ID: 928186655

View in Genome Browser
Species Human (GRCh38)
Location 2:29115989-29116011
Sequence CTCGGGGCAGCCGCGGCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 608
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 576}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928186655_928186661 -3 Left 928186655 2:29115989-29116011 CCGCCAGCCGCGGCTGCCCCGAG 0: 1
1: 0
2: 0
3: 31
4: 576
Right 928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
928186655_928186665 10 Left 928186655 2:29115989-29116011 CCGCCAGCCGCGGCTGCCCCGAG 0: 1
1: 0
2: 0
3: 31
4: 576
Right 928186665 2:29116022-29116044 CGCGCAGTGGCTTTCCAACGCGG 0: 1
1: 0
2: 0
3: 2
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928186655 Original CRISPR CTCGGGGCAGCCGCGGCTGG CGG (reversed) Intronic
900023373 1:200206-200228 CCCGGAGGAGCCGAGGCTGGCGG - Intergenic
900299440 1:1969512-1969534 CTCCGGGCAGCCAAGGCTGCTGG - Intronic
900461553 1:2804462-2804484 CTCGGGGCTGCTGGTGCTGGTGG - Intergenic
900602730 1:3509955-3509977 CTCGCAGCCGCCACGGCTGGAGG + Exonic
900611741 1:3547172-3547194 CTCGGGTGGGCCGAGGCTGGAGG - Intronic
901005003 1:6167221-6167243 CTCCTGGCAGCGGTGGCTGGTGG + Intronic
901057629 1:6456024-6456046 GTCGGGGGAGGCGCGGCGGGCGG - Intronic
901093466 1:6659514-6659536 CTCTGGGAGGCCGCGGCGGGTGG + Intronic
901220271 1:7579801-7579823 CTTGGGGAAGCCGAGGCTGGTGG - Intronic
901374083 1:8825028-8825050 CTTTGGGCAGCCGAGGCGGGTGG + Intergenic
901920638 1:12534360-12534382 CTTTGGGAAGCCGAGGCTGGCGG - Intergenic
902277423 1:15349869-15349891 CTCGGGGCAGGTGTGTCTGGTGG - Intronic
902807101 1:18868003-18868025 ATCGGGGCAGGCGTCGCTGGAGG - Intronic
903202761 1:21755920-21755942 CTCTGGGAAGCCGAGGCGGGTGG + Intronic
903431018 1:23300087-23300109 CTTTGGGAAGCCGAGGCTGGCGG - Intergenic
904177714 1:28642814-28642836 CTCGGAGAAGACGCGGCTGTGGG - Exonic
905783943 1:40737570-40737592 CTCTGGGAAGCCGAGGCAGGTGG - Intronic
907129235 1:52080775-52080797 CTCTGGGAGGCCGAGGCTGGTGG - Intronic
907426271 1:54381139-54381161 CTCTGGGAGGCCGAGGCTGGTGG + Intronic
907731531 1:57071159-57071181 CTCTGGGCAGAAGAGGCTGGTGG + Intronic
908114816 1:60930237-60930259 CTTTGGGAAGCCGTGGCTGGTGG - Intronic
908224755 1:62044972-62044994 CTCTGGGAGGCCGAGGCTGGCGG + Intronic
908258218 1:62319366-62319388 CGGGGCGAAGCCGCGGCTGGCGG - Exonic
909441117 1:75697541-75697563 CTTTGGGAAGCCGGGGCTGGTGG + Intergenic
910337796 1:86154774-86154796 CTCGGGGCAGGAGCTGCAGGAGG + Intronic
910418875 1:87033785-87033807 CTCTGGGAGGCCGAGGCTGGTGG - Intronic
912489277 1:110052807-110052829 CTCTGGGAGGCCGAGGCTGGTGG - Intronic
912781982 1:112559473-112559495 CTTTGGGAAGCCGAGGCTGGTGG - Intronic
912955571 1:114152688-114152710 CTCCGGGGAGTCGCGGCAGGGGG - Exonic
914479221 1:148049797-148049819 CTCTGGGAAGCCGAGGCGGGCGG + Intergenic
914811425 1:151031428-151031450 CTCTGGGAAGCTGAGGCTGGTGG - Intronic
915197518 1:154200925-154200947 CTCTGGGAAGCCGAGGCAGGTGG - Intronic
915559264 1:156676958-156676980 CCCGGGCCAGCCGCAGCTGCTGG + Exonic
915561484 1:156690711-156690733 CTGCGGGCAGCAGAGGCTGGCGG + Intergenic
915593941 1:156885858-156885880 CACGGGGCAGGGGAGGCTGGAGG - Intergenic
916717130 1:167455514-167455536 CGCACGGGAGCCGCGGCTGGCGG - Intronic
917859273 1:179130183-179130205 CTTTGGGAAGCCGAGGCTGGTGG - Intronic
918274836 1:182943874-182943896 CTTGGGGAAGCCGAGGCGGGTGG + Intronic
918501445 1:185200845-185200867 CTGGGGGAAGCTGCGGCTGTGGG - Intronic
920194043 1:204214140-204214162 CCCCGGGCAGGCGCGGCAGGTGG - Intergenic
920317304 1:205086478-205086500 CTTGGGGAGGCCGAGGCTGGTGG - Exonic
920676389 1:208041299-208041321 CTCTGGGCAGCAGGGGCTGGAGG - Intronic
920952321 1:210584183-210584205 CTTTGGGAAGCCGAGGCTGGGGG - Intronic
921656090 1:217738706-217738728 CTTGGGGAAGCCAAGGCTGGTGG + Intronic
922513147 1:226186476-226186498 CCCGGGGAGGCGGCGGCTGGGGG - Exonic
922527745 1:226318687-226318709 CCCTGGGCAGCCAAGGCTGGTGG + Intergenic
922615410 1:226958371-226958393 CGCTGGGCAGCGGCAGCTGGTGG + Intronic
922776490 1:228216447-228216469 TCCCGGGCAGCTGCGGCTGGCGG - Exonic
922783319 1:228269979-228270001 CCCGGCGCGGCCGCGGCCGGGGG - Intronic
922938237 1:229437275-229437297 CTTTGGGAAGCCGAGGCTGGTGG + Intergenic
924233511 1:241981643-241981665 CTTTGGGCAGCCGAGGCAGGCGG + Intergenic
924634709 1:245774944-245774966 CTCCGGGAGGCCGAGGCTGGCGG - Intronic
924692148 1:246362704-246362726 CTCCGGGAGGCCGAGGCTGGCGG - Intronic
924697162 1:246412613-246412635 CTTTGGGCAGCCGAGGCAGGCGG + Intronic
924788288 1:247220232-247220254 CTCCGGGAGGCCGAGGCTGGCGG - Intergenic
924925525 1:248676544-248676566 CTCCGGGAGGCCGAGGCTGGCGG - Intergenic
1064704914 10:18061626-18061648 CTTGGGGAAGCCGAGGCAGGTGG + Intergenic
1065008151 10:21398290-21398312 CTTTGGGCAGCCGAGGCAGGTGG + Intergenic
1065220575 10:23492020-23492042 CTCTGGGAAGCCGAGGCAGGTGG - Intergenic
1065829030 10:29597641-29597663 CTTTGGGAGGCCGCGGCTGGTGG - Intronic
1066121270 10:32289865-32289887 CTCTGGGAAGCCGAGGCAGGCGG - Intronic
1066571268 10:36775272-36775294 CTCTGGGCGGCCGAGGCGGGTGG + Intergenic
1067379832 10:45762660-45762682 CTTGGGGAAGCCGAGGCGGGCGG + Intronic
1067796513 10:49325712-49325734 CCCGGGGGAGCCGGGGTTGGGGG - Exonic
1069186534 10:65429670-65429692 CCCGGGGCCGGCGGGGCTGGCGG + Intergenic
1069485811 10:68822425-68822447 CTTTGGGCAGCCGAGGCGGGAGG - Intergenic
1069708499 10:70474315-70474337 CTTTGGGCAGCCGAGGCAGGTGG + Intergenic
1072189134 10:93066350-93066372 CTGGGCGCCGCCGCGGCAGGCGG - Intronic
1072605117 10:96974923-96974945 CTTTGGGAAGCCGAGGCTGGTGG + Intronic
1072768680 10:98117657-98117679 CTCTGGGAGGCCGAGGCTGGTGG - Intergenic
1073266420 10:102230803-102230825 CCCGGGGCAGCCGCGGCGGAGGG + Exonic
1073485497 10:103815645-103815667 CTCGGGGAGGCCGAGGCAGGCGG + Intronic
1073782848 10:106858374-106858396 CTTGGGGAAGCCGAGGCAGGCGG + Intronic
1073823216 10:107289982-107290004 CTCTGGGAGGCCGAGGCTGGCGG - Intergenic
1074503124 10:114044003-114044025 GTCAGGGCAGCCGCGGCGCGGGG - Intergenic
1074654536 10:115570203-115570225 CTTTGGGAAGCCACGGCTGGTGG - Intronic
1075111639 10:119591158-119591180 CTCTGGGAAGCCGAGGCAGGTGG + Intronic
1075159122 10:120007817-120007839 CTTTGGGCAGCCGAGGCAGGTGG - Intergenic
1075334439 10:121598272-121598294 CTCGGGGCCCCCGGGGCTCGCGG + Exonic
1075371984 10:121945115-121945137 CTTTGGGCGGCCGAGGCTGGCGG - Intergenic
1075381881 10:122025815-122025837 CTTTGGGCAGCCGAGGCGGGTGG - Intronic
1075834159 10:125439006-125439028 CTTTGGGCGGCCGAGGCTGGTGG + Intergenic
1076455867 10:130594860-130594882 CTCTGGGCGGCCAAGGCTGGTGG - Intergenic
1077068271 11:654629-654651 CTTTGGGCAGCCGAGGCGGGTGG + Intronic
1077311619 11:1891338-1891360 CTGGGGGCTGCCGCTGGTGGGGG + Intronic
1077423319 11:2463002-2463024 AGCGGGGCAGCGGCGGCAGGGGG + Intronic
1077443001 11:2577449-2577471 CTCGGGGAAGACGCGGCCTGGGG + Intronic
1078331438 11:10425683-10425705 CTGGGGGAAGCGGCGGCTGTGGG - Intronic
1079768625 11:24429016-24429038 CTCTGGGAGGCCGAGGCTGGAGG + Intergenic
1080013879 11:27484810-27484832 CTTTGGGCAGCCGAGGCAGGTGG + Intergenic
1080331447 11:31144378-31144400 CTTTGGGAAGCCGAGGCTGGTGG - Intronic
1080391411 11:31850523-31850545 CTCAGGGAAGCCGAGGTTGGTGG + Intronic
1080437596 11:32260311-32260333 CTCTGGGAAGTCGCGGCAGGCGG - Intergenic
1080867061 11:36204730-36204752 CTCTGGGAAGCCGAGGCAGGTGG - Intronic
1082177707 11:49080940-49080962 CTCTGGGAAGCCGAGGCAGGTGG + Intergenic
1082283756 11:50298751-50298773 CCGGGCGCAGCCGAGGCTGGAGG + Intergenic
1082727700 11:56756296-56756318 CTTTGGGAAGCCGAGGCTGGTGG + Intergenic
1082819712 11:57536814-57536836 CTTTGGGCAGCCGAGGCGGGTGG - Intergenic
1083207766 11:61163037-61163059 CTTTGGGAAGCCGAGGCTGGAGG - Intergenic
1083247405 11:61440069-61440091 CTCTGGGAAGCCGAGGCAGGTGG + Intronic
1083304928 11:61757185-61757207 CCCGTGGCAGCCGGGGCTGAAGG - Intronic
1083807590 11:65084245-65084267 ATCGGGGCGGCCGGGGCTGAAGG + Exonic
1084804946 11:71572347-71572369 CTGTGGGCAGCCCCGGCTGGGGG + Intergenic
1085108565 11:73867435-73867457 CTCGGGGCAGGGGAGGCGGGGGG - Intergenic
1085931283 11:81086312-81086334 CTAGGGGCAGCAGGGGTTGGTGG + Intergenic
1086391002 11:86362695-86362717 CTCTGGGAAGCCGAGGCGGGCGG + Intergenic
1086688013 11:89754936-89754958 CTCTGGGAAGCCGAGGCAGGCGG - Intergenic
1086717836 11:90084965-90084987 CTCTGGGAAGCCGAGGCAGGCGG + Intergenic
1086758753 11:90600625-90600647 CTTTGGGAAGCCGAGGCTGGTGG + Intergenic
1088485360 11:110335173-110335195 CTTTGGGCAGCCGAGGCGGGAGG + Intergenic
1089535633 11:119159241-119159263 CTTTGGGAAGCCGAGGCTGGAGG + Intronic
1089688208 11:120170105-120170127 CTGGGGGCAGCCCCGACTGCAGG - Exonic
1089712512 11:120325652-120325674 CTTGGAGCAGGCGTGGCTGGCGG - Intronic
1090508376 11:127344315-127344337 CTCTGGGCGGCCGAGGCAGGCGG - Intergenic
1090877560 11:130804578-130804600 CTTTGGGCAGCCACGGCTGGAGG + Intergenic
1091248905 11:134125066-134125088 CACAGGGCAGCGGCGGCTGCAGG - Intronic
1091377072 12:31744-31766 CCCGGAGGAGCCGAGGCTGGCGG - Intergenic
1091474042 12:753974-753996 CCAGGGGCGGCAGCGGCTGGAGG - Exonic
1091564694 12:1639738-1639760 CTCGCGGCAGGCCCGGCTGATGG - Exonic
1096245217 12:49981048-49981070 CTCTGGGCAGCTGTGGCAGGGGG + Intronic
1096668143 12:53180742-53180764 GTGGGGGCAGCCGCGGCGGTGGG + Exonic
1096775558 12:53961457-53961479 CTCGAGTCAGCCGGGGCTGTGGG - Intergenic
1096835524 12:54348493-54348515 CTTTGGGAAGCCGAGGCTGGCGG + Intronic
1097178277 12:57156261-57156283 CTCGGGGCTGACGCCTCTGGTGG - Exonic
1097272338 12:57783857-57783879 CTCTGGGAAGCCGAGGCGGGCGG - Intronic
1097281110 12:57846001-57846023 CCCGGGGCAGCCGCGCGCGGCGG + Intronic
1098933923 12:76454989-76455011 CTCTGGGAGGCCGAGGCTGGTGG + Intronic
1098935987 12:76479921-76479943 CTTTGGGAAGCCGAGGCTGGCGG + Intronic
1100263096 12:92950777-92950799 CTTTGGGCAGCTGCGGCAGGAGG + Intergenic
1100329521 12:93571057-93571079 GTCGCAGCCGCCGCGGCTGGCGG + Intronic
1100603197 12:96129923-96129945 CTCGGGGAGGCCGAGGCAGGAGG + Intergenic
1101013560 12:100475975-100475997 CTCTGGGAAGCCGAGGCGGGCGG - Intronic
1101102434 12:101407588-101407610 CTCGAGGGAGCCGCGGCCGAGGG - Intronic
1101489462 12:105197858-105197880 CCCAGGGGAGCCGTGGCTGGAGG - Exonic
1102544619 12:113645675-113645697 CCCGGAGCAGCCCCGGGTGGGGG + Intergenic
1102705066 12:114874138-114874160 CTCGGGGAGGCCGAGGCAGGTGG + Intergenic
1103320938 12:120092585-120092607 CTAGGGCCTGCCGGGGCTGGGGG + Intronic
1103534742 12:121626765-121626787 CTCGGGACTGCTGCGGCTCGGGG - Exonic
1103595498 12:122022409-122022431 CTCCGGGCCGCCGCGCCAGGTGG - Intronic
1103780300 12:123394344-123394366 CTTTGGGAAGCCGAGGCTGGCGG - Intronic
1103929117 12:124439961-124439983 CTCGGTGCAGCAGTGGGTGGGGG - Intronic
1104019795 12:124984287-124984309 CTCGGGGAGGCCGAGGCAGGTGG + Intronic
1104876696 12:132039793-132039815 CTTTGGGAAGCCGAGGCTGGAGG + Intronic
1104973819 12:132543180-132543202 CTCAGGACAGCAGCCGCTGGCGG - Intronic
1105355161 13:19652975-19652997 CTCGGGGAAGGGGCGGCTGTGGG + Intronic
1105472070 13:20703736-20703758 CTCGGGGCGGCGGCGGCGGCGGG + Intronic
1106011422 13:25827353-25827375 CTCTGGGAAGCCGAGGTTGGCGG - Intronic
1106044844 13:26129390-26129412 CTCTGGGAGGCCGAGGCTGGTGG - Intergenic
1106219661 13:27735087-27735109 CTCTGGGAGGCCGAGGCTGGCGG + Intergenic
1106269403 13:28138868-28138890 CCCGGGGCAGCCCCGGCGGCAGG - Exonic
1107514789 13:41118635-41118657 CTCTGGGAAGCCGAGGCAGGCGG - Intergenic
1108292556 13:48976057-48976079 CTCAGGGCCGCCGCGGCCGCCGG - Intronic
1108387379 13:49912401-49912423 CTCTGGGGGGCCGAGGCTGGCGG + Intergenic
1111975997 13:94967944-94967966 CACGGGGCAGCCGCGGAGGGTGG + Intergenic
1113082747 13:106535261-106535283 GCCGGGCCGGCCGCGGCTGGCGG + Intergenic
1113767397 13:112889800-112889822 CTGGGAGCAGCCGCGGCCTGCGG + Intergenic
1113885995 13:113658630-113658652 ATCGGGGCGGCCGCAGCGGGGGG - Intergenic
1114248550 14:20937034-20937056 CTTTGGGAAGCCGAGGCTGGTGG - Intergenic
1114385392 14:22249109-22249131 CTCTGGGCAGCCAAGGCGGGTGG - Intergenic
1114634986 14:24182333-24182355 GCCCTGGCAGCCGCGGCTGGGGG - Exonic
1115339132 14:32273247-32273269 CTCGGGGAAGGGGCGGCTGTGGG + Intergenic
1115343688 14:32319209-32319231 CTTTGGGAAGCCGAGGCTGGCGG + Intergenic
1116655348 14:47645827-47645849 CTCTGGGAAGCCGAGGCGGGTGG + Intronic
1116893860 14:50296126-50296148 CTCTGGGAAGCTGAGGCTGGTGG + Intronic
1117137867 14:52755364-52755386 CTTGGGGAAGCCGAGGCAGGTGG - Intronic
1117478213 14:56118432-56118454 CTCGGGGCGGCCGCGGCGCGCGG + Exonic
1117941125 14:60966361-60966383 CTCTGGGAAGCCGAGGCAGGTGG - Intronic
1118137450 14:63045402-63045424 GTCTGGGCAGCGGCGGCCGGGGG - Exonic
1118358695 14:65037666-65037688 CTTGGGGAAGCCGCAGCAGGAGG - Intronic
1118404908 14:65413134-65413156 CGTGGGGCAGCTGCGGCTGAGGG + Intronic
1118627454 14:67672684-67672706 CTTGGGGAAGCCGAGGCGGGCGG - Intronic
1119098196 14:71854054-71854076 CTTTGGGAAGCCGAGGCTGGTGG - Intergenic
1119325632 14:73758519-73758541 CTGTTGGCAGCTGCGGCTGGGGG - Intronic
1119743526 14:77028524-77028546 GCCCGGGCCGCCGCGGCTGGCGG + Exonic
1120190528 14:81436118-81436140 CCCGGGACGCCCGCGGCTGGTGG + Intronic
1121137681 14:91512788-91512810 CTTTGGGAAGCCGAGGCTGGCGG + Intergenic
1121278186 14:92681713-92681735 CTTGGGGCAGCAAGGGCTGGGGG + Intronic
1122143689 14:99676587-99676609 CTCGGGGCTGACCAGGCTGGGGG + Exonic
1122366696 14:101198617-101198639 GTCGGTACAGCCGCTGCTGGGGG + Intergenic
1122670789 14:103370539-103370561 CTCTGGGAGGCCGAGGCTGGTGG - Intergenic
1122710223 14:103651249-103651271 CTCTGGGAGGCCGAGGCTGGCGG - Intronic
1122729727 14:103787095-103787117 CTTTGGGCAGCCGAGGCAGGTGG - Intronic
1122817561 14:104321038-104321060 CTCGGGGCAGGCCCGGGGGGTGG + Intergenic
1122817766 14:104321936-104321958 CTGGGGGCGGGGGCGGCTGGAGG + Intergenic
1122840915 14:104462130-104462152 CTCGGGGTGGCCGTGGCGGGAGG - Intergenic
1122952285 14:105051666-105051688 GTCGGGGCCGCCGCCGCCGGAGG - Exonic
1123071091 14:105642863-105642885 CCCAGGGCAGCTGCTGCTGGAGG + Intergenic
1123090751 14:105741133-105741155 CCCAGGGCAGCTGCTGCTGGAGG + Intergenic
1123096386 14:105768897-105768919 CCCAGGGCAGCTGCTGCTGGAGG + Intergenic
1124574462 15:30895773-30895795 CCCGGGGAGGCCGAGGCTGGCGG + Intergenic
1126018746 15:44378296-44378318 CTTTGGGCAGCCGAGGCGGGCGG - Intronic
1127124374 15:55797841-55797863 CTTTGGGAAGCCGAGGCTGGTGG - Intergenic
1127753008 15:62064635-62064657 CTTTGGGAAGCCGAGGCTGGGGG + Intergenic
1128254221 15:66185243-66185265 CTTGAGGCAGCAGGGGCTGGCGG - Intronic
1128521113 15:68375488-68375510 CCCGGGGCTGCCCTGGCTGGGGG + Intronic
1128728095 15:70002567-70002589 CTGGGGGCAGGCAGGGCTGGTGG + Intergenic
1128748715 15:70133265-70133287 CTGTGGGCAGCAGGGGCTGGAGG + Intergenic
1129503522 15:76061485-76061507 CACGGAGCAGCCGCACCTGGAGG - Intronic
1129741246 15:77990709-77990731 CTGGGAGCAGCTGCAGCTGGAGG - Intronic
1129852240 15:78800146-78800168 CTTGGGGCAGTCTCGGGTGGTGG - Intronic
1129865592 15:78905817-78905839 CTCTGGGAAGCCGAGGCGGGCGG - Intergenic
1130250758 15:82298927-82298949 CTTGGGGCAGTCTCGGGTGGTGG + Intergenic
1130284126 15:82541257-82541279 ATCGGGGCAGCCTGCGCTGGTGG - Intronic
1130348014 15:83066895-83066917 CGCGGCGCCGCCGCCGCTGGGGG - Exonic
1130612234 15:85371968-85371990 CTCTGGGAAGCCGAGGCGGGCGG - Intergenic
1130798809 15:87239276-87239298 TTCGGTGCAGCTGTGGCTGGGGG + Intergenic
1131517711 15:93089845-93089867 CGCGGGGGAGCCGCGGCCGTGGG - Intergenic
1131534840 15:93228105-93228127 CTTTGGGAAGCCGCGGCAGGCGG - Intergenic
1132610369 16:813156-813178 CTTGGTGCAGCCGTGGGTGGGGG + Intronic
1132635057 16:940087-940109 CTCCGGGCACCCCCGGCTTGTGG - Intronic
1132759138 16:1500510-1500532 CTCGGGGCGCCCGAGGCCGGGGG - Intronic
1132814008 16:1817390-1817412 GTCTGGGCAGCCGTGGCCGGAGG - Intronic
1132955177 16:2588115-2588137 CTCTGGGCCGCCCCGGCAGGTGG + Intronic
1133138405 16:3728206-3728228 GATGGGGCAGCCGGGGCTGGGGG - Exonic
1133208299 16:4247434-4247456 CTTTGGGCAGCCGAGGCAGGTGG + Intergenic
1133772539 16:8875736-8875758 CTCTGGGAAGCCGAGGCGGGTGG - Intergenic
1134005832 16:10818455-10818477 CTCGGGGATGCTGGGGCTGGAGG - Intronic
1134538053 16:15042431-15042453 CTTTGGGCAGCCGAGGCAGGTGG - Intronic
1134645019 16:15858544-15858566 CGCGGGGCAACGGCGGCCGGTGG - Intergenic
1134654785 16:15939896-15939918 CTTTGGGAAGCCGCGGCAGGAGG + Intergenic
1135024514 16:18988804-18988826 CTCTGGGATGCCGAGGCTGGTGG + Intronic
1135102558 16:19619174-19619196 CTCTGGGAAGCCGAGGCGGGAGG - Intronic
1135250884 16:20900364-20900386 TTCGGGGCGGCCGCCGCCGGTGG - Exonic
1136141854 16:28293266-28293288 CGCGGGGACGCCGCGGCAGGGGG - Exonic
1136410387 16:30073428-30073450 CTTTGGGCAGCCGAGGCAGGTGG - Intergenic
1137056171 16:35747615-35747637 CTGGGGACAACCGGGGCTGGAGG + Intergenic
1137240184 16:46649386-46649408 CTCTGCGCAGTCTCGGCTGGAGG - Intergenic
1137249513 16:46731845-46731867 CTCTGGGAGGCCGAGGCTGGAGG + Intronic
1137266811 16:46875557-46875579 CTTCGGGCAGCCGAGGCGGGTGG + Intergenic
1137551096 16:49438128-49438150 CTCTGGGAGGCCGAGGCTGGTGG + Intergenic
1138047341 16:53739068-53739090 GTTTGGGCAGCCGAGGCTGGAGG - Intronic
1138761144 16:59546139-59546161 CTTTGGGCAGCCGAGGCAGGTGG + Intergenic
1140638225 16:76941690-76941712 CTTGGGGAGGCCGAGGCTGGCGG + Intergenic
1141333496 16:83133740-83133762 CTTTGGGCAGCCGAGGCAGGTGG - Intronic
1141501217 16:84445449-84445471 CTTTGGGCAGCCGAGGCGGGTGG - Intronic
1141564926 16:84894983-84895005 CTCGGGGCAGCCTGGCTTGGGGG - Intronic
1142178950 16:88657930-88657952 TGTGGGGCAGCCGCGGCTGCAGG - Exonic
1142283740 16:89162521-89162543 CCCGGGGCAGCCGCACCTGGAGG - Intergenic
1142528430 17:561871-561893 TTGGGGGCAGCCGAGGCAGGAGG - Intronic
1143568624 17:7740543-7740565 CGCGGGGCAGCCGCACCTCGCGG - Exonic
1143831374 17:9654403-9654425 CTTGGGGAAGCCGAGGCGGGCGG + Intronic
1144119363 17:12135473-12135495 CTCCGGGAAGCCGAGGCAGGAGG - Intronic
1144226327 17:13151194-13151216 CTTTGGGAAGCCGAGGCTGGCGG - Intergenic
1144408362 17:14974627-14974649 CTCAGTGCAGCAGCAGCTGGGGG - Intergenic
1145063819 17:19748724-19748746 CCCGGGGCAGCGGTGGCTGGGGG - Intronic
1145364831 17:22251312-22251334 CTCTGGGAGGCCGAGGCTGGTGG - Intergenic
1146052883 17:29567048-29567070 CCCTGGGCAGCCGCCGCCGGCGG - Exonic
1146240217 17:31215222-31215244 CTTGGGGAGGCCGAGGCTGGAGG - Intronic
1146438974 17:32877098-32877120 CGCCCGGCAGCCGCGGCGGGAGG - Exonic
1146888293 17:36486897-36486919 CTCGGGGCTGACGCGGCCTGTGG + Intronic
1147563358 17:41522145-41522167 CTCTGGGCAGTCCCAGCTGGGGG + Exonic
1147871870 17:43593175-43593197 CTTGGGGAGGCCGAGGCTGGTGG + Intergenic
1147899681 17:43775868-43775890 CTCTGGGAAGCCGAGGCAGGTGG + Intronic
1148050460 17:44767653-44767675 GCCGGGGCAGCTGGGGCTGGGGG - Intronic
1148238750 17:45986252-45986274 CTCAGAGCAGCTGGGGCTGGTGG + Intronic
1148610416 17:48961068-48961090 TGAGGGGCAGCCGCGGATGGGGG + Intronic
1148836566 17:50468837-50468859 CTGGGGGCAGCAGCGGCGGCGGG + Exonic
1148942764 17:51229084-51229106 CTCTGGGAGGCCGAGGCTGGAGG + Intronic
1149740805 17:59044049-59044071 CTTTGGGAAGCCGAGGCTGGAGG + Intronic
1150051775 17:61971348-61971370 CTCATGGCAACCTCGGCTGGCGG + Intronic
1150561986 17:66302530-66302552 CTCGGGGCATGCGCGGTGGGCGG + Intergenic
1150823764 17:68457229-68457251 CTCGAGGCGGCCTCGGCGGGAGG - Intronic
1151719446 17:75847065-75847087 CTCGGGGCAGCTGGTGCTGGGGG + Intronic
1151854289 17:76710491-76710513 CTGGGGGCAGCCTGGGCTGGAGG + Intronic
1151914302 17:77106148-77106170 CTTGGGGAAGCCGAGGTTGGCGG + Intronic
1151945927 17:77319869-77319891 CTCGGGGCGGCGGGGGCTGGAGG + Intronic
1152293918 17:79455841-79455863 CTCGGGGGAGGCCAGGCTGGAGG - Intronic
1152609298 17:81307730-81307752 CTTTGGGAAGCCGAGGCTGGTGG - Intergenic
1152824974 17:82458881-82458903 CTCTGGGCGGCCGAGGTTGGCGG + Intronic
1153249926 18:3111183-3111205 CTTTGGGCAGCTGAGGCTGGAGG - Intronic
1153918249 18:9765239-9765261 CTCTGGGCAGCCGGGTGTGGTGG - Intronic
1153997429 18:10454517-10454539 CCCCGGGCAGCCGCCGCCGGGGG - Intergenic
1155180643 18:23343164-23343186 CTCTGGGAAGCCGAGGCAGGTGG - Intronic
1156952474 18:42919468-42919490 CTTTGGGCAGCCGAGGCTGGAGG + Intronic
1157862560 18:51154118-51154140 CTGTGGGCAGCCCCAGCTGGCGG - Intergenic
1158608143 18:58914436-58914458 CTCTGGGAGGCCGCGGCGGGCGG + Intronic
1158681006 18:59566786-59566808 GTTGGGGCAGCAGCGGGTGGGGG - Intronic
1159782337 18:72674853-72674875 CTGGGGGTGGCTGCGGCTGGAGG - Intergenic
1160455057 18:78993874-78993896 CCCGGGGCTGCCGAGGCTCGTGG - Exonic
1160506795 18:79431942-79431964 CTCGGGGAGGCCGAGGCGGGTGG - Intronic
1160540233 18:79617161-79617183 CTGGGGGCGGCCGGGGCTGCCGG - Intergenic
1160677148 19:397500-397522 CGCGGGGCAGCCCAGGCAGGAGG - Intergenic
1160743361 19:698143-698165 CTCCGGGAAGCCGAGGCTGGAGG - Intergenic
1161258195 19:3321343-3321365 CAAGGGGCAGCCGCTGCAGGAGG + Intergenic
1161586772 19:5109929-5109951 CTGGGGGCACCCGCGTCTGACGG + Intronic
1161923005 19:7280472-7280494 CTTTGGGCAGCCGAGGCGGGTGG + Intronic
1162022513 19:7874230-7874252 CGCGGGCCAGGCCCGGCTGGGGG - Intronic
1162365213 19:10244444-10244466 CTTTGGGAAGCCGAGGCTGGAGG + Intergenic
1162478705 19:10915737-10915759 CTTGGGGCAGGCGGGGCTGCGGG + Intronic
1162711337 19:12597052-12597074 CTCGGGTCAGCTGCGCCAGGGGG + Intronic
1162789915 19:13057516-13057538 CCCTGGGGAGCCGAGGCTGGGGG - Intronic
1162915829 19:13873894-13873916 CTGGGGGCACCCGGGGCGGGGGG + Intronic
1163048925 19:14666618-14666640 CTCGGGGAGGCCGAGGCAGGTGG - Intronic
1163463731 19:17454740-17454762 CTGGGGGCAGGAGGGGCTGGGGG - Intronic
1163655671 19:18543532-18543554 GGCGCGGCGGCCGCGGCTGGGGG - Exonic
1163666552 19:18606465-18606487 CCGGGGGCAGCCGCGGGGGGAGG - Intronic
1163753433 19:19092322-19092344 CTGAGGGCAGCTGGGGCTGGGGG - Intronic
1165302250 19:34977567-34977589 TTCGGGGAGGCCGAGGCTGGTGG + Intergenic
1165305682 19:35000980-35001002 CTCGGGGCTGCCGGGGGTGGGGG + Intronic
1165325465 19:35111955-35111977 CTCTGGGGGGCCGAGGCTGGAGG - Intergenic
1165738811 19:38193751-38193773 CTCGGGAAAGCCGCTGCCGGCGG - Exonic
1165845633 19:38816233-38816255 CTGGGGGCAGCCAGGCCTGGAGG - Intronic
1166073689 19:40401399-40401421 CTCGGGGAAGCCAAGGCGGGAGG - Intronic
1167145733 19:47680130-47680152 CTCGGGACAGCCGCTGGCGGTGG + Exonic
1167645310 19:50702573-50702595 CCCTGGGCAGCCGCGGGAGGCGG - Exonic
1167796211 19:51710834-51710856 CTTTGGGAAGCCGAGGCTGGTGG + Intergenic
1167908739 19:52684123-52684145 CTCTGGGAGGCCGAGGCTGGTGG + Intronic
1168335936 19:55597807-55597829 CTGGGGGCGGCAGCGGCGGGCGG + Exonic
1168414504 19:56159906-56159928 CCCGGGGCTGCCGGGGCTGCCGG - Exonic
1168670399 19:58237305-58237327 CTCTGGGCAGCAGAGGCAGGCGG - Intronic
1168678026 19:58293180-58293202 CTTTGGGAAGCCGAGGCTGGAGG - Intronic
924969903 2:116330-116352 CTCTGGGAGGCCGAGGCTGGCGG + Intergenic
925056978 2:863781-863803 CTGGGGGCAGTGGGGGCTGGGGG - Intergenic
925903546 2:8525508-8525530 CCTGGGTCAGCCGCTGCTGGCGG + Intergenic
927472271 2:23385400-23385422 CCCGCGGCCGCCGCGGCTGCGGG + Exonic
927640539 2:24842749-24842771 CTCTGTGCAGCCGTGGCGGGTGG - Intronic
927937307 2:27083092-27083114 TGAGGGGCAGCTGCGGCTGGTGG + Exonic
928186655 2:29115989-29116011 CTCGGGGCAGCCGCGGCTGGCGG - Intronic
928284290 2:29975545-29975567 CTCGGGGAGGCCGAGGCGGGTGG - Intergenic
928606327 2:32947536-32947558 CCCGGGGGAGGCACGGCTGGGGG - Exonic
929062857 2:37941489-37941511 CTGGGGGAAGGCGCGGCTGTGGG - Intronic
929102236 2:38326742-38326764 CTCGGGGAGGCCGAGGCAGGTGG + Intronic
930358254 2:50346964-50346986 CGAGGGGCAGCCGCCGCGGGAGG + Intronic
931671954 2:64654676-64654698 CTCGGTGCAGACCCGGCAGGAGG + Intronic
932217608 2:69976946-69976968 CTTTGGGAAGCCGCGGCAGGTGG + Intergenic
934588530 2:95526719-95526741 CTGGGGGAAGAGGCGGCTGGCGG + Intergenic
934862061 2:97772650-97772672 CTCTGGGAAGCCGAGGCAGGTGG + Intronic
934882484 2:97995896-97995918 CGCGGGTCAGGCGCGGCGGGCGG + Intergenic
936566074 2:113583750-113583772 CCCGGAGGAGCCGAGGCTGGCGG + Intergenic
936598216 2:113869676-113869698 CTCTGGGAAGCTGCGGCAGGTGG + Intergenic
937784483 2:125879121-125879143 CTCTGAGAAGCCGAGGCTGGTGG + Intergenic
938588445 2:132714572-132714594 CTTTGGGAAGCCGAGGCTGGCGG + Intronic
938920591 2:135991007-135991029 CTCTGGGCAGCTGAGGCAGGCGG - Intergenic
940314199 2:152310172-152310194 CTTTGGGAAGCCGAGGCTGGTGG + Intergenic
940862539 2:158785647-158785669 CTTTGGGAAGCCGAGGCTGGAGG + Intergenic
941096686 2:161245164-161245186 CCCGGCGCGGCCGCGGCCGGGGG - Intergenic
941822807 2:169859312-169859334 CTCTGGGAAGCCGAGGCGGGTGG - Intronic
941932778 2:170958911-170958933 CTTGGGGCAGCAGAGGCGGGCGG - Intronic
945119607 2:206443887-206443909 CTCGCGGCAGCCGCCCCTGGCGG + Exonic
947355454 2:229289991-229290013 CTTTGGGCAGCCGAGGCGGGTGG - Intergenic
947536573 2:230943480-230943502 CTCCGGGCATCCCCAGCTGGGGG + Intronic
948116038 2:235494635-235494657 CGCGGGGCGGCGGCGGCGGGGGG + Exonic
948267596 2:236646990-236647012 CTTGGGGCAGACTGGGCTGGTGG + Intergenic
948851860 2:240712207-240712229 CTCAGTGCAGCCCTGGCTGGTGG - Intergenic
948875975 2:240828690-240828712 CTCTGGGAAGCCGAGGCAGGTGG + Intergenic
948934052 2:241150715-241150737 CTCGGGGGAGCCCCGGCCCGGGG + Intronic
1169095923 20:2898612-2898634 CTCTGGGAGGCCGAGGCTGGTGG + Intronic
1169206478 20:3743127-3743149 CTCTGGGAGGCCGAGGCTGGCGG - Intronic
1171346430 20:24469550-24469572 CTCGGGGCAGCCGGGGGCGCAGG + Exonic
1171963088 20:31509343-31509365 CTCTGGGAGGCCGCGGCAGGTGG + Intergenic
1173502674 20:43565466-43565488 CTCAGGGAAGCCTGGGCTGGGGG + Intronic
1174298871 20:49568117-49568139 CGCGGGGCTGGCGGGGCTGGCGG + Exonic
1174822826 20:53742209-53742231 CTGTGGGAGGCCGCGGCTGGTGG - Intergenic
1175339955 20:58222319-58222341 CTCGGGGCAGGTGCGGCAGGAGG - Intronic
1175779626 20:61674206-61674228 CTCGGGGCAGCTCAGGCTTGGGG - Intronic
1175908785 20:62394818-62394840 CCGGGGGCAGCCGCACCTGGGGG + Intronic
1175998330 20:62821195-62821217 CCCGGGGCCGCCCGGGCTGGGGG + Exonic
1176308187 21:5135331-5135353 CTCGCTGCAGCTGCGGCAGGTGG + Intronic
1176914291 21:14606081-14606103 CTTTGGGCAGCCGAGGCGGGCGG - Intronic
1179217323 21:39378946-39378968 CTCTGGGAAGCCGAGGCAGGTGG - Intergenic
1179775686 21:43660318-43660340 CTCTGGGAAGCCGAGGCGGGCGG + Intronic
1179811578 21:43874267-43874289 CTCGGGGAAGCCGAGGTGGGCGG - Intronic
1179848873 21:44126701-44126723 CTCGCTGCAGCTGCGGCAGGTGG - Intronic
1180087844 21:45516029-45516051 CCGGGGGCTGCCGCGGGTGGTGG + Exonic
1180281599 22:10701121-10701143 CTCTGGGAAGCCGAGGCGGGTGG - Intergenic
1180614758 22:17120202-17120224 CTGGGGGCGGCCGCGGCAGCGGG - Exonic
1180875265 22:19172127-19172149 GCTGGGGCAGCCGAGGCTGGCGG - Intergenic
1181745424 22:24952607-24952629 CTCCGCGCAGGCGCGGCCGGCGG + Intergenic
1181880155 22:25972710-25972732 CTCTGGGAAGCCGAGGCAGGTGG + Intronic
1182369709 22:29802183-29802205 ATGGGAGCAGCCGCGGCTGTGGG - Exonic
1183204540 22:36409760-36409782 CTCTGGGAGGCCGAGGCTGGCGG - Intergenic
1183274166 22:36881223-36881245 CTCTGGGAAGCCGAGGCAGGTGG - Intergenic
1183942048 22:41301534-41301556 CTCGCGGCAGCACCCGCTGGAGG - Exonic
1184160354 22:42693912-42693934 CCCGGAGCAGCCGCAGCAGGAGG + Exonic
1184195554 22:42925234-42925256 CTTTGGGCGGCCGAGGCTGGCGG + Intronic
1184375658 22:44110841-44110863 CTCTGGGAGGCCGAGGCTGGTGG - Intronic
1184430059 22:44437425-44437447 CCAGGGGCAGCCGGGGCTTGTGG + Intergenic
1184465843 22:44668636-44668658 CTGGGGGCTGCGGCGGCTGCGGG + Intronic
1184791222 22:46701315-46701337 CTCGGGGCAGCAGCCTCTGGAGG + Intronic
1185007923 22:48295427-48295449 CTTTGGGAAGCCGAGGCTGGTGG + Intergenic
1185278280 22:49959213-49959235 CTCTGGGAAGCAGCGGCTGGAGG + Intergenic
1185296757 22:50058437-50058459 GTCGGAGCAGGCGCGGCTGCGGG + Intergenic
950295499 3:11826288-11826310 CTCGGGGAGGCCGAGGCGGGAGG + Intronic
950305875 3:11915122-11915144 CGCGGGGCAGCCTGGGATGGTGG - Intergenic
950329318 3:12143979-12144001 CTGGGTGCAGCTGGGGCTGGAGG + Intronic
950388819 3:12680450-12680472 CTCTGGGAGGCCGAGGCTGGAGG - Intergenic
950417357 3:12876143-12876165 GTGGGGGCAGCAGCGTCTGGAGG + Intergenic
950568681 3:13786971-13786993 CTCGTGCCACACGCGGCTGGTGG + Intergenic
950710631 3:14810756-14810778 CGCGGGGCGGCCGCGGAGGGAGG + Intergenic
953027423 3:39153199-39153221 CTCGGGGTTACCGCGGCGGGCGG + Intronic
953264330 3:41371190-41371212 CTCGGGGAAGGGGCGGCTGTGGG + Intronic
953353034 3:42230303-42230325 CTCGGGGCTGCTGTGGTTGGCGG + Intergenic
953484911 3:43286380-43286402 GTCGGGGCTGAGGCGGCTGGCGG - Intergenic
953554549 3:43933282-43933304 CTTTGGGAAGCCGAGGCTGGTGG + Intergenic
953635714 3:44662225-44662247 CTCTGGGAAGCCGAGGCAGGTGG - Intergenic
953909284 3:46883514-46883536 CTCGGGGCAGCCGCCGCCGCCGG - Exonic
954618980 3:51985136-51985158 CTCCGGGCTGCCTGGGCTGGTGG + Intronic
954882775 3:53846717-53846739 TTCGGGGCAGCCTGGACTGGCGG - Intronic
956825434 3:72993527-72993549 CTCTGGGAAGCCAAGGCTGGAGG - Intronic
957627380 3:82671082-82671104 CTCTGGGAAGCCGAGGCAGGGGG - Intergenic
957756856 3:84500592-84500614 CTCGGGGAGGCCGAGGCGGGCGG + Intergenic
957890567 3:86351917-86351939 CTTTGGGAAGCCGCGGCGGGCGG - Intergenic
958575576 3:95946549-95946571 CTTTGGGCAGCTGAGGCTGGAGG - Intergenic
959513503 3:107240558-107240580 CGCGGGGCAGCCGGGGCGGAAGG - Intergenic
959568108 3:107853364-107853386 CTCTGGGAGGCCGAGGCTGGCGG - Intergenic
959705732 3:109337141-109337163 CTTTGGGCAGCCGAGGCGGGCGG - Intronic
960922978 3:122767293-122767315 CTTTGGGCGGCCGAGGCTGGTGG + Intronic
961260512 3:125597814-125597836 CTTTGGGCAGCTGAGGCTGGTGG + Intergenic
961975489 3:131020368-131020390 CTCGGGGCAGCTGCTTCTGCAGG - Intronic
962575655 3:136752663-136752685 CTTGGGCCGCCCGCGGCTGGCGG + Intergenic
962578453 3:136775779-136775801 CTCCGGGAGGCCGAGGCTGGTGG - Intergenic
962586786 3:136849859-136849881 CTTCGGGAAGCCGCGGCGGGCGG + Intronic
962770878 3:138609083-138609105 CTCTGGGCGGCGGCGGCGGGCGG + Intronic
963588622 3:147227753-147227775 CTCTGGGAGGCCGAGGCTGGTGG - Intergenic
963827462 3:149970744-149970766 GTCTGGGCAGCCACGGCCGGGGG - Exonic
967680245 3:192353610-192353632 CTCTGGGAGGCCGAGGCTGGCGG - Intronic
967859828 3:194142042-194142064 CTCGGTGCGGCGGAGGCTGGTGG - Intergenic
968118832 3:196110215-196110237 CTCGGGGAGGCCGAGGCGGGTGG - Intergenic
968599800 4:1503587-1503609 CTGGGGGCAGCCGCTGAGGGTGG - Intergenic
969285833 4:6201120-6201142 CTGGGGGCAGCCTGGGCTGGTGG - Intergenic
969729997 4:8948940-8948962 CTTTGGGCAGCCGAGGCTGATGG - Intergenic
969794495 4:9516277-9516299 CTTTGGGAAGCCGAGGCTGGCGG - Intergenic
971280287 4:25237607-25237629 CTCTGGGAAGCCGAGGCGGGAGG - Intronic
971382219 4:26109347-26109369 CTTTGGGCAGCCGAGGCAGGTGG - Intergenic
972091568 4:35292597-35292619 CTTTGGGCAGCCGAGGCGGGTGG - Intergenic
972333072 4:38081283-38081305 CTCGGGGCAGGTGCAGCAGGAGG + Intronic
975305716 4:72846802-72846824 CTGGGGGAAGGGGCGGCTGGGGG + Intergenic
976249342 4:83034586-83034608 CTTTGGGCAGCCGAGGCGGGCGG - Intronic
977257683 4:94758379-94758401 GTCGGGGCAGCGGCGGCGGCGGG + Intronic
977606993 4:98993930-98993952 CACGGTGCAGCGGCGGCTGAAGG + Intergenic
978127005 4:105146777-105146799 CTCGGGGCGGCCGCGCCGAGGGG - Exonic
978510604 4:109513523-109513545 CTTTGGGCGGCCGCGGCGGGCGG - Intronic
979308324 4:119173925-119173947 CTCGGGCCAGCGGCGGTGGGGGG + Intronic
980056648 4:128084377-128084399 CTCCGGGAGGCCGAGGCTGGCGG + Intronic
981233817 4:142391312-142391334 CTCTGGGAAGCCGAGGCGGGTGG + Intronic
981502503 4:145467403-145467425 CTCCGGGAAGCCAAGGCTGGAGG + Intergenic
982191026 4:152855448-152855470 CTGGCGGCAGCCTAGGCTGGTGG + Intronic
982695301 4:158592328-158592350 CTCTGGGGGGCCGAGGCTGGTGG + Intronic
982794494 4:159629308-159629330 CTGGGGGAAGCGGCGGCTGTGGG - Intergenic
983649791 4:170026504-170026526 TTCGCGGCAGCCGCGGGCGGGGG + Intronic
983940158 4:173529176-173529198 CTCATGGCTGCAGCGGCTGGCGG + Exonic
984562383 4:181286026-181286048 CTTTGGGAAGCCGAGGCTGGTGG - Intergenic
985026788 4:185746559-185746581 CTCTGGGAAGCCGAGGCAGGAGG - Intronic
985533327 5:446612-446634 CTCGGGGAGGCCGAGGCAGGCGG + Intronic
985545557 5:507506-507528 CTTTGGGAAGCCGCGGCTGGAGG - Intronic
985947767 5:3200267-3200289 CACGGGGCAGCAGCATCTGGAGG - Intergenic
987303451 5:16617088-16617110 CGCGGGGCACAGGCGGCTGGGGG + Intergenic
987448639 5:18054204-18054226 CTAGGGGAAGCCGAGGCGGGAGG + Intergenic
987553436 5:19413551-19413573 CTTGGGGAAGCCGAAGCTGGCGG - Intergenic
988303292 5:29462225-29462247 CTCTGGGAGGCCGAGGCTGGCGG - Intergenic
992464684 5:76992066-76992088 CTTTGGGAAGCCGAGGCTGGTGG - Intergenic
992950368 5:81852014-81852036 AGCGCGGCAGCCGCGGCGGGAGG - Intergenic
992964578 5:81986798-81986820 CTCTGGGAAGCTGAGGCTGGTGG + Intronic
996293995 5:121890232-121890254 CTTTGGGAAGCCGCGGCAGGCGG - Intergenic
996742403 5:126812970-126812992 CTCTGGGAAGCCGAGGCGGGTGG - Intronic
998135353 5:139671493-139671515 CCTGGGCCAGCCGCGGGTGGCGG + Intronic
999140463 5:149358111-149358133 CTCGCCGCCGCCGCTGCTGGCGG + Exonic
999163836 5:149530722-149530744 CTCTGGGAAGCCGAGGCGGGCGG + Intronic
1000558760 5:162759779-162759801 CTTTGGGAAGCCGAGGCTGGTGG + Intergenic
1000671822 5:164072684-164072706 CTTGGGGCAGCCGAGGCAGGTGG - Intergenic
1000723934 5:164744903-164744925 CTTGGGGAAGCCGAGGCAGGCGG - Intergenic
1001389571 5:171367963-171367985 CTCTGGGAAGCCGAGGCGGGCGG - Intergenic
1002050777 5:176569523-176569545 CTCTGGGAAGCCGAGGCGGGCGG - Intronic
1002058131 5:176610224-176610246 CGCGGGGAAACCGCGGCCGGAGG + Intergenic
1002765918 6:238819-238841 CTTGGGGAAGCCGAGGCAGGCGG + Intergenic
1002946847 6:1769967-1769989 CTCGGGGAGGCCGAGGCGGGTGG - Intronic
1002951861 6:1821350-1821372 GCCAGGGGAGCCGCGGCTGGTGG + Intronic
1003231660 6:4259267-4259289 CTTTGGGCAGCCGAGGCAGGGGG - Intergenic
1003995797 6:11538164-11538186 CTCCAGGCCGCCGCCGCTGGTGG - Intergenic
1004629613 6:17408910-17408932 CTTGGGGAGGCCGAGGCTGGCGG - Intronic
1005064286 6:21803480-21803502 CTCTGGGAAGCCGAGGCGGGTGG - Intergenic
1005526540 6:26657003-26657025 CTTCGGGAAGCCGAGGCTGGCGG + Intronic
1005993139 6:30915739-30915761 CTTGGGGCAGCCGGGCCTAGAGG - Exonic
1006073330 6:31512798-31512820 CTTGGGGAGGCCGAGGCTGGTGG + Intergenic
1006475272 6:34248978-34249000 GTCGGGGCTGCAGCGGCGGGAGG - Exonic
1006508177 6:34504532-34504554 CTTGGGGAAGCCGAGGCAGGTGG - Intronic
1006645791 6:35513086-35513108 CTCGGGGCAGGTGGAGCTGGTGG - Intergenic
1006793295 6:36717294-36717316 GTGGGGGCAGCTGCGGCAGGAGG + Exonic
1006814459 6:36840571-36840593 CTTGGCGAGGCCGCGGCTGGCGG - Intergenic
1007644248 6:43368821-43368843 CTCGGGGATGCCGAGCCTGGAGG - Intronic
1009200884 6:60744067-60744089 CTTTGGGAAGCCGAGGCTGGCGG - Intergenic
1012704081 6:102499013-102499035 CTTGGGGAGGCCGAGGCTGGCGG + Intergenic
1014441118 6:121475006-121475028 CTTGGGGAAGCTGAGGCTGGAGG - Intergenic
1014986790 6:128021391-128021413 CTCTGGGAGGCCGAGGCTGGTGG + Intronic
1015569227 6:134604524-134604546 CTCGGGGCCGCTGCTGCTGATGG - Intergenic
1017726540 6:157280308-157280330 CTGGGTGGAGCCGCGGCTGAGGG + Intergenic
1017836709 6:158185294-158185316 CACTGGGAAGCCGAGGCTGGAGG + Intronic
1018079470 6:160246501-160246523 CTTTGGGAAGCCGAGGCTGGTGG + Intronic
1019184142 6:170211229-170211251 AGAGGGGCAGACGCGGCTGGCGG - Intergenic
1019293319 7:260992-261014 CTCGGGGCCGCCGCAGCTTTGGG - Intergenic
1019316838 7:390847-390869 CTGGGGGCTGCAGGGGCTGGCGG + Intergenic
1019610981 7:1936544-1936566 CTGTGGGCAGCCGGGTCTGGTGG - Intronic
1019614898 7:1954797-1954819 CTCGGGGCACCCACGGACGGTGG - Intronic
1019684656 7:2374457-2374479 GCCGGGGCAGCCAAGGCTGGAGG - Intronic
1019828408 7:3301816-3301838 GGCCGGGCCGCCGCGGCTGGTGG + Exonic
1019898227 7:3999563-3999585 CTCGGGGCGGGGGAGGCTGGTGG + Intronic
1020074343 7:5248090-5248112 CTTTGGGAAGCCGAGGCTGGTGG - Intergenic
1020137324 7:5594399-5594421 CGCGGGGCAGACGCGGGAGGAGG - Intronic
1020185619 7:5957231-5957253 CTCTGGGAAGCCGAGGCAGGTGG + Intronic
1020297297 7:6767525-6767547 CTCTGGGAAGCCGAGGCAGGTGG - Intronic
1021162948 7:17298743-17298765 CTGGGAGCAGCCGGGACTGGTGG + Exonic
1021230843 7:18085529-18085551 CTTTGGGAAGCCGAGGCTGGAGG - Intergenic
1021313174 7:19117146-19117168 CCCGGCGGAGCCGCGGGTGGGGG - Exonic
1021414819 7:20370855-20370877 CTTTGGGAAGCCGAGGCTGGTGG - Intronic
1021767955 7:23968260-23968282 CTGGTGGCAGCCAGGGCTGGAGG + Intergenic
1022427960 7:30285571-30285593 CGCGGGGCCGCCGGGGCTGCCGG - Exonic
1023239652 7:38130020-38130042 CTTTGGGAAGCCGAGGCTGGTGG + Intergenic
1023741342 7:43283913-43283935 CTCAAGGCAGCCGCAGCTGGGGG - Intronic
1023796262 7:43794965-43794987 CTTTGGGAAGCCGAGGCTGGTGG + Intronic
1023797010 7:43801889-43801911 CTTGGGGAAGCTGAGGCTGGTGG + Intronic
1024794281 7:53003855-53003877 CACGGTGCAGCGGCGGCTGAAGG - Intergenic
1026145326 7:67741458-67741480 CTCTGGGAAGCCGAGGCAGGAGG - Intergenic
1026360870 7:69599741-69599763 CTGGGGGCCGGCGCGGCCGGCGG + Exonic
1026767356 7:73168643-73168665 CTCTGGGAGGCCGAGGCTGGTGG - Intergenic
1026909430 7:74083811-74083833 CTCGGCGCCGCGGCGGCTTGGGG - Intronic
1027001564 7:74657963-74657985 CGCGGAGCAGCCTCGGCTGAGGG - Intronic
1027043823 7:74978345-74978367 CTCTGGGAGGCCGAGGCTGGTGG - Intronic
1027047252 7:74999251-74999273 CTTGGGGAAGCCGAGGCGGGTGG - Intronic
1027079822 7:75224007-75224029 CTCTGGGAGGCCGAGGCTGGTGG + Intergenic
1027192634 7:76005998-76006020 CTTTGGGCAGCCGAGGCAGGTGG - Intronic
1027449720 7:78317533-78317555 CTGGGGGAAGGCGCGGCTGTGGG + Intronic
1029389035 7:100262597-100262619 CTCTGGGAGGCCGAGGCTGGTGG + Intronic
1029498443 7:100911696-100911718 CTCTGGGAAGCTGAGGCTGGAGG + Intergenic
1030022491 7:105289504-105289526 CTCTGGGAAGCTGCGGCAGGAGG + Intronic
1033300019 7:140177057-140177079 CGCGAGGCCGCGGCGGCTGGCGG + Intergenic
1033406056 7:141072767-141072789 CTCGGAGCCGCCGCGGCTAGAGG + Intergenic
1033788213 7:144759692-144759714 CTCTGGGAAGCCGAGGCAGGAGG + Intronic
1034417533 7:150972927-150972949 CTCTTGGCAGCAGCGGCTGAGGG - Intronic
1034939022 7:155218508-155218530 CTCGGGGCACCCCAGGCTGAGGG + Intergenic
1035022683 7:155808602-155808624 CTCCGCGCGGCCTCGGCTGGCGG + Intronic
1035059215 7:156056718-156056740 CTCGGTGGTGCCGGGGCTGGGGG + Intergenic
1036083084 8:5579730-5579752 CTTGGGGAGGCCGAGGCTGGTGG + Intergenic
1036646256 8:10612709-10612731 CTCGGGGAGGCCGGTGCTGGAGG + Exonic
1036902980 8:12685792-12685814 CTTTGGGCAGCCGAGGCTGATGG + Intergenic
1036905389 8:12704707-12704729 CTTTGGGCAGCCGAGGCTGATGG + Intergenic
1037425784 8:18753111-18753133 CTCTGGGAAGCCGAGGCAGGTGG + Intronic
1037585328 8:20271904-20271926 GGTGGGGCAGCCGCAGCTGGGGG + Intronic
1038492602 8:27981517-27981539 CACGGGGGAGCCCCGGCAGGAGG - Intronic
1039471519 8:37816179-37816201 CTCTGGGAGGCCGAGGCTGGAGG + Intronic
1039893632 8:41701010-41701032 CTTTGGGCAGCCGAGGTTGGAGG - Intronic
1040045388 8:42958073-42958095 CTTTGGGAAGCCGAGGCTGGTGG - Intronic
1040328398 8:46373884-46373906 TCCAGGGCACCCGCGGCTGGGGG - Intergenic
1040477037 8:47787774-47787796 CTGGGGGCAGGCTAGGCTGGAGG + Intronic
1041005594 8:53494579-53494601 CTCTGGGAGGCCGAGGCTGGTGG + Intergenic
1042109361 8:65363609-65363631 CTCTGGGAAGCCGAGGCAGGCGG - Intergenic
1042902913 8:73746593-73746615 CTCGGGGCAGCAGCGGGGAGGGG - Intronic
1042909791 8:73814761-73814783 CTCTGGGAAGCCGAGGCGGGCGG - Intronic
1043748780 8:83909203-83909225 CTCGGGGAAGGGGCGGCTGTGGG + Intergenic
1043813282 8:84769515-84769537 CTGTGGGAAGCCGAGGCTGGAGG + Intronic
1044678718 8:94755539-94755561 TTGGGGGCAGCGGGGGCTGGGGG + Intronic
1046721172 8:117620666-117620688 CTTGGGGAAGCCGAGGCAGGCGG - Intergenic
1047257908 8:123229771-123229793 CTCTGGGAAGCCGAGGCGGGTGG + Intronic
1049102803 8:140591079-140591101 CTGGGTGCAGCCCCGGGTGGGGG + Intronic
1049405407 8:142449964-142449986 CCGGGGGCGGCGGCGGCTGGAGG + Exonic
1049427071 8:142542427-142542449 CTCGGGGGGCCCGCCGCTGGGGG - Exonic
1049473821 8:142787848-142787870 CACGTGGCAGCGGCGGCAGGAGG - Intergenic
1049585261 8:143430064-143430086 CTCGGGGAAGCCGGCGCTGGAGG - Exonic
1049602441 8:143514163-143514185 CTCGGGGAAGCCGCTCCTGATGG - Intronic
1049680633 8:143916425-143916447 CACGGGGCTGCGGCTGCTGGAGG - Exonic
1049680733 8:143916881-143916903 CACGGGGCAGCGGCTGCTGGAGG - Exonic
1049974023 9:844963-844985 CTCTGGGAAGCCGAGGCGGGTGG - Intronic
1052864531 9:33457023-33457045 CTCTGGCCAGCCCCGTCTGGTGG + Intergenic
1052919897 9:33956872-33956894 CTCTGGGCAGCCGAGGCAGGAGG + Intronic
1053074024 9:35117366-35117388 CTTTGGGCAGCCGAGGCGGGCGG - Intergenic
1053288187 9:36863370-36863392 CTCGGGGAGGCCGAGGCGGGAGG - Intronic
1053732877 9:41074813-41074835 CTGGGGCCAGGCGCGGGTGGAGG - Intergenic
1054695552 9:68356741-68356763 CTGGGGCCAGGCGCGGGTGGAGG + Intronic
1055823844 9:80300873-80300895 CTCAGGGAAGCGGCGGCTGTGGG - Intergenic
1056850693 9:90081357-90081379 ATCTGGTCAGCCGTGGCTGGGGG + Intergenic
1057596229 9:96418045-96418067 CCCGGGGCCGCCGGAGCTGGGGG - Exonic
1057611446 9:96547219-96547241 CTCTGGGAAGCCGAGGCTGGTGG + Intronic
1057767228 9:97932560-97932582 CTCTGGGAGGCCGAGGCTGGTGG + Intronic
1057778456 9:98029718-98029740 CTGGGAGCAGCTGCGGCTGGAGG + Intergenic
1058332212 9:103776861-103776883 CTCTGGGAAGCCAAGGCTGGTGG - Intergenic
1058668279 9:107340035-107340057 CTTTGGGAAGCCGAGGCTGGCGG + Intergenic
1058693746 9:107541416-107541438 CTTTGGGCAGCCGAGGATGGAGG + Intergenic
1058991093 9:110256016-110256038 GTCCGGGCAGCCCCGACTGGAGG - Intronic
1059101602 9:111477353-111477375 CTCTGGGAGGCCGAGGCTGGGGG - Intronic
1059116812 9:111607292-111607314 CTTTGGGAAGCCGAGGCTGGTGG - Intergenic
1059989624 9:119853057-119853079 CTCGGGGCATCAGCATCTGGTGG - Intergenic
1060197224 9:121631572-121631594 CTCTGGGAGGCCGAGGCTGGCGG + Intronic
1060549444 9:124478049-124478071 CGCGGGGCAGCGGAGGCTGCCGG + Intronic
1060643996 9:125262243-125262265 CGCGGGGCGGCCTCGGGTGGGGG + Intronic
1061050549 9:128192144-128192166 CTCTGGGAGGCCGAGGCTGGAGG + Intronic
1061198631 9:129122983-129123005 CTCGGGGCAGGTGGGGCGGGGGG + Intronic
1061408142 9:130403847-130403869 CATGGGGAAGACGCGGCTGGTGG + Intronic
1061433080 9:130543466-130543488 CTCTGGGGAGCCAGGGCTGGAGG - Intergenic
1061500644 9:130999779-130999801 CTTTGGGAAGCCGAGGCTGGTGG - Intergenic
1061580903 9:131535380-131535402 CTCTGGGAAGCCGAGGCAGGAGG - Intergenic
1061664929 9:132155117-132155139 CTCGGGGCAGCAGGGGCGTGTGG - Intergenic
1062562621 9:137148428-137148450 CTCGAGGCAGGCGCGGCTGCAGG + Intronic
1062600459 9:137316683-137316705 CTCCGGGCTGCAGGGGCTGGGGG + Intronic
1203567234 Un_KI270744v1:101608-101630 CTTTGGGAAGCCGAGGCTGGTGG + Intergenic
1185468751 X:370399-370421 CTCGCTGCAGCCGTGGCTGCAGG - Intronic
1187135517 X:16543657-16543679 CTTTGGGAAGCCGCGGCGGGTGG + Intergenic
1188427582 X:30067218-30067240 CTTGGAGCAGCCTCAGCTGGGGG + Intergenic
1190285590 X:48958903-48958925 CTCTGGGAAGCCGAGGCGGGAGG - Intergenic
1192403606 X:70861708-70861730 CTTTGGGAAGCCGAGGCTGGTGG - Intronic
1192453953 X:71262185-71262207 CTCTGGGAAGCTGAGGCTGGTGG - Intergenic
1193810365 X:86043667-86043689 CTTGGGGAAGCCGAGGCAGGTGG - Intronic
1194719168 X:97320468-97320490 CTCTGGGAAGCCGAGGCGGGCGG + Intronic
1195345361 X:103945019-103945041 CTCTGGGAGGCCGAGGCTGGTGG - Intronic
1195923529 X:110003873-110003895 CTCTTGGCAGCAGCGGCTGCTGG + Exonic
1197199857 X:123738916-123738938 CTTTGGGAAGCCGAGGCTGGCGG + Intergenic
1198767785 X:140095937-140095959 CTTGGGGAGGCCGAGGCTGGTGG - Intergenic
1198860238 X:141061287-141061309 CTTTGGGCAGCCGAGGCGGGCGG - Intergenic
1198902453 X:141526103-141526125 CTTTGGGCAGCCGAGGCGGGCGG + Intergenic
1200065857 X:153503787-153503809 CTCTGGGCTGCCGAGGCTGTGGG + Intronic