ID: 928186654

View in Genome Browser
Species Human (GRCh38)
Location 2:29115983-29116005
Sequence GCAGCCGCGGCTGGCGGTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928186654_928186661 3 Left 928186654 2:29115983-29116005 CCACGACCGCCAGCCGCGGCTGC 0: 1
1: 0
2: 0
3: 10
4: 214
Right 928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
928186654_928186665 16 Left 928186654 2:29115983-29116005 CCACGACCGCCAGCCGCGGCTGC 0: 1
1: 0
2: 0
3: 10
4: 214
Right 928186665 2:29116022-29116044 CGCGCAGTGGCTTTCCAACGCGG 0: 1
1: 0
2: 0
3: 2
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928186654 Original CRISPR GCAGCCGCGGCTGGCGGTCG TGG (reversed) Intronic
900210674 1:1454353-1454375 GCTGACGCTGCTGGCTGTCGGGG + Exonic
900216547 1:1485024-1485046 GCTGACGCTGCTGGCTGTCGGGG + Exonic
900488304 1:2933933-2933955 GCAGGCGCGGCTGGGAGCCGGGG - Intergenic
900571065 1:3358474-3358496 GAAGCCGCGGCTGGGAGTCTGGG - Intronic
900661075 1:3784042-3784064 GCAGCTGCAGCTGGAGGCCGAGG - Exonic
901060672 1:6470562-6470584 GCGGCAGCGGCTGGCGGCCGTGG - Exonic
901420904 1:9150429-9150451 GCAGCAGAGGCTGGGGGTGGGGG + Intergenic
901602148 1:10430672-10430694 GCAGCCGCGGGGGGCGCCCGGGG - Intronic
901923100 1:12549690-12549712 GGAGACGCGGCTGGGGGTGGCGG + Intergenic
903213462 1:21830952-21830974 GCGACAGCGACTGGCGGTCGGGG + Intronic
903925136 1:26826631-26826653 GAGGCCGCGGCGGGCGGTGGCGG + Intergenic
906128575 1:43442429-43442451 GCAGCTGTAGCTGGAGGTCGGGG - Exonic
906640842 1:47439438-47439460 GCTGCCGCGAATGGCGGTCCCGG - Exonic
908089422 1:60670656-60670678 GCAGCTGGGGCTGGCGGGAGGGG + Intergenic
910758878 1:90716898-90716920 GCAGCCGCCGCCGCCGGCCGCGG - Exonic
912800801 1:112718844-112718866 GCAGCGGCCCCTGGCGGCCGAGG - Intergenic
913544396 1:119853260-119853282 GCCGCCTGGGCTGGCGGGCGGGG - Intergenic
915552353 1:156642437-156642459 GCAGCAGCTGCAGGCGCTCGGGG - Intronic
917817436 1:178725253-178725275 GCCGCCGCCGCTGCCGCTCGGGG - Exonic
918265679 1:182839557-182839579 GCGGCGGCGGCTGGGGGTGGGGG + Intronic
919854203 1:201694529-201694551 GCAGCCAGGGCTGGTGGTCCTGG - Intronic
922526769 1:226309674-226309696 GCTGCTGCGGCCGGCGGTCTCGG - Exonic
922527747 1:226318693-226318715 GCAGCCAAGGCTGGTGGTAGAGG + Intergenic
923056100 1:230426490-230426512 GCGGCCGGGGCTGGCGGTTAGGG + Intergenic
923506195 1:234608817-234608839 GGAGCCCAGGCTGGCGGCCGCGG + Exonic
924582050 1:245331081-245331103 GCAGCCGCGGCAGGGGGCGGTGG + Intronic
1062860292 10:805162-805184 GGAGGGGCGGCTGGAGGTCGAGG + Intergenic
1063391542 10:5652868-5652890 GCAGCTGCTGCTGGCGGCTGGGG - Exonic
1064008816 10:11718920-11718942 GCAGCCGCGGCTGGGCGCAGTGG - Intergenic
1066126327 10:32346585-32346607 GCCGCGGCGGCCGGGGGTCGAGG + Intronic
1067369776 10:45672589-45672611 GCTGCCGCCGCCGGCCGTCGTGG - Intronic
1067836338 10:49643982-49644004 GCAGCAGGGGCTGGTGGTCAGGG + Intronic
1069895081 10:71675485-71675507 GTAACTGCGGCTGGCGGTGGTGG - Intronic
1070156620 10:73839498-73839520 GGGGCCGAGGCAGGCGGTCGGGG + Intronic
1073073960 10:100811863-100811885 GCAGCCGCAGCTGTCAGTCCTGG - Intronic
1073251127 10:102120798-102120820 GGAGCCGCGGCTGGGGGAGGCGG + Intergenic
1073479808 10:103779389-103779411 GCAGCCGGGGCTGGCACACGGGG - Intronic
1074772366 10:116742385-116742407 GCGGCCGCGGCTGGCGGGGCAGG - Intronic
1074801440 10:117004971-117004993 GCAGCCGCGGCCCGTGGGCGGGG - Intronic
1076864524 10:133160341-133160363 GCGGCAGCGGCGGGCGGGCGGGG + Intergenic
1077124381 11:925983-926005 GCGGCCTCGGCTGGCGGACCCGG - Exonic
1077183198 11:1225464-1225486 GCATCTGCGGCTGACGGTTGGGG + Intronic
1077377208 11:2210678-2210700 GCAGCCTCGGCTGGCAGTGCAGG - Intergenic
1077476211 11:2791689-2791711 GCAGCTGCGGGTGGGGGTGGGGG + Intronic
1078987056 11:16607060-16607082 GGAGCCGCGGCTGCCGGGCCGGG - Intronic
1079882441 11:25944302-25944324 GCAGCTGCAGCTGGAGGGCGGGG - Intergenic
1080503808 11:32893265-32893287 GCAGCTGCTGCTGGCGGCGGCGG - Exonic
1081808483 11:45902524-45902546 GCTGCCCCGCCTGGGGGTCGGGG + Exonic
1083560810 11:63671592-63671614 GCACACGCGGCAGGCGGTGGCGG - Exonic
1083904908 11:65663043-65663065 ACAGCCGCTGCCGGGGGTCGGGG + Exonic
1084369967 11:68734849-68734871 GCAGTCTTGGCTGGCTGTCGGGG + Intronic
1092385350 12:8032641-8032663 GCGGCAGCGGCCGGCGGGCGGGG + Intergenic
1092861484 12:12723910-12723932 ACTGCCGCGGCGGGCGGGCGCGG - Intergenic
1094565011 12:31591125-31591147 GCCGCCGCGTCTGGCGCCCGCGG + Intergenic
1095958668 12:47820151-47820173 GGAGCCGCGGCCGGCGTTCCGGG - Intronic
1096192640 12:49630563-49630585 GCAGGCGCTGCTGGGGGCCGGGG - Exonic
1096396554 12:51270382-51270404 GAAGCCGCGGGTGGCGCGCGGGG + Exonic
1097990257 12:65825586-65825608 GGAGCCGCGGCGGGCGGCCCGGG + Intronic
1102544621 12:113645681-113645703 GCAGCCCCGGGTGGGGGACGTGG + Intergenic
1103120069 12:118372789-118372811 GCAGCCTCTGCTCGCGGTCTCGG + Exonic
1103309126 12:119990045-119990067 GCTGGCGCTGCTGGCGGCCGGGG + Exonic
1103563404 12:121804105-121804127 GCCGCCGCGGCTGCCGGGCCCGG - Intergenic
1104692744 12:130839040-130839062 GCAGCCGCGGGTAGCGGTTCAGG - Intronic
1113969322 13:114176735-114176757 GCAGCCGTGGGTGGCAGCCGTGG + Intergenic
1113969497 13:114177506-114177528 GCAGCCGTGGGTGGCAGCCGTGG + Intergenic
1118320418 14:64749284-64749306 GCAGGTGGGGCTGGCGGGCGCGG - Exonic
1121042215 14:90758573-90758595 GCAGCCGCCGCCAGGGGTCGCGG - Intronic
1121796685 14:96741696-96741718 GCAGCAGAGGCTGGGGGGCGAGG + Intergenic
1122599739 14:102915344-102915366 GGAGCCGCTGCTGGCAGTCAGGG - Intergenic
1126113379 15:45187980-45188002 GCAGCGGCGGGTGGGGGGCGGGG + Intronic
1129082502 15:73052767-73052789 GGAGCCGCTCCTGGCGGCCGCGG - Exonic
1130301165 15:82680608-82680630 GCAGCAGCAGCCGGTGGTCGGGG + Exonic
1131367605 15:91853537-91853559 GCAGGCGCGGCCGGCGGGCAAGG + Intergenic
1132612495 16:824347-824369 CCACCCGCTGCTGGCCGTCGTGG - Intergenic
1132933246 16:2469158-2469180 GCAGCAGCGGCGGGAGGCCGTGG - Intergenic
1133222535 16:4324969-4324991 GCAGCAGGGGCTGGCGGGCAGGG - Intronic
1133325027 16:4937065-4937087 GCGGCGGCGGCTGGCGGGCCGGG + Exonic
1134696984 16:16232530-16232552 GCGGCGGCGGCTGGCGGCGGCGG + Exonic
1136572680 16:31106043-31106065 GCAGCCACGGCTGGAGCCCGTGG - Intergenic
1136591248 16:31219082-31219104 GCAGCTGTGTCTGGGGGTCGAGG - Exonic
1138328086 16:56191801-56191823 GCTGCCGCGGCTGCCGGAGGAGG - Intronic
1141675985 16:85517633-85517655 GCTGCCGGGGCTGGAGGTGGTGG - Intergenic
1141875269 16:86819819-86819841 GCATCCCCGGCTGGGGGTGGGGG - Intergenic
1142117925 16:88369811-88369833 GAAGCTGGGGCTGGGGGTCGCGG - Intergenic
1142126067 16:88411342-88411364 GCAGCCCCGGCGGGTGGTCCAGG + Intergenic
1142246117 16:88970830-88970852 GCAGCCGACGCTGGGGGCCGGGG + Intronic
1142388866 16:89784990-89785012 GCAGCCGCGCCTGGCTGTCCTGG - Intronic
1142388876 16:89785055-89785077 GCAGCTGCGCCTGGCTGTCCTGG - Intronic
1142418749 16:89957537-89957559 GCAGCTGCGGCAGGCGATCGAGG + Exonic
1142811793 17:2399013-2399035 GCCGCCGCGGCGGGCGGGGGTGG - Intronic
1142962184 17:3557860-3557882 GCAGCTGTGGCTGGTGGGCGTGG - Intronic
1143036624 17:4003341-4003363 GCAGCCGTGGCTGGGGGCCGGGG + Intergenic
1143174494 17:4948452-4948474 GCTGCCTCGGCTGGCGGGCGGGG + Exonic
1143480389 17:7224655-7224677 GCTGCAGCGGCTGGCAGACGGGG + Exonic
1143587214 17:7856309-7856331 GGAGCAGCGGCAGGCGGCCGAGG - Intergenic
1144952954 17:19003933-19003955 GGAGCAGCGGCTGGCGCTGGAGG - Exonic
1145941139 17:28744000-28744022 GCGGCGCCGACTGGCGGTCGCGG - Exonic
1145978049 17:28995746-28995768 GCAGCTGCAGCTGGTGGTGGTGG + Intronic
1146062015 17:29612646-29612668 GCAGCCGCGGCAGGAGGCTGGGG - Exonic
1146955825 17:36935966-36935988 CCAGCGGCGGCTGGGGGTGGTGG - Intergenic
1147943501 17:44066597-44066619 GCAGCCGCGGCCGGCGGCGGCGG + Exonic
1148122661 17:45222008-45222030 GGGGCAGCGGCTGGCGGTGGCGG - Exonic
1151570473 17:74923185-74923207 GCAGCGGGGGCTGGCGGCCCCGG - Exonic
1151854290 17:76710497-76710519 GCAGCCTGGGCTGGAGGCCGCGG + Intronic
1152234459 17:79131416-79131438 GCAGCCGCGTCTGTGGGTGGAGG - Intronic
1152406658 17:80101730-80101752 GGGGCCGCGGGTGGAGGTCGGGG + Intergenic
1152824976 17:82458887-82458909 GCGGCCGAGGTTGGCGGTCCGGG + Intronic
1156008448 18:32470494-32470516 GCCGCCGCTGCTCGCGCTCGCGG + Intergenic
1157464291 18:47930764-47930786 GCCGCGGCGGCCGGCGGCCGAGG - Intronic
1157609992 18:48950180-48950202 GCGCCCGCGGCTGGCGGGTGGGG + Exonic
1160540232 18:79617155-79617177 GCGGCCGGGGCTGCCGGCCGCGG - Intergenic
1161264792 19:3359342-3359364 GCGGCGGCGGCTGCAGGTCGCGG - Intergenic
1161793795 19:6375332-6375354 GCAGCCGCTGCCAGCGGTGGCGG + Exonic
1161959530 19:7516153-7516175 GCCGGCGGGGCTGGCGGGCGGGG + Exonic
1162299308 19:9835272-9835294 GCAGCGGCGGCGGGCGGGCGCGG + Intronic
1162373244 19:10291103-10291125 GCAGCCTCGCGTGGCGTTCGTGG + Exonic
1163023512 19:14496139-14496161 GCAGCGGCGCCTGGGGGGCGGGG + Intronic
1163503205 19:17688152-17688174 GGAGGCGAGGCTGGGGGTCGGGG - Intronic
1164191878 19:22925394-22925416 GCAGCTGCTGCGGTCGGTCGCGG - Intergenic
1166261397 19:41644073-41644095 GCAGCGGCTGCGGTCGGTCGCGG - Intronic
1167466221 19:49652176-49652198 GCAGCCGCAGGTCGCGGTCCCGG + Exonic
1167579563 19:50333482-50333504 GCAGCCACAGGTGGCAGTCGGGG - Intronic
1167591883 19:50408751-50408773 GCAGCCGCGGCCGGGAGTCAGGG - Intronic
1168336453 19:55600142-55600164 GCAGGCGCGGCTTCCGGGCGTGG + Intronic
925607455 2:5673442-5673464 GCGGCCGCGCCTGGCGGAGGTGG - Intergenic
926161929 2:10495401-10495423 TCAGCCGCTGCTGGCGGGTGTGG - Intergenic
926241821 2:11094469-11094491 GCAGCCCAGGTTGGCGGGCGGGG + Intergenic
926332747 2:11838610-11838632 GCAGCCAAGGCTGGCTGACGGGG - Intergenic
927809225 2:26172788-26172810 GCAGCGGCGGGTGGGGGCCGGGG + Intergenic
928022451 2:27715493-27715515 GCAGGCGCGGCCGGAGGGCGCGG + Intronic
928186654 2:29115983-29116005 GCAGCCGCGGCTGGCGGTCGTGG - Intronic
928998770 2:37324923-37324945 GTGGCCGCGGCGGGAGGTCGGGG + Intergenic
929775386 2:44928354-44928376 GGAGCGGCGGCCGGGGGTCGGGG - Intergenic
938708357 2:133953660-133953682 GGAGGCGTGGCTGGCGGTAGGGG - Intergenic
939900620 2:147845254-147845276 GCGGCCGCTGCTGGGGGCCGCGG + Intronic
940429895 2:153576609-153576631 GCAGCCCCTGCTGGGGGTTGGGG + Intergenic
946692438 2:222319564-222319586 GCAGCGGCGGGAGGCGGTCCTGG + Intergenic
947568743 2:231214218-231214240 GCAGCTGCAGCTGGCAGGCGTGG + Intronic
1168786443 20:543791-543813 GCAGCCGCTGCTGCCGGAAGCGG + Exonic
1169673758 20:8132345-8132367 TCAGCCGAGGCTGCCAGTCGCGG - Intronic
1172654370 20:36528007-36528029 GCCGCCGCCGCTGGCTCTCGGGG + Exonic
1175282262 20:57811801-57811823 GCAGCCGAGGCTGGAGGCAGAGG + Intergenic
1175925299 20:62468495-62468517 GCAGCTGTGGCTGGGGGTTGAGG - Intronic
1176039444 20:63056557-63056579 ACAGCGGCTCCTGGCGGTCGAGG - Intergenic
1180110258 21:45644024-45644046 GCAGGCGCCGGCGGCGGTCGGGG - Intronic
1180190699 21:46161209-46161231 GCAGCGGCGGGCTGCGGTCGGGG + Exonic
1181283533 22:21736169-21736191 GCCGGCGGGGCTGGCGGTGGTGG + Intergenic
1182116112 22:27757435-27757457 GCTGCCGAGGCTGGGGGTCAGGG + Intronic
1184046737 22:41976795-41976817 GCGGCGGCGGCTGGCGGCGGCGG + Exonic
1184160358 22:42693918-42693940 GCAGCCGCAGCAGGAGGTCGGGG + Exonic
1184723019 22:46326522-46326544 GCAGCGCCGGCTGGCGGGTGTGG - Exonic
1185272319 22:49935161-49935183 GGAGCGGGGGCTGGTGGTCGCGG + Intergenic
1185411335 22:50684500-50684522 GCAGCTGGGGCTGGCTGGCGAGG + Intergenic
1203238348 22_KI270732v1_random:30396-30418 GAAGCCGCGGCCGGCGGCGGGGG - Intergenic
950329320 3:12143985-12144007 GCAGCTGGGGCTGGAGGTGGTGG + Intronic
950829404 3:15859571-15859593 GCGGCGGCGGCGGGCGGCCGGGG - Exonic
951411541 3:22372568-22372590 GCCGCCGGGGCTGGCTGTCCCGG + Intronic
952316769 3:32238681-32238703 GCAGCCGGGGAAGGCGGTGGAGG - Exonic
952905846 3:38138686-38138708 GCAGCCATGGCGGGCGGTCCTGG - Exonic
953816520 3:46162888-46162910 GCAGCAGGGGCTGGGGGTAGGGG - Intergenic
954005620 3:47588216-47588238 GCAGCTGAGGCTGGCGGGCCAGG + Exonic
958949418 3:100400811-100400833 GCAGCTGGCTCTGGCGGTCGGGG - Exonic
962320237 3:134383968-134383990 GGAGGCGGGGCTGGAGGTCGAGG - Intergenic
966919360 3:184602013-184602035 GCAGCCGCGGCTGGCGGCTTCGG + Intronic
968319071 3:197749833-197749855 GCAGCCGCGGGTGGAGACCGAGG + Exonic
971327434 4:25655745-25655767 GCGGCTGCGGCAGGCGGTCCTGG + Intronic
981331399 4:143513989-143514011 GCTCCCGCCGCTGGCGATCGAGG - Exonic
981782207 4:148442730-148442752 GCAGCCGCGGCGGGAGCTTGGGG + Intronic
981998515 4:151001249-151001271 GCAGCCTAGGTCGGCGGTCGGGG - Intronic
982000273 4:151015581-151015603 GCAGCCGCTGCTGGCGCTACGGG + Intronic
982712254 4:158769136-158769158 GCAGCCGGGGGCGGCGGCCGCGG - Exonic
983940160 4:173529182-173529204 GCTGCAGCGGCTGGCGGCGGCGG + Exonic
985844037 5:2330894-2330916 GGAGCCGTGGCTGGCGGCAGCGG - Intergenic
987050587 5:14144170-14144192 GAAGCCGCGGCTGCCGGGAGCGG - Intronic
992460288 5:76953896-76953918 GCAGCCTAGGCTGGAAGTCGGGG + Intronic
999395462 5:151224052-151224074 GCAGCCCCAGCCGGCGGGCGCGG - Exonic
1002061926 5:176630312-176630334 GCGGCTGCGGCGGGCGGACGCGG + Exonic
1002887849 6:1312103-1312125 GCAGCCGCGGCAGGCCAGCGGGG + Intergenic
1002951866 6:1821356-1821378 GGAGCCGCGGCTGGTGGGTGGGG + Intronic
1003942776 6:11044688-11044710 GCAGCAGCGGCTGCCGATCTGGG - Intergenic
1006151709 6:31993440-31993462 GCAGCAGCGCTTGGCTGTCGGGG - Exonic
1006158010 6:32026178-32026200 GCAGCAGCGCTTGGCTGTCGGGG - Exonic
1006313432 6:33277240-33277262 GCAGCTGCGGACCGCGGTCGAGG - Exonic
1007073908 6:39054766-39054788 GCAGCAGCTGCTGGGGGTGGAGG - Intronic
1007390321 6:41546763-41546785 GCAGCCCCGGCGGGCGGCGGCGG + Exonic
1007656816 6:43455563-43455585 GCAGCCGCTGCCGCCGCTCGGGG - Intronic
1010001648 6:70955652-70955674 GCAGCCTCCGCTGGCCGTGGGGG - Intronic
1010212057 6:73369803-73369825 GCAGCCGCGGAGCGCGCTCGAGG + Intronic
1013155877 6:107490558-107490580 GCTGCCGCCGCCGGCGGTGGTGG - Exonic
1015494489 6:133865868-133865890 GCAGGGGCGGCTGGAGGTCCTGG + Intergenic
1017880814 6:158561032-158561054 GCAGCCGCGCCTGGCGCAGGAGG + Intronic
1018613069 6:165662233-165662255 GCAGCGGCGGCGGGCGGCGGCGG - Intronic
1018652901 6:166006140-166006162 GCAGCAGCCGCGGGCGGGCGGGG - Intergenic
1018906457 6:168078881-168078903 GCAACTGCGGCTGGCCGTGGGGG - Exonic
1019316839 7:390853-390875 GCTGCAGGGGCTGGCGGTCCTGG + Intergenic
1019353803 7:568635-568657 GCAGCAGGGGCTGGCCGTGGTGG - Intronic
1024043786 7:45574346-45574368 GCAGGCGCGGCGGGCGGGAGGGG + Intronic
1026734911 7:72943223-72943245 GCTCCCGCTGCTGGCGGTCTGGG - Exonic
1026785244 7:73298138-73298160 GCTCCCGCTGCTGGCGGTCTGGG - Intergenic
1027108830 7:75421786-75421808 GCTCCCGCTGCTGGCGGTCTGGG + Exonic
1028268560 7:88759225-88759247 GCAGCCGCGGGGGGCTCTCGGGG - Intergenic
1029361055 7:100088963-100088985 GGGGCCGAGGCTGGCGGGCGCGG + Exonic
1032021574 7:128409705-128409727 GCATCCGGGGCGGGCGGCCGAGG - Intronic
1033300023 7:140177063-140177085 GCCGCGGCGGCTGGCGGAGGGGG + Intergenic
1033472840 7:141664956-141664978 GCAGCGGCTGCAGGTGGTCGTGG + Exonic
1034622095 7:152464131-152464153 GCGGCCGTGCCTGGCGGGCGGGG - Intergenic
1034911754 7:155003220-155003242 GGAGCCGTGGCTGGCGGCAGAGG - Intergenic
1035605346 8:926681-926703 GCAGCCGTGGGTGGCCGCCGAGG + Intergenic
1037786344 8:21905647-21905669 GCAGCTGAGGCTGGCTGTAGTGG + Intergenic
1039522379 8:38181848-38181870 GCAGCCCAGGCTGGAGTTCGTGG - Intronic
1040355811 8:46617426-46617448 GCAGACGCGGCTTGGGGGCGAGG - Intergenic
1041107895 8:54459314-54459336 GCAGCAGCGGCGGGCCGGCGGGG - Exonic
1049682120 8:143923994-143924016 GCAGCGGCAGCTGGCGGCGGAGG - Exonic
1049719270 8:144108138-144108160 GCAGCCACAGCCGGCGGGCGCGG - Exonic
1050455782 9:5832878-5832900 GCAGCGGCGGCGGGAGGACGCGG - Exonic
1051641883 9:19230987-19231009 GTGGCCGCGGCTGGCGTTCGTGG + Intronic
1054775654 9:69121685-69121707 GCCGCCGCGGCCGGCGGTGTCGG - Intronic
1060052620 9:120388060-120388082 GCAGCCCCGGCTGGGAGTCCGGG - Intergenic
1060825023 9:126683030-126683052 CCAGCCGGGGCTGGAGGTCACGG - Intronic
1061084301 9:128390285-128390307 GGAGCAGCTGCTGGCGGTGGGGG - Exonic
1061726096 9:132582734-132582756 GCAGCGGCGGCTGGGGTTGGGGG + Exonic
1062119683 9:134827611-134827633 GAAGCCGCGGCTGGTGTTCACGG + Intronic
1190732405 X:53234466-53234488 GCAGGCGCGGCTGGGGGCCCTGG - Exonic
1193654996 X:84188006-84188028 GAAGGCGGGGCTGGGGGTCGCGG - Intergenic
1200239463 X:154486252-154486274 GCAGCCGCTGCTGGCGCACTGGG + Exonic