:5651658-5651680 CAGTGCCCAGCGCAGCCGCCTGG + Intronic
1161721058 19:5902984-5903006 CAGAGCCTTGCTCTGTCGCCCGG - Intronic
1162352811 19:10161277-10161299 CAGAGTCTCGCTCTGCCGCCAGG - Intronic
1162363392 19:10232847-10232869 CAGAGTCTAGCTCTGTCGCCAGG + Intergenic
1162733258 19:12731530-12731552 CCGCGCCCAGCTCCGCCAGCCGG + Intronic
1163093487 19:15037743-15037765 CAGAGCCCAGCTGCAACGCTTGG + Intergenic
1163378106 19:16946850-16946872 AAGAGCCCAGCTCCCCCAACAGG + Intronic
1163548394 19:17952181-17952203 CTGGGCCCCGCCCCGCCGCCCGG - Intronic
1163790795 19:19305102-19305124 CAGAGGCCAGCTTGGCCCCCGGG - Intronic
1165019217 19:32909343-32909365 CAGAGGCCTGCTCAGCAGCCAGG + Intronic
1165154349 19:33778161-33778183 CAGAGCCGTTCTCCGCCGCCAGG + Intergenic
1165446812 19:35861112-35861134 CAGAGCCCAGCACCTGCGACAGG - Exonic
1165923831 19:39314928-39314950 CGGCGACCAGCTCCGCGGCCTGG - Exonic
1166077211 19:40420809-40420831 CTGAGCTCAGCACCGCCCCCTGG - Intergenic
1166082051 19:40450171-40450193 CAGAGTCTTGCTCTGCCGCCAGG - Intronic
1166299584 19:41906400-41906422 CAGATCCCAGCCCAGCCCCCTGG + Intronic
1166860845 19:45810243-45810265 CACTGCCAAGCTCCGCCTCCTGG + Intronic
1166885116 19:45955830-45955852 CGGAGTCCCGCTCTGCCGCCAGG - Intronic
1166963032 19:46510852-46510874 CAGAGCCCCGCTCTGTCCCCAGG - Intronic
1167030759 19:46958307-46958329 CACTGCCAAGCTCCGCCTCCTGG - Intronic
1167111610 19:47465917-47465939 CTGGGCCCAGCTCACCCGCCTGG + Exonic
1167354251 19:48993479-48993501 CAGCGGCAAGCTCCGCCCCCTGG - Exonic
1167381215 19:49139297-49139319 CAGAGTCTAGCTCTGTCGCCAGG - Intronic
1167788964 19:51659218-51659240 CGGAGCCTTGCTCCGTCGCCAGG - Intergenic
1168271865 19:55254522-55254544 CCAAGCACAGCTCTGCCGCCAGG + Intronic
1168612891 19:57815085-57815107 AAAAGCCCAGCTCCACCTCCGGG + Intronic
1168675338 19:58273819-58273841 CAGAGTCTTGCTCTGCCGCCAGG + Intronic
1202644194 1_KI270706v1_random:125344-125366 CAGAGCCTTGCTCTGTCGCCCGG - Intergenic
925066656 2:933056-933078 CAGAGCCCCGCAGCGCTGCCTGG - Intergenic
925343740 2:3154904-3154926 CAGAGCCCAGCACCGCTGCAGGG + Intergenic
925868503 2:8249392-8249414 CAGTGCCCAGCTCCGGGTCCTGG - Intergenic
925924314 2:8659454-8659476 CAGAGGCCTGCTCAGCAGCCAGG - Intergenic
926198023 2:10775264-10775286 CCGCCCCCAGCTCCACCGCCTGG - Intronic
926217050 2:10912215-10912237 CAGCCCCGAGCCCCGCCGCCGGG + Exonic
926759190 2:16262238-16262260 CAGAGCCCTGCTCCTCCCCAAGG - Intergenic
926839630 2:17065430-17065452 CAGAGCCTTGCTCTGTCGCCAGG + Intergenic
928186649 2:29115958-29115980 CAGAGCCCAGCTCCGCCGCCGGG - Intronic
928278169 2:29921037-29921059 CAGACCCCAGCTCCGACTGCGGG - Exonic
929188730 2:39120788-39120810 CAGCCGCCAGCTCCGCCGCGGGG - Intronic
932415678 2:71572649-71572671 CAAAGCCCAGCCCTGCCTCCAGG - Intronic
933605425 2:84377461-84377483 CAGAGCCTTGCTCTGTCGCCAGG + Intergenic
933824618 2:86147776-86147798 GAGAACCCAGCTTCGCCGACAGG - Exonic
937223133 2:120353469-120353491 TGGAGCCCAGCTCTGCCCCCAGG + Intergenic
938296282 2:130181613-130181635 CAGAGCCACGCCCCGCGGCCGGG + Exonic
938460466 2:131493034-131493056 CAGAGCCACGCCCCGCGGCCGGG - Intergenic
939076168 2:137605692-137605714 CGGAGTCCTGCTCCGTCGCCAGG + Intronic
940440158 2:153706020-153706042 CAGAGCCTAACTCTGTCGCCAGG + Intergenic
940650362 2:156435661-156435683 CAGAGCCCAGAACCCTCGCCCGG - Exonic
941917778 2:170823500-170823522 GAAAGCCCAGCCCTGCCGCCGGG + Intronic
942717335 2:178908218-178908240 CAGAGTCTCGCTCTGCCGCCAGG + Intronic
944085026 2:195835816-195835838 CAGAGTCTTGCTCTGCCGCCAGG - Intronic
944567006 2:201001696-201001718 CAGAGTCTTGCTCTGCCGCCAGG + Intronic
946327902 2:218994047-218994069 CAGCGCCCGGCGCCGCCGCGTGG - Intergenic
947435354 2:230068174-230068196 CGGAGCCCAGCCTCGCTGCCCGG - Intronic
947524642 2:230870685-230870707 CCGAGCCCAGCCCCTCCCCCAGG + Intronic
947642949 2:231717189-231717211 CAGAGTCTAGCTCTGTCGCCCGG + Intergenic
949002245 2:241622340-241622362 CAGAGCCTTGCTCTGTCGCCAGG - Intronic
1168836111 20:878380-878402 CCCAGCCCAGCTCCTCAGCCAGG - Intronic
1171371233 20:24663542-24663564 CAGAGCCCAGCCCAGGCCCCAGG + Intronic
1172470530 20:35190883-35190905 CAGAGTCTCGCTCCGTCGCCAGG + Intergenic
1172841750 20:37906139-37906161 CTGAGCCCAGCCCGGCCGCCGGG + Intronic
1173874790 20:46363785-46363807 CTAAGCCCAGCTCCTCAGCCTGG + Intronic
1174426673 20:50436517-50436539 AGGAGCCCAGCTCCGGAGCCAGG - Intergenic
1174746273 20:53066542-53066564 CAGAGCCTAGCTCTGTCACCAGG + Intronic
1174867491 20:54151570-54151592 CAGAGTCCTGCTCTGTCGCCAGG + Intergenic
1174875772 20:54224822-54224844 CAGTGCCAACCTCCGCCGCCCGG + Intronic
1175221635 20:57420735-57420757 CAGAGCCCAGCTCATGCTCCAGG - Intergenic
1175263179 20:57687527-57687549 AAGAGCCCAGCCCTGCCTCCAGG + Intronic
1175795529 20:61768040-61768062 CAAAGACCAGCTCAGCCACCAGG + Intronic
1175857710 20:62131576-62131598 CAGAGTCCAGCTCTGCCCTCAGG - Intronic
1175957491 20:62618800-62618822 CAGAGCCCAGCCCCTCCCCGGGG + Intergenic
1176447385 21:6831696-6831718 CAGTGCCCAGCGCAGCCACCCGG - Intergenic
1176607683 21:8847293-8847315 CAGAGCCTTGCTCTGTCGCCCGG + Intergenic
1176825553 21:13696722-13696744 CAGTGCCCAGCGCAGCCACCCGG - Intergenic
1177074464 21:16554745-16554767 CAGAGCCAAGCTCTCCAGCCAGG + Intergenic
1177643026 21:23868231-23868253 CAGAGTCCAGCTCTGTCACCAGG - Intergenic
1178248912 21:30983049-30983071 CACTGCCAAGCTCCGCCTCCCGG + Intergenic
1179797611 21:43794505-43794527 CAGAGCACAGCCCAGCAGCCCGG - Intronic
1179965317 21:44801599-44801621 CCGGGCCCGGCTCCCCCGCCAGG + Intronic
1180032578 21:45222401-45222423 CAGGGCCCAGCATCGCCGCCTGG + Exonic
1180089832 21:45528241-45528263 CAGAGCCCAGGCCAGCCCCCAGG + Intronic
1180143776 21:45908758-45908780 CAAAGCCCAGCTCTGTCTCCTGG + Intronic
1180357769 22:11857090-11857112 CAGAGCCTTGCTCTGTCGCCCGG + Intergenic
1180380498 22:12135243-12135265 CAGAGCCTTGCTCTGTCGCCCGG - Intergenic
1180959185 22:19755019-19755041 CAGGGGCCAGGTCCGCCTCCAGG - Intergenic
1180996567 22:19968713-19968735 CAGGGCCCTGCTTCGCTGCCTGG - Exonic
1181038966 22:20183001-20183023 CTGAGCCCTGCTCCTCCTCCTGG + Intergenic
1181049301 22:20231163-20231185 CAGAGCCCAGCTCAGCACCCGGG + Intergenic
1181406150 22:22686390-22686412 CAGGGCCCAGCTCAGCCCCATGG + Intergenic
1181414100 22:22747050-22747072 CAGAGCCCAGCTCAGCCCCATGG + Intronic
1183316685 22:37141017-37141039 GAGACCCCAGCTACGCCTCCCGG - Intronic
1183476408 22:38038438-38038460 CAGAGCCCATCATGGCCGCCAGG - Intronic
1183573345 22:38670898-38670920 CCAAGCCCAGCTCCACCTCCCGG - Exonic
1183578253 22:38706154-38706176 CAGCGCCCGCCGCCGCCGCCCGG - Intronic
1184019970 22:41814223-41814245 CAAAGCCCACCTCAGCCCCCTGG - Intronic
1184084591 22:42252475-42252497 CTGAGTCCAGCTCTGTCGCCAGG + Intronic
1184101424 22:42343519-42343541 CGGAGCCCGGCCCCGCTGCCCGG - Intronic
1184608082 22:45585816-45585838 CAGAGCCCATCTCTGCCCCATGG - Intronic
1185173013 22:49304429-49304451 CAGAGCCCAGCCCTGCCTCCCGG + Intergenic
1185239524 22:49735220-49735242 CAGGTCCCAGCTCCGCCGTGTGG + Intergenic
949872803 3:8603500-8603522 CAGATCCCAGCCCCTCCCCCAGG - Intergenic
950067989 3:10128854-10128876 CAGAGCCTTGCTCTGCTGCCAGG + Intergenic
951038999 3:17967438-17967460 CTGAGCCCAGCTCTGCAGACGGG - Intronic
952427656 3:33192096-33192118 CAGAGCCTTGCTCTGTCGCCTGG + Intronic
952942314 3:38454127-38454149 CTGAGCCCGGCCCCGCCGACCGG + Exonic
953357233 3:42265688-42265710 CAGAACTCAGCTGCGCAGCCTGG + Exonic
953563769 3:44014104-44014126 CAGAGCCCGGCCCAGCAGCCTGG + Intergenic
953932280 3:47011450-47011472 CAGCTCCCAGCTCCCCTGCCTGG + Intergenic
955346897 3:58168076-58168098 CAGAGTCCAGCTCTCCCTCCAGG - Intronic
955583445 3:60449975-60449997 CAGAGTCTAGCTCTGTCGCCAGG - Intronic
956061893 3:65356645-65356667 CAGAGACCGTCTCCGCCGGCTGG + Exonic
956679063 3:71761078-71761100 CAGAGTCTTGCTCTGCCGCCCGG + Intergenic
957479718 3:80775622-80775644 CTGAGTCCAGCTCTGTCGCCAGG - Intergenic
959324166 3:104914569-104914591 CAGAGTCTTGCTCTGCCGCCAGG - Intergenic
961047676 3:123720696-123720718 CAGAGCCCAGCTCTGGCCTCTGG - Intronic
961116549 3:124334817-124334839 CAGAGTCTCGCTCTGCCGCCTGG + Intronic
961346559 3:126267250-126267272 GAGAGCCAAGCAGCGCCGCCGGG - Intergenic
961699564 3:128732063-128732085 CAGAGTCAAGCTCTGTCGCCAGG + Intronic
962285734 3:134084434-134084456 CAGACCCCAGCTGCTCAGCCAGG - Intronic
962792448 3:138823675-138823697 CAGAGCCTCGCTCTGTCGCCAGG - Intronic
965020675 3:163226502-163226524 CAGAGTCTAGCTCTGTCGCCAGG + Intergenic
965558146 3:170038107-170038129 GAGGGCCCAGCTCGCCCGCCTGG - Exonic
965719988 3:171650821-171650843 CACTGCCAAGCTCCGCCTCCCGG - Intronic
966055417 3:175681085-175681107 CAGAGCCTCGCTCTGTCGCCAGG - Intronic
967021682 3:185528186-185528208 CAGAGCCTTGCTCTGCCGCCAGG - Intronic
968008855 3:195260211-195260233 CAGTGCCCCGCGCGGCCGCCTGG - Intronic
968133759 3:196207768-196207790 CCGAGCCCCGCCCCGCCCCCCGG + Intronic
968178218 3:196569145-196569167 CAGGGCGCAGCTCCGCAGCTCGG - Exonic
968426854 4:529350-529372 CTGACCCCAGCTCCTCAGCCAGG + Intronic
968446491 4:654938-654960 CAGACCCCGGCTCAGCCCCCAGG + Intronic
968610012 4:1552634-1552656 CAAAGCCCAGCTCAGCCACCGGG + Intergenic
969626152 4:8306711-8306733 CGGGGCTCAGCTCCGCAGCCAGG - Exonic
972556747 4:40189118-40189140 CAGAGTCCCGCTCTGGCGCCAGG - Intergenic
973110001 4:46386789-46386811 CAGAGCCCACCTCCACCTCCTGG - Intronic
977836119 4:101647860-101647882 CTGAGCCCTGCTCTGCCTCCTGG + Intronic
981009034 4:139905465-139905487 CAGAGTCTTGCTCTGCCGCCCGG - Intronic
981077956 4:140609299-140609321 CAGAGCCTTGCTCTGCTGCCAGG - Intergenic
982238320 4:153273298-153273320 CAGAGTCTCGCTCTGCCGCCCGG + Intronic
982953268 4:161727956-161727978 CAGAGTCTAGCTCTGTCGCCAGG - Intronic
984731532 4:183073174-183073196 CAGAGTCTGGCTCTGCCGCCAGG + Intergenic
984956650 4:185052057-185052079 CAGAGTCCTGCTCTGTCGCCAGG + Intergenic
985574292 5:666409-666431 CGGAGCCCACCTCCTCCTCCCGG + Intronic
985930840 5:3056487-3056509 GAGAGCCCCTCCCCGCCGCCGGG - Intergenic
987527301 5:19069420-19069442 CAGAGGCAAGCTCCGCCTCCCGG - Intergenic
987604193 5:20111570-20111592 CAGAGCCTTGCTCTGTCGCCAGG + Intronic
990148376 5:52788281-52788303 GAGAGCGCAGCTCCCGCGCCCGG + Exonic
990936620 5:61157323-61157345 CAGAGCCTTGCTCTGTCGCCAGG + Intergenic
991381159 5:66029628-66029650 CAGAGTCTCGCTCTGCCGCCAGG + Intronic
992050892 5:72939630-72939652 CACTGCCCAGCTCTGCCTCCCGG - Intergenic
995745801 5:115402253-115402275 CAGAGCCCAGCCCCAGAGCCTGG + Intergenic
997302093 5:132813666-132813688 GGAAGCCCAGCACCGCCGCCTGG - Exonic
997950918 5:138241969-138241991 CTGGGCCCAGCTCCGGCGCTCGG + Intergenic
998106689 5:139473344-139473366 CAGATCCCAGCTTCTCCGCCTGG - Intergenic
1000843744 5:166253623-166253645 CAGAGCCCAGCTTTGGCTCCAGG + Intergenic
1001293877 5:170485403-170485425 CAGAGCCCAGCTCTGGGCCCAGG + Intronic
1002057386 5:176606289-176606311 CAGAGCCCAGCTGTGCTCCCAGG + Intronic
1002252793 5:177939824-177939846 CAAAGCTCGGCTCCGCCGCTTGG - Intergenic
1002598437 5:180339352-180339374 CAGAGTCTAGCTCTGTCGCCAGG - Intronic
1003643237 6:7893232-7893254 CAGAGTCCTGCTCAGACGCCAGG - Intronic
1004537267 6:16514955-16514977 CAGAGCCTCGCTCTGTCGCCAGG - Intronic
1005182232 6:23118956-23118978 CACAGCAAAGCTCCGCCTCCCGG + Intergenic
1005670882 6:28105027-28105049 CGGAGCCCAGCTCCCCCACGCGG + Intergenic
1006187832 6:32190661-32190683 CAGAGGCCAGCTCCCCTCCCCGG - Intergenic
1006584062 6:35094074-35094096 CAAAGCCCAGCTTCCCCACCTGG - Intergenic
1007395538 6:41575713-41575735 CAGAGCCCTGCTCAGTCTCCTGG - Intronic
1007574911 6:42919067-42919089 CAGAGTCCCGCTCTGTCGCCAGG + Intronic
1008122552 6:47634857-47634879 GAGAGCCCAGCGCCGCACCCTGG + Intergenic
1008941143 6:57046900-57046922 CCGAGCCCAGCTCTGGGGCCTGG + Intronic
1008945332 6:57090398-57090420 CCGAGCCCAGCTCTGGGGCCTGG + Intronic
1011020353 6:82806205-82806227 CAGAGCCTTGCTCCACCTCCTGG + Intergenic
1012052555 6:94362352-94362374 CTGGGCCCAGCTCCGCCTCGGGG + Intergenic
1012912276 6:105131989-105132011 CAGAGTCTAGCTCTGTCGCCAGG + Intronic
1012912914 6:105137256-105137278 CGGAGCCCGGCGCCGCGGCCAGG + Intergenic
1013242322 6:108257936-108257958 CAGAGCCTTGCTCTGTCGCCAGG - Intronic
1013658784 6:112273215-112273237 CAGAGTCCAGCTCTGTCGCCAGG + Intergenic
1015237950 6:130992654-130992676 CAGAGCCTCGCTCAGTCGCCAGG + Intronic
1015352925 6:132244368-132244390 CAGAGTCTAGCTCTGTCGCCAGG + Intergenic
1015722174 6:136253840-136253862 CAGAGTCTAGCTCTGTCGCCAGG - Intergenic
1016313538 6:142760177-142760199 CAGAGCCAAGCTCCTCTCCCAGG - Exonic
1016658173 6:146544149-146544171 CAGAGCCCCGCCGGGCCGCCTGG + Intronic
1016902460 6:149115839-149115861 CAGAGTCTAGCTCTGTCGCCAGG - Intergenic
1017184343 6:151586026-151586048 CAGAAACCAGCTCTGCCTCCAGG - Exonic
1017626213 6:156351712-156351734 CAGCCCCCAGCTCCTCTGCCAGG - Intergenic
1017636207 6:156445606-156445628 CAGAGTCTCGCTCTGCCGCCCGG + Intergenic
1017672225 6:156778659-156778681 CAAGGCCCAGCGCGGCCGCCGGG - Exonic
1018465445 6:164040134-164040156 CAGGTCACAGCTCCTCCGCCCGG + Intergenic
1018683045 6:166280727-166280749 CAGACCCAAGCTCCGCTGCCGGG + Intergenic
1019457468 7:1138039-1138061 CGGACCCCAGGGCCGCCGCCCGG + Exonic
1019475829 7:1243835-1243857 CAGTGCCCGCCCCCGCCGCCAGG - Intergenic
1019501002 7:1364733-1364755 CAGAGTCCAGCACCGCCGGCTGG + Intergenic
1019565253 7:1675839-1675861 CACAGCACAGCTGCCCCGCCAGG + Intergenic
1019594078 7:1850390-1850412 CTGGGCCCAGCTCAGCCCCCTGG + Intronic
1019777146 7:2918568-2918590 CAGAGCCCAGCAGCTCCTCCTGG - Exonic
1020046525 7:5045124-5045146 CAGAGTCTCGCTCCGTCGCCAGG + Intronic
1020291887 7:6729039-6729061 CAGAGTCTCGCTCCGTCGCCAGG + Intergenic
1022911346 7:34901975-34901997 CAGAGCCCAGGGCATCCGCCTGG + Intergenic
1023005260 7:35858379-35858401 CAGAGTCTAGCTCTGTCGCCAGG + Intronic
1024965325 7:55018946-55018968 CCGATCCCTCCTCCGCCGCCTGG + Intergenic
1025865028 7:65373428-65373450 CAGAGTCTAGCTCTGTCGCCAGG - Intergenic
1027747243 7:82092445-82092467 CACTGCCAAGCTCCGCCTCCCGG + Intronic
1028695325 7:93704046-93704068 CGGAGCCTTGCTCCGTCGCCAGG - Intronic
1029257325 7:99278356-99278378 CAGAGCCCAGCCCTGACTCCAGG - Intergenic
1029681757 7:102116301-102116323 GAGAGCCCAGCTTCGTAGCCTGG + Intronic
1029689433 7:102171230-102171252 CAGACCCCAGCTCAGCAGTCTGG + Intronic
1030090544 7:105854067-105854089 CAGAGCCCATCTCTGCAGGCAGG + Intronic
1030310356 7:108062928-108062950 CAGAGGCAAGCTCCCCCACCAGG + Exonic
1030477974 7:110061770-110061792 CAGAGTCTCGCTCCGTCGCCAGG + Intergenic
1031043597 7:116863062-116863084 CAGTGCCCAGCGCGGCGGCCTGG + Intronic
1031629861 7:124033080-124033102 CCGAGCCCCGCGCCGCCTCCTGG + Intergenic
1032321172 7:130887901-130887923 GAGAGCCCAGCTCAGGCCCCTGG - Intergenic
1032332306 7:130991955-130991977 CAGAGCCCAGCTCTGTGGCTCGG - Intergenic
1033338057 7:140470020-140470042 CAGAGCCTAGCTCTGTCGCCAGG - Intronic
1033404674 7:141061151-141061173 CAGAGTCTTGCTCTGCCGCCAGG - Intergenic
1034282692 7:149864909-149864931 AAGAGCCCAGCTCCACCATCTGG - Exonic
1034494180 7:151410191-151410213 CAGAGCCCAGAGGCGCAGCCCGG - Intronic
1035018166 7:155784354-155784376 CAGTGTCCAGCTCTGCAGCCTGG - Intergenic
1035167452 7:157000073-157000095 CCGCGCCCCGCTCCGCCCCCGGG - Intronic
1035231721 7:157469588-157469610 CAGAGACCAGCGCCGACACCCGG - Intergenic
1035431850 7:158828875-158828897 CAGACCCCAGCCCCGGCCCCCGG - Intronic
1036659253 8:10697525-10697547 CAGAGCCCACATCCACTGCCTGG + Intronic
1036756743 8:11476279-11476301 CAGTGCCCACCCCCGCCCCCCGG + Intergenic
1038606632 8:29013159-29013181 CAGAGTCTAGCTCTGCCACCAGG + Intronic
1041166922 8:55101172-55101194 CCGCGCCCCGCGCCGCCGCCAGG + Intergenic
1041694449 8:60720935-60720957 TAGAGCCCTGCTCAGCAGCCTGG + Intronic
1042805205 8:72763883-72763905 CAAAGCCCAGCTCCTTCCCCAGG - Intronic
1043086429 8:75840408-75840430 CAGAGCCCAGCTCTGCAGCCAGG - Intergenic
1045321251 8:101083401-101083423 CAGAGTCTAGCTCTGTCGCCAGG + Intergenic
1046871400 8:119208752-119208774 CGGTGCCCCGCGCCGCCGCCCGG + Intronic
1048517063 8:135120753-135120775 CAATGCCCAGCTCCACCGCCAGG - Intergenic
1048796217 8:138152384-138152406 GTGAGCCAAGCTCCGTCGCCTGG - Exonic
1049401044 8:142427467-142427489 CAGAGCCCAGATCCTTGGCCAGG - Intergenic
1049556219 8:143283537-143283559 CAGGGCCCAGCTCGGCCTCTGGG + Intergenic
1049625564 8:143618221-143618243 CAGAGCCCAGTCCTGCTGCCTGG + Intergenic
1049709220 8:144056190-144056212 CATAGCCCAGCTCTGCCAGCAGG + Exonic
1050563611 9:6859447-6859469 CAGAGTCCCGCTCTGTCGCCAGG - Intronic
1052934423 9:34081066-34081088 CAGAGTCCTGCTCTGCCACCCGG - Intergenic
1054458206 9:65446677-65446699 CACTGCCAAGCTCCGCCTCCTGG - Intergenic
1054766856 9:69049155-69049177 CAGGGCCCAACTCTGCCGGCAGG + Intronic
1055981050 9:82001263-82001285 CAGAGTCTAGCTCCGTCGCTAGG + Intergenic
1057238229 9:93383671-93383693 CAGAGCCTCGCTCTGCCACCAGG + Intergenic
1057403398 9:94744315-94744337 CACTGCCAAGCTCCGCCTCCCGG - Intronic
1057478668 9:95426859-95426881 CTGAGCCCCGCCCCGCCGCGGGG - Intergenic
1058431719 9:104926680-104926702 CAGAGCCCAGCCCAGCCCCGCGG + Intronic
1058851031 9:109012835-109012857 CCGAGCCCGGCTCCTCCGCCTGG - Intronic
1059288654 9:113201016-113201038 CAGAGTCCTGCTCTGTCGCCAGG - Intronic
1060778386 9:126393313-126393335 CAGAGCCCAGCACCGGAGCCAGG - Intronic
1060794099 9:126503196-126503218 CAGAGCAGAGCGCAGCCGCCAGG + Exonic
1060831921 9:126722651-126722673 CCGAGGCCAGCCCCGCCCCCTGG + Intergenic
1060872456 9:127053713-127053735 CAGAGCCCAGCCCCACAGACTGG - Intronic
1061021605 9:128019309-128019331 CAGAGTCTAGCTCTGTCGCCAGG + Intergenic
1061208868 9:129179247-129179269 CAGCTCCTAGCTCCGCCCCCTGG - Intergenic
1061248967 9:129415440-129415462 CAGAGCCGGGATCCACCGCCAGG - Intergenic
1061292331 9:129658212-129658234 CAGAGTCTTGCTCCGTCGCCAGG + Intergenic
1061385431 9:130286753-130286775 CAGTGCCCAGCACCACTGCCTGG - Intronic
1062113289 9:134794297-134794319 CAGAGTCTTGCTCTGCCGCCAGG - Intronic
1062303329 9:135888088-135888110 CAGGGCCCAGCACAGCCACCTGG + Intronic
1062394083 9:136345702-136345724 GAGAGCCCCGCTCCGTCTCCCGG - Intronic
1062425024 9:136502161-136502183 CAGGGCCCACCTCCCACGCCAGG - Intronic
1062621250 9:137423447-137423469 CGCAGCCCCGCGCCGCCGCCTGG + Exonic
1062668841 9:137694354-137694376 CAGAGTCCAGCACCATCGCCTGG - Intronic
1203521805 Un_GL000213v1:52835-52857 CAGTGCCCAGCGCAGCCACCCGG + Intergenic
1185621476 X:1453387-1453409 CCGCCCCCAGCTCCGCCTCCCGG + Intronic
1186385420 X:9105643-9105665 CAGAGCCCCTCTCTGTCGCCAGG - Intronic
1187361521 X:18632125-18632147 CAGAGCCAAGCTCTGCAGACTGG - Intronic
1188004390 X:25007213-25007235 CCGAGCCTACCTCCGCCTCCGGG - Exonic
1192183621 X:68931275-68931297 CAGAGCTCAGCTCTGCAGCCTGG + Intergenic
1192880113 X:75274431-75274453 CAGAGTCCAGCTCGGCCGGCAGG - Exonic
1195654742 X:107323896-107323918 CTGGGCCCAGCTCCGCCTCGGGG - Intergenic
1196940923 X:120775116-120775138 CAGAGTCTAGCTCTGTCGCCAGG + Intergenic
1197344939 X:125319774-125319796 CAGTTCCCAGCTCAGCCGCTTGG + Intergenic
1200128557 X:153829580-153829602 TGGAGCCCAGCCCCGCGGCCCGG - Intronic
1200616282 Y:5383642-5383664 CAGAGTCTAGCTCTGTCGCCAGG + Intronic
1202584470 Y:26408971-26408993 CAGAACGCAGCTCCGCCCTCGGG + Intergenic