ID: 928186650

View in Genome Browser
Species Human (GRCh38)
Location 2:29115959-29115981
Sequence CCAGAGCCCAGCTCCGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 313}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928186650_928186653 -3 Left 928186650 2:29115959-29115981 CCGGCGGCGGAGCTGGGCTCTGG 0: 1
1: 0
2: 1
3: 31
4: 313
Right 928186653 2:29115979-29116001 TGGGCCACGACCGCCAGCCGCGG 0: 1
1: 0
2: 2
3: 12
4: 170
928186650_928186661 27 Left 928186650 2:29115959-29115981 CCGGCGGCGGAGCTGGGCTCTGG 0: 1
1: 0
2: 1
3: 31
4: 313
Right 928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928186650 Original CRISPR CCAGAGCCCAGCTCCGCCGC CGG (reversed) Intronic
900624098 1:3600333-3600355 CCAGAGCCCAGCTGGGATGCTGG + Intronic
900897724 1:5495534-5495556 CCAGAGCCCAACTCTGCCCCAGG + Intergenic
901332788 1:8423796-8423818 GCAGAGCCCGGCGCGGCCGCGGG + Intronic
901637076 1:10675498-10675520 CCAGTGCCCAGCTCAGCCTCAGG + Intronic
901653179 1:10754742-10754764 CCCGGGCCCAGCTCAGCTGCTGG + Intronic
902682023 1:18050315-18050337 CCAGAGCCCTGCTCCTCTGTGGG - Intergenic
903024003 1:20413959-20413981 CCATGGCCCAGCTCTGCCACTGG + Intergenic
906640581 1:47438446-47438468 CCCGGGCCCCGCTGCGCCGCGGG - Exonic
906707595 1:47906086-47906108 TCTGATCCCAGCTCTGCCGCAGG - Intronic
907877651 1:58508817-58508839 CCAGAGCCCAGCTTCTCCTGGGG + Intronic
911440583 1:97921080-97921102 CGAGAGCGCAGCCCCGCCCCGGG - Intergenic
915286610 1:154857359-154857381 CCAGAGCCCAGCACGGCACCTGG + Intronic
915319959 1:155051222-155051244 CCCAAGCCAAGCTCCGCCCCCGG - Intronic
915637097 1:157194956-157194978 CCTGGGCCCAGCTCCGCCTCGGG - Intergenic
917436165 1:175023492-175023514 CCACCTCCCAGCTCCGCCCCAGG - Intergenic
918963318 1:191307083-191307105 CCTGGGCCCAGCTCCACCTCAGG + Intergenic
919520474 1:198582035-198582057 CCAGAGCCCAGCTGCTCTGCTGG - Intergenic
919879720 1:201893619-201893641 CCAGAACCCAGCTGGGCTGCAGG - Intergenic
921505902 1:215969660-215969682 CTACAGCTCAGCTCCGCCGATGG + Intronic
922725435 1:227920885-227920907 CCAGAGCCAACCCCCGCCTCTGG + Exonic
924172436 1:241356749-241356771 CCGTAGCCCAGCCCCGGCGCGGG + Intronic
924691551 1:246356148-246356170 CCAGAGCCCAGTACCTCCACTGG + Intronic
1063504022 10:6580181-6580203 CCCGCGCCCCGCGCCGCCGCCGG - Intronic
1064034097 10:11901469-11901491 CAAGAGCCCATCTCCACTGCAGG - Intergenic
1064384634 10:14879116-14879138 ACAGTGCCCACCTCCGCGGCGGG - Intronic
1067434410 10:46266775-46266797 CCAGAGCCCAGCTGCTGCTCTGG + Intergenic
1069544901 10:69320780-69320802 CCTCAGCCCAGCTCAGCTGCTGG - Intronic
1070328301 10:75401709-75401731 GCAGAGCGCAGCGCCGGCGCGGG - Exonic
1070593411 10:77816475-77816497 GCAGAGCCCAGGCCCGCTGCCGG + Intronic
1071086821 10:81875229-81875251 CCCGAGCCCGCCGCCGCCGCCGG + Intergenic
1071527305 10:86366153-86366175 CCGGTGCACAGCTCCTCCGCCGG + Intronic
1072059856 10:91798921-91798943 CCAGACCCCACCTGCGCAGCCGG + Intronic
1072141597 10:92593327-92593349 ACAGCGCCCAGGTCCGCGGCCGG + Exonic
1072452459 10:95549376-95549398 CCAGAGCCCAGCATGGACGCTGG + Intronic
1072679886 10:97498933-97498955 CCGGAGACCAGCTCCGCTGGAGG - Exonic
1075451245 10:122553204-122553226 CCAGAGCCCACCCCTCCCGCTGG + Intergenic
1076371781 10:129960016-129960038 GCTCAGCCCGGCTCCGCCGCTGG + Intronic
1077093967 11:791611-791633 CCAGAGACCAGCTCTGTCCCTGG + Exonic
1077124429 11:926125-926147 CCAGACCCCGTCTCCGCCGGCGG - Intronic
1077365795 11:2161089-2161111 CCAGGCCCCAGCTCTGCAGCAGG - Exonic
1077459236 11:2700464-2700486 CCCGAGACCAGCCCCTCCGCCGG + Intronic
1077560437 11:3257086-3257108 CCAAAGCCCAGCTCCTTCACTGG - Intergenic
1078653895 11:13220469-13220491 CCAGGGCCCACCTCTGCCCCTGG + Intergenic
1079603611 11:22341047-22341069 CCAGAGAGCTGCTCCGCTGCAGG - Intronic
1081354106 11:42092048-42092070 CCAGCTCCCAGCTCAGACGCAGG + Intergenic
1083186644 11:61021706-61021728 CCAGTGCCCAGCTCTGCCTGCGG + Intergenic
1083898951 11:65634493-65634515 CCAGAGCCCAGCTCAGACCTGGG - Intronic
1083958790 11:66002578-66002600 TCAGGGCCCTGCTCCGCGGCTGG - Intronic
1084070165 11:66728465-66728487 CCAGAGCCCCGCGGGGCCGCCGG - Intronic
1084117132 11:67049023-67049045 ACATAGCCCAGCTCGGCAGCTGG - Exonic
1084493650 11:69491540-69491562 CCACAGCCCAGCTCCTCGGGAGG - Intergenic
1085297572 11:75439655-75439677 CCAGAGCCAAGCTCTGCCTTGGG - Intronic
1087038185 11:93774201-93774223 CTGGAGCCCAGCTCCACCTCAGG + Intronic
1087817486 11:102675797-102675819 CCAGAGCCCAGCAGCTCTGCAGG - Intergenic
1088921167 11:114260657-114260679 CCAGGGCCCAGCTCTGCCTCAGG - Intronic
1089301301 11:117500591-117500613 TCAAAGCCCAGCTCTGCCACTGG - Intronic
1089591633 11:119545943-119545965 CCCCAGCCCAGCTCTGCCTCAGG - Intergenic
1090645849 11:128766167-128766189 CCAGAGCTCAGCTCAGATGCAGG + Intronic
1090988364 11:131793846-131793868 GCAGAGCCCAGCACAGCAGCTGG - Intronic
1091498279 12:991161-991183 CCCGCCCCCAGCCCCGCCGCGGG - Intronic
1092035842 12:5333586-5333608 CCAGACCCCAGCTGTGCCACAGG + Intergenic
1092564702 12:9651669-9651691 CCAGACCCCACCTCCAACGCTGG + Intergenic
1094107976 12:26833318-26833340 CCCCGGCCCAGCTCCGCCCCCGG - Intergenic
1095099286 12:38163697-38163719 CCAGAGCCTCCCTCCGTCGCCGG + Intergenic
1096152957 12:49325932-49325954 CCAGAGCCCAGCTTTGTCCCTGG - Intronic
1096179483 12:49542758-49542780 GCACGGCCCGGCTCCGCCGCCGG - Exonic
1096549636 12:52363674-52363696 CCAAACCCCAGCTCCCCTGCTGG - Intronic
1097179924 12:57165985-57166007 CCAGAGCCGAGCTGCCCTGCAGG - Intronic
1102436803 12:112930476-112930498 CAAGTGCCCAGCTCCGCAGTGGG - Intronic
1102813364 12:115842984-115843006 CCAGAGCCCAGCACCTCGCCTGG - Intergenic
1103595452 12:122022279-122022301 CCCCGGCCCAGCCCCGCCGCGGG + Intronic
1103736296 12:123063074-123063096 GCAGAGCCCAGCTCTGCTGACGG + Intronic
1104392149 12:128400265-128400287 CCAGAGACAAGCTCAGCCACGGG - Intronic
1104822308 12:131684170-131684192 CCAGGCCCCAGCTCTGCCGAGGG + Intergenic
1105034510 12:132908930-132908952 CCAGAGCCGGGCTCCTCCTCCGG - Intronic
1105608578 13:21947689-21947711 CCAGTGCCCAGCACCACCCCTGG - Intergenic
1106087645 13:26557779-26557801 TCAGAGCGCAGCCCCGGCGCCGG + Exonic
1106435587 13:29720778-29720800 CAGGAGCTCAGCTCCTCCGCTGG + Intergenic
1113610894 13:111644672-111644694 CCATAGCCCAGCCCCTCCTCAGG - Intronic
1113676069 13:112208844-112208866 CCAGCTCCCAGCTCCTCCGAGGG - Intergenic
1113676082 13:112208883-112208905 CCAGCTCCCAGCTCCTCCGAGGG - Intergenic
1113842675 13:113369320-113369342 CCAGAGCCGGCCTGCGCCGCTGG - Intergenic
1113891024 13:113735753-113735775 CCAGAGCCACGCTCCTCAGCGGG + Exonic
1113910364 13:113838628-113838650 GCACAGCCCAGCCCCGCAGCAGG + Intronic
1114495207 14:23127277-23127299 CCTGAGCCCCGCTCCACCTCGGG + Exonic
1114680757 14:24482058-24482080 CCAGAACCCAGCTCAGCCTCTGG - Intergenic
1116063968 14:39958824-39958846 CCAGAGCCCAGTAGCTCCGCTGG + Intergenic
1116928670 14:50668262-50668284 CCAGGGCCATGGTCCGCCGCGGG + Exonic
1117562164 14:56951767-56951789 CCAAAACCCTGCTCCACCGCTGG + Intergenic
1119582620 14:75800755-75800777 CCAGAGCCCAGCAGCTCTGCTGG - Intronic
1121449076 14:93996409-93996431 CCTGAGCCCAGCCCCGACCCTGG + Intergenic
1121455788 14:94038255-94038277 GCAGAGCCCAGCTCCTTCCCTGG - Intronic
1122231201 14:100306983-100307005 CCGGAGGCCACCGCCGCCGCGGG - Intergenic
1122725008 14:103744777-103744799 TCACAGCCCAGCTCCACCTCTGG + Intronic
1122768569 14:104086884-104086906 CCAGAGCCCAGGGCCTCCCCTGG + Intronic
1202905279 14_GL000194v1_random:68165-68187 CCAGTACCCACCTCCGCTGCTGG + Intergenic
1124178445 15:27449355-27449377 CAAGAGCCCAGCTCTGCAGAAGG + Intronic
1124441412 15:29688712-29688734 CCAGGGCCCAGCACCGGCTCGGG + Intergenic
1124649677 15:31465488-31465510 CCAGGGCTCAGCTCTGCCCCAGG - Intergenic
1124910622 15:33916381-33916403 CCAGAGCCCAGAAACTCCGCTGG + Intronic
1125328910 15:38564204-38564226 CCGGAGCCCAGCGCCCCAGCAGG + Intronic
1126104646 15:45139479-45139501 CCAGATCCCGGCCCCGCTGCAGG - Exonic
1127982793 15:64046595-64046617 CGAGAGCCCAGCTTCCCGGCCGG + Intronic
1128801761 15:70501494-70501516 TCAGATCCCAGCTCTGCCACAGG + Intergenic
1129221488 15:74134111-74134133 CCACAGCGCTGCTCCTCCGCCGG - Exonic
1129743123 15:77999800-77999822 CCAGACCCCACCTCTGCCTCAGG + Intronic
1129842358 15:78751640-78751662 CCAGACCCCACCTCTGCCTCAGG - Intergenic
1130010958 15:80152773-80152795 CCAGAGCCCCGCCCCGCCCCTGG - Exonic
1130846569 15:87753245-87753267 ACAGAGCCCAGCTTCACTGCTGG + Intergenic
1130881214 15:88057681-88057703 CCAGTGCCCTGCTCTGCCCCTGG + Intronic
1131035896 15:89221829-89221851 CCAGATCCCAGCCCCACAGCCGG - Intergenic
1131439549 15:92448557-92448579 CCAGACCCCAGCTCCGTGACTGG + Intronic
1132045958 15:98562966-98562988 CCAGGGCCCAGCTCTGCCTCTGG - Intergenic
1132304708 15:100802684-100802706 CCAGATTCCAGCTCCACTGCTGG - Intergenic
1132419518 15:101652977-101652999 CCAGAGCCCAGCCCTGCCTGGGG + Intergenic
1132498349 16:274213-274235 CCATAGTCCAGCTCTGCAGCCGG + Exonic
1132580009 16:680402-680424 GCCCGGCCCAGCTCCGCCGCCGG - Exonic
1132587068 16:710236-710258 CCAGACCCCAGCTCCACCCAGGG + Intronic
1132630839 16:916586-916608 CCAGTGCCCAGCCCCGCCACTGG - Intronic
1132649118 16:1012606-1012628 CCAGAGCCCAGCAGCTCCTCTGG + Intergenic
1132700556 16:1220398-1220420 CCGCTGCCCAGCTCCGCCGAGGG - Exonic
1132971490 16:2691448-2691470 CTAGAACCCAGCTGAGCCGCCGG - Intronic
1133783433 16:8956828-8956850 TAAGAGCCCAGCCCCCCCGCAGG + Intronic
1135607616 16:23836991-23837013 CCAGAGGACACCACCGCCGCGGG + Intronic
1135707349 16:24686231-24686253 CCAGAGCCCGTCTCCACCCCAGG - Intergenic
1136298046 16:29314742-29314764 CCAGAGCCCAGCTCAGAGCCTGG - Intergenic
1136927116 16:34384625-34384647 CCAGGGCCCAGTTCAGCCGCAGG - Intergenic
1136977458 16:35027182-35027204 CCAGGGCCCAGTTCAGCCGCAGG + Intergenic
1139352891 16:66348334-66348356 CCAGTGCCCAGCCCTGCCTCAGG - Intergenic
1139491775 16:67289808-67289830 CTAGGGCCCAGCTCTGCCCCAGG + Intronic
1139651569 16:68364948-68364970 CCAGACCCCAGCTAGGCCCCAGG + Intronic
1139678240 16:68539760-68539782 CCAGGGCCCGGCTCCGGGGCAGG - Exonic
1139966128 16:70746414-70746436 CCAGAACCCAACGCAGCCGCTGG - Intronic
1140097179 16:71884529-71884551 CCCAACCACAGCTCCGCCGCAGG + Intronic
1140206568 16:72938378-72938400 ACAAAGCCCAGCTCCGCTGAGGG - Intronic
1141435432 16:83997161-83997183 CCAGAGCCCCACTCCGCCCCGGG - Intronic
1142059692 16:88021247-88021269 CCAGAGCCCAGCTCAGAGCCTGG - Intronic
1142154893 16:88528426-88528448 CCAGAGCCCAGGGCCACCACAGG + Intronic
1142256976 16:89018761-89018783 CCTGAGCCCAGCCCAGCCTCCGG + Intergenic
1142671858 17:1491301-1491323 CCGCAGCCCTGCTCCGCCTCTGG - Intronic
1143001808 17:3799318-3799340 CCACAGCTCAGCTCAGCCACGGG - Intronic
1143030311 17:3963985-3964007 CCAGCCCCCAGCCCCGGCGCCGG + Intronic
1143390580 17:6556939-6556961 CCAGAGCCCGGCTCCGGCTCCGG + Intergenic
1143974467 17:10819932-10819954 CCAGAGCCCAGCTGGGCTGGTGG + Intergenic
1144061139 17:11583861-11583883 CCTGGGCCCAGCTCCACCTCAGG + Intergenic
1144770279 17:17755758-17755780 ACAAAGCCCAGCTCCTCCCCTGG + Intronic
1145263348 17:21367606-21367628 GCAGAGCCCAGCTCAGCCCCAGG - Intergenic
1146359041 17:32159387-32159409 TCAGGGCCCAGCTCCACCTCGGG - Intronic
1147150373 17:38510568-38510590 CGGGAGGCCAGCGCCGCCGCCGG - Exonic
1147232213 17:39027570-39027592 CCAGATGTCAGCTCCGCCTCAGG + Intergenic
1147743779 17:42683082-42683104 CCAGAGCCCAGCCCCAGCCCCGG - Intronic
1148832134 17:50440547-50440569 TCAGAGCCCAGCTCTGCCTGTGG + Intronic
1149439169 17:56661051-56661073 CCAGAGCCCCGCTCAGCCACTGG - Intergenic
1149685427 17:58532012-58532034 TCGGCGCGCAGCTCCGCCGCGGG - Intronic
1150520880 17:65865895-65865917 CCTGGGCCCAGCTCCGCCTCAGG - Intronic
1151772847 17:76176741-76176763 CCAAGGCCCAGCTCCGCCTCGGG - Intronic
1152230353 17:79111232-79111254 GCAGAGCCCAGGTCCCCAGCAGG + Intronic
1152414102 17:80147663-80147685 CCGGAGCCCAGCGCCGCGCCGGG - Intergenic
1152625854 17:81387606-81387628 CCCGCGCCCGGCCCCGCCGCGGG + Intergenic
1152776113 17:82203049-82203071 CCAGGCCCCAGCTCCCCCGTTGG - Intronic
1152861254 17:82698112-82698134 CCAGCGCCCGGCCCAGCCGCGGG + Intronic
1153201905 18:2655732-2655754 CCCGCGACCAGCGCCGCCGCCGG - Exonic
1156463993 18:37337150-37337172 CCAGACCCCAGGGCCACCGCAGG - Intronic
1157616168 18:48988979-48989001 GCAGAGCCGAGCTCCTCCGCTGG + Intergenic
1158836325 18:61334363-61334385 CCACAGCCGAGCTCCGGCGGGGG - Intronic
1160448866 18:78948338-78948360 GCAGACCCCAGCTCCTCCTCAGG - Intergenic
1160536875 18:79599216-79599238 CCAGAGCCCAGAGCAGCCCCTGG + Intergenic
1160970859 19:1767207-1767229 CCAGAGCCCAGCTCCTCTCAGGG + Intronic
1160986927 19:1843341-1843363 CCAGGGCCCAGAGCCGCAGCTGG + Intronic
1161127656 19:2567677-2567699 CCAGCACTCAGCTCTGCCGCTGG - Intronic
1162903400 19:13808841-13808863 CCAGACCCCACCGCCGGCGCAGG + Exonic
1163838787 19:19593007-19593029 CCAGAGCCCTGCACAGCCTCGGG - Intronic
1164593097 19:29516913-29516935 CCAGAGCACAGCTCCTGCCCTGG + Intergenic
1165123781 19:33580109-33580131 CCAGAGCCCGGTCCCGCCTCCGG - Intergenic
1165943078 19:39424994-39425016 CCAGAGCCTGGCTCGGCGGCAGG + Exonic
1167528788 19:50001971-50001993 CCAGAGCCCAGCACGGACCCTGG + Intronic
1167597531 19:50435425-50435447 GCAGAGCCCAGCCCCTCGGCTGG + Intronic
1167662516 19:50804291-50804313 CAAGGGGCGAGCTCCGCCGCGGG + Intronic
1168137256 19:54360021-54360043 ACAGAGCCCGGCTCCTCAGCTGG - Exonic
1168160821 19:54509064-54509086 ACAGAGCCCGGCTCCTCAGCTGG + Exonic
925058290 2:872025-872047 CCAGGGCCCAGCTCCCCTCCTGG + Intergenic
925343739 2:3154903-3154925 GCAGAGCCCAGCACCGCTGCAGG + Intergenic
925546714 2:5024555-5024577 CCAGAGACCAGCTGGGCCCCGGG + Intergenic
926098081 2:10095569-10095591 CCAGAGCCCAGCTGGACGGCTGG + Intergenic
926217049 2:10912214-10912236 CCAGCCCCGAGCCCCGCCGCCGG + Exonic
926625186 2:15085135-15085157 CCCGGGCCCAGCTCTGCCTCGGG - Intergenic
926784610 2:16507808-16507830 CCAGAGCCTGGCGCCGCTGCTGG + Intergenic
926808433 2:16734809-16734831 CCAGTGCCCAGCTCAGCACCTGG - Intergenic
928087649 2:28355906-28355928 CCAGAGCCCAGTTCCATCCCCGG - Intergenic
928186650 2:29115959-29115981 CCAGAGCCCAGCTCCGCCGCCGG - Intronic
929188731 2:39120789-39120811 CCAGCCGCCAGCTCCGCCGCGGG - Intronic
931052356 2:58428603-58428625 GCGGAGCCCAGCTGCGCCGGGGG - Intergenic
932128820 2:69169154-69169176 CCAGAGCCCGGCTCCCCGACTGG + Intronic
934557247 2:95293991-95294013 CCAGAGCGCAGCTCAGCCAGAGG + Intergenic
937098232 2:119249425-119249447 CCAGTGCCCAGCCCCGGGGCTGG + Intronic
937221251 2:120344407-120344429 CCAGAGGCAGGCTCCGCCGGCGG - Intergenic
937360725 2:121228033-121228055 CCAGGGGCCGGCTCCGCGGCTGG + Intronic
938211318 2:129467582-129467604 ACAGAGCCCCGCTGCGCCCCAGG - Intergenic
938688895 2:133768439-133768461 CCAGAGGCCAGGTTCCCCGCAGG - Intergenic
940962450 2:159800432-159800454 CCAGAGCCCAGCTCCTCTGCTGG + Intronic
941917777 2:170823499-170823521 CGAAAGCCCAGCCCTGCCGCCGG + Intronic
942167091 2:173252651-173252673 CCAGTGCCCACCTCCGCTCCTGG + Intronic
942505574 2:176638048-176638070 CCAGAGTTTAGCACCGCCGCGGG + Intergenic
945188844 2:207166252-207166274 CCAGGGCCAAGCCCCGCCCCAGG - Intronic
945699389 2:213151655-213151677 CCCGAGCACATCTCCCCCGCCGG + Intronic
948335152 2:237201713-237201735 CCAGAGCCCAGCTGCCTCACTGG - Intergenic
948385550 2:237578494-237578516 CCAGAGCCCAGCTGCATCGCTGG - Intronic
948703299 2:239774239-239774261 TCACAGCCCAGCTCTGCTGCAGG - Intronic
948712869 2:239836194-239836216 CCTGGGCCCAGCTCCACCTCGGG - Intergenic
948845247 2:240680002-240680024 CCAGAGCCAGACTCCGCCGAGGG - Intronic
948848613 2:240694877-240694899 CCAGAGCCAGACTCCGCCGAGGG + Intronic
949070004 2:242018717-242018739 CCTGAGCCCAGCCACGCCACGGG + Intergenic
1169191367 20:3660808-3660830 CCAGCGCCCAGCGCCCCCGACGG - Exonic
1170906042 20:20515940-20515962 GCAGAACCCAGATCTGCCGCAGG - Intronic
1170981787 20:21221014-21221036 CCTGAGCCCAGCTGGGCTGCTGG + Intronic
1172841749 20:37906138-37906160 TCTGAGCCCAGCCCGGCCGCCGG + Intronic
1174351415 20:49970957-49970979 CCAGAGCCCAGCTCTACGCCTGG - Intergenic
1174665965 20:52258114-52258136 CCAGACCCCACCTCCAACGCTGG - Intergenic
1175957288 20:62617921-62617943 CCAGAGCCCAGCTGAGGCGCTGG + Intergenic
1175957490 20:62618799-62618821 CCAGAGCCCAGCCCCTCCCCGGG + Intergenic
1175982358 20:62745101-62745123 CCAGAGCCCAGCTACCCAGCCGG + Intronic
1176177756 20:63736724-63736746 CCAGACCCCAGCTGCCCCCCAGG - Intronic
1178589707 21:33899023-33899045 CCAGAGCTCATCTCCTCTGCTGG - Exonic
1180559131 22:16601687-16601709 CCGACGCCCAGCGCCGCCGCTGG + Intergenic
1180699720 22:17774566-17774588 CCACAGCCCCGCGCCGGCGCGGG - Intronic
1180961619 22:19764909-19764931 CCTCAGCCCAGCCCCACCGCTGG + Intronic
1181049300 22:20231162-20231184 TCAGAGCCCAGCTCAGCACCCGG + Intergenic
1181403825 22:22667953-22667975 GCAGAGCCCAGCTCAGCCCATGG + Intergenic
1181408813 22:22703934-22703956 ACAGGGCCCAGCTCAGCCCCAGG + Intergenic
1182442545 22:30372711-30372733 CCAGAGCACAGCTATGCCCCGGG - Intronic
1182503796 22:30767715-30767737 ACAGAGCCCAGCTTGGCTGCTGG - Intronic
1183715664 22:39532254-39532276 CCAGGGCCCCGCTCCGCGCCTGG + Intronic
1184235898 22:43182884-43182906 CCTGGGCCCTGCACCGCCGCTGG - Intronic
1184604314 22:45563417-45563439 CCAGTGCCCAGCTCACCCCCGGG - Intronic
1184664263 22:45978966-45978988 CAAGCGCCCAGACCCGCCGCAGG - Intergenic
1185277244 22:49955079-49955101 GCCGAGCCCAGCTCCCCCGTGGG - Intergenic
1185376691 22:50485914-50485936 CAAGACGCCAGCTCTGCCGCGGG + Exonic
951039000 3:17967439-17967461 CCTGAGCCCAGCTCTGCAGACGG - Intronic
953125556 3:40088685-40088707 CCAGAGCCCATCTCTGTGGCTGG + Intronic
953766333 3:45746568-45746590 CCCGGGCCCAGCTCCGCCTGTGG - Intergenic
953796427 3:45989502-45989524 CCAGAGGCCAGCTCAGAGGCAGG + Intronic
954783623 3:53077707-53077729 CCACAGACAAGCTCAGCCGCTGG - Exonic
954869081 3:53753449-53753471 CCACAGCCCAGCACCCTCGCTGG - Intronic
956718486 3:72098697-72098719 CCTGAGACCAGCTCTGCCACAGG + Intergenic
964473368 3:157077186-157077208 CCAGAGAGCAGCTCCCCCTCAGG + Intergenic
965486723 3:169287040-169287062 CCAAACCCCAGCTCGGCAGCTGG + Intronic
966919333 3:184601931-184601953 CCGGGGGCCGGCTCCGCCGCCGG + Intronic
967511914 3:190322382-190322404 CCAGACTCCAGCGCCGCCCCGGG - Exonic
967677396 3:192316699-192316721 TCAGAGCCCAGCCCAGCAGCAGG - Intronic
967951795 3:194847054-194847076 CCAGAGCACAGCCCCGCTGAGGG + Intergenic
968133665 3:196207572-196207594 CCCGAGCCCCGCCCCGCCCCCGG + Intronic
968133688 3:196207622-196207644 CCCGAGCCCCGCCCCGCCCCTGG + Intronic
968133712 3:196207669-196207691 CCCGAGCCCCGCCCCGCCCCCGG + Intronic
968133735 3:196207719-196207741 CCCGAGCCCCGCCCCGCCCCTGG + Intronic
968552883 4:1233048-1233070 CCAGTGCCCAGCTGAGCCTCGGG - Intronic
968610011 4:1552633-1552655 TCAAAGCCCAGCTCAGCCACCGG + Intergenic
968914146 4:3489803-3489825 CCACAGCCCAGGTCAGCCCCCGG - Intronic
969049979 4:4365874-4365896 TCAGAGCCCAGCTCTGCTGTAGG - Intronic
969403158 4:6970648-6970670 CCTGACCCCAGCTCAGCCACAGG - Intronic
969403171 4:6970711-6970733 CCTGACCCCAGCTCAGCCACGGG - Intronic
969403185 4:6970774-6970796 CCTGACCCCAGCTCAGCCACGGG - Intronic
970415956 4:15857127-15857149 ACAGATCCCAGCTCTGCAGCTGG + Intergenic
973573743 4:52265448-52265470 TCTCAGCCCAGCTCCGCTGCTGG - Intergenic
973633160 4:52838395-52838417 CCACAGCCCAGCTCCACGACAGG - Intergenic
974804410 4:66860399-66860421 CCAGAGCCCTGCCCCGCGGGAGG - Intergenic
978118136 4:105047145-105047167 CCTGAGGCCAGCTCCTCTGCAGG + Intergenic
978761328 4:112358248-112358270 CCAGAGCCCAGCTGCCCTCCTGG + Intronic
979547265 4:121951938-121951960 CCAGAGCCCCGCTCGGCCCCGGG - Intergenic
983000556 4:162409052-162409074 CCTGGGCCCAGCTCCACCTCAGG + Intergenic
984690348 4:182719060-182719082 CCAGTGGCCAGCTCCCCCGTGGG + Intronic
985730362 5:1544031-1544053 CCAAAGCCCATCTCCTCCTCAGG + Intergenic
985930841 5:3056488-3056510 CGAGAGCCCCTCCCCGCCGCCGG - Intergenic
988577806 5:32444112-32444134 CCAGAGCCCCGGCCCGCTGCAGG - Intronic
991460662 5:66855115-66855137 CCAGGGCCCACCTCCAACGCTGG - Intronic
992104138 5:73436604-73436626 CCAGAGCCCAGCCCCAGCGCGGG - Intergenic
992403442 5:76432663-76432685 CCAGAGCACAGCTCAGTCCCTGG - Intronic
1003869670 6:10391433-10391455 CCAGAGCTGAGCTCTGGCGCTGG + Intergenic
1004486246 6:16069330-16069352 CCCGAGCCCTGCCCCGCCGGAGG + Intergenic
1006447946 6:34090449-34090471 CCAGAGCCCAGCCCCTCCCTTGG - Intronic
1007227323 6:40324368-40324390 GCAGAGCCCAGCTCCCCAGGGGG + Intergenic
1007584254 6:42979041-42979063 ACCAGGCCCAGCTCCGCCGCCGG + Exonic
1011112603 6:83854226-83854248 GCGCAGCCCAGCTCCGCAGCTGG + Intronic
1011195065 6:84772956-84772978 CGAGAGCGGGGCTCCGCCGCGGG + Intergenic
1011798424 6:90982872-90982894 CCCAAGCCCAGCTCCACAGCGGG + Intergenic
1012052554 6:94362351-94362373 CCTGGGCCCAGCTCCGCCTCGGG + Intergenic
1012218843 6:96623274-96623296 TCAGATCCCAGCTCTGCCACGGG + Intergenic
1016454337 6:144215639-144215661 CCAGATCCCAGCTCAGCCACAGG + Intergenic
1018683044 6:166280726-166280748 CCAGACCCAAGCTCCGCTGCCGG + Intergenic
1019177371 6:170166970-170166992 CCAGATTCCAGCTCTGCCCCAGG - Intergenic
1019639539 7:2096088-2096110 CCAGAGGCCACCTTGGCCGCCGG - Intronic
1019983933 7:4641748-4641770 ACAGAGCCCGGCCCCGCCCCGGG + Intergenic
1020035879 7:4962839-4962861 CCAGAGCCCAGCTGGGCTCCAGG - Intergenic
1020181005 7:5922473-5922495 CCTGAGCACAGCCCCGCCCCTGG - Intronic
1020301928 7:6802415-6802437 CCTGAGCACAGCCCCGCCCCTGG + Intronic
1021615378 7:22498296-22498318 CCAGACCCCAGCTCCCGCACTGG + Intronic
1024562148 7:50653655-50653677 CCAGAGACCACTTCAGCCGCTGG + Intronic
1026472751 7:70708252-70708274 CGAAAACCCAGCTCCTCCGCAGG + Intronic
1026611640 7:71865168-71865190 CCAGACCCCACCTCCGACACTGG - Intronic
1027224445 7:76235133-76235155 CCGCAGCCCAGCTCCTCCTCGGG + Exonic
1028377119 7:90156336-90156358 CCAGACCCCAGCTCCCTCACTGG - Intronic
1028397915 7:90392696-90392718 CCAGAGCCCACCTCCGACATTGG - Intronic
1029424440 7:100487204-100487226 CCAGCTCCCAGCTCCACCCCAGG - Intronic
1029519156 7:101049165-101049187 CCAGAGACCTGCTCCACCCCAGG - Intronic
1030290074 7:107863604-107863626 CCAGAGCCTAGCACCGTCCCTGG - Intergenic
1031919696 7:127591553-127591575 CCAGATCCCTGCTCCTCCTCTGG - Exonic
1032496747 7:132368504-132368526 CCACAGCCCACCTCCTCCTCTGG - Intronic
1032858855 7:135858997-135859019 CCCGGGCCCAGCTCTGCCTCGGG + Intergenic
1033639872 7:143252114-143252136 CCAGACCCCACCTCCGACACTGG - Intronic
1034618189 7:152436318-152436340 CCGGCGCCCAGCGCCGCCACTGG - Intergenic
1035167454 7:157000074-157000096 CCCGCGCCCCGCTCCGCCCCCGG - Intronic
1035212336 7:157337345-157337367 CCAGACCCCAGCCCCGGCCCCGG - Intronic
1035719862 8:1783885-1783907 GAAGAGCCCAGCTCTGGCGCCGG - Exonic
1036765478 8:11547112-11547134 ACAGAGCCCAGCTCTGTCCCAGG + Intronic
1037927067 8:22851929-22851951 CCAGCGCCCAGCTGAGCCACGGG + Intronic
1038442959 8:27584487-27584509 CCAGTGCCCAGCCCCTCCTCTGG - Intergenic
1038959414 8:32502377-32502399 CCAGAGCCCACCTCCAACACTGG + Intronic
1042235912 8:66613155-66613177 CCCCAGCCCGGCTCCGCCACAGG + Exonic
1045459437 8:102412908-102412930 CCCGAGCCCAGCCCCGCCGGGGG + Intergenic
1045782751 8:105886807-105886829 CCAGAGCCCATATCAGCGGCTGG + Intergenic
1049018163 8:139936174-139936196 CCAGAGCCCAGGAGCGCCACAGG + Intronic
1049349398 8:142156143-142156165 CCAAACCCCAGAACCGCCGCAGG + Intergenic
1049463841 8:142742153-142742175 CCAGAGCCCAGCTTCACCCTGGG - Intronic
1049517315 8:143067602-143067624 TCAGAGACCAGCGCCGACGCGGG - Intergenic
1049556218 8:143283536-143283558 GCAGGGCCCAGCTCGGCCTCTGG + Intergenic
1049586528 8:143434982-143435004 CCAGAGCACAGCTGCGCAGGAGG + Intergenic
1049748140 8:144271654-144271676 CCAGGGCCCAGCACCCCTGCTGG - Intronic
1056200700 9:84273243-84273265 CAAGAGCCCAGCTCTGGAGCTGG - Intergenic
1057478669 9:95426860-95426882 TCTGAGCCCCGCCCCGCCGCGGG - Intergenic
1057694370 9:97312787-97312809 CCAGATCCCTGCTCAGCTGCTGG + Intronic
1057857025 9:98609717-98609739 CTGGAGCCCAGCTCTGCCCCAGG - Intronic
1059400952 9:114070588-114070610 CCTGGGCCCAGCTCTGCCTCAGG - Intronic
1059425502 9:114218427-114218449 GCAGAGCCCAGGTCCACCTCTGG - Intronic
1059452786 9:114381255-114381277 CCCAGGCCCAGCGCCGCCGCTGG + Exonic
1061370706 9:130195935-130195957 CCAGAGCCCAGACCCACCGAGGG + Intronic
1061790598 9:133057056-133057078 CCAGAGCCCAGCCCAGGTGCTGG + Intronic
1062466660 9:136684618-136684640 CCAGAGCTCAGGCCTGCCGCAGG + Intronic
1062732893 9:138119484-138119506 CCACAGCCCAGGTCGGCCGAGGG - Intronic
1185431452 X:13948-13970 CCAGACCCCCGCTCCTCCCCTGG + Intergenic
1188004392 X:25007214-25007236 CCCGAGCCTACCTCCGCCTCCGG - Exonic
1189002789 X:36963739-36963761 CCCGGCCCCACCTCCGCCGCGGG + Intergenic
1189093474 X:38112723-38112745 ACAGAGCCCAGCTCAGCCTGGGG - Intronic
1190959255 X:55228951-55228973 CCAGGGCCCACCTCCAACGCTGG - Intronic
1191770184 X:64747159-64747181 CCAGAGCCCACCTCCAACTCTGG + Intergenic
1195654743 X:107323897-107323919 CCTGGGCCCAGCTCCGCCTCGGG - Intergenic
1200054928 X:153455360-153455382 CCAGAGCCCTGCCACGCCACTGG + Intronic
1200138703 X:153886770-153886792 CCAGAGCCCAGGTGGGCGGCAGG + Intronic