ID: 928186656

View in Genome Browser
Species Human (GRCh38)
Location 2:29115992-29116014
Sequence ACTCTCGGGGCAGCCGCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928186656_928186665 7 Left 928186656 2:29115992-29116014 CCAGCCGCGGCTGCCCCGAGAGT 0: 1
1: 0
2: 0
3: 16
4: 148
Right 928186665 2:29116022-29116044 CGCGCAGTGGCTTTCCAACGCGG 0: 1
1: 0
2: 0
3: 2
4: 35
928186656_928186661 -6 Left 928186656 2:29115992-29116014 CCAGCCGCGGCTGCCCCGAGAGT 0: 1
1: 0
2: 0
3: 16
4: 148
Right 928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928186656 Original CRISPR ACTCTCGGGGCAGCCGCGGC TGG (reversed) Intronic
900495694 1:2975012-2975034 ACTCTCCAGGCAGCCGAGGCTGG - Intergenic
900532523 1:3161693-3161715 AATCTCGAGGCTCCCGCGGCCGG - Intronic
902190443 1:14759158-14759180 ACACACAGGGCAGCCACGGCAGG + Intronic
902749457 1:18497320-18497342 ACTCTAGGCTCAGCTGCGGCTGG + Intergenic
905299654 1:36977898-36977920 ACTCTGGGGGCAGGCCCTGCAGG + Intronic
905783944 1:40737573-40737595 ACACTCTGGGAAGCCGAGGCAGG - Intronic
907188918 1:52632996-52633018 AGTCTCGGGGCATTCGGGGCTGG - Intergenic
912305233 1:108560242-108560264 CCTCTCGCGGCAGCCTGGGCCGG - Exonic
912515106 1:110212101-110212123 GGTCTGGGGGCTGCCGCGGCTGG + Exonic
913042525 1:115041237-115041259 ACTCTCGTGGCTGCTGCAGCTGG - Intergenic
913615797 1:120558494-120558516 GCTCCCGGAGCAGCAGCGGCCGG + Intergenic
914574478 1:148952408-148952430 GCTCCCGGAGCAGCAGCGGCCGG - Intronic
915070333 1:153261125-153261147 ACTCTGGCGGCGGCTGCGGCGGG + Exonic
915556741 1:156665003-156665025 ACTCTGGTGGCAGTGGCGGCAGG + Intergenic
915916858 1:159945632-159945654 GCGCTCGGGGCATCCGAGGCGGG - Intergenic
922527743 1:226318684-226318706 ACTCCCTGGGCAGCCAAGGCTGG + Intergenic
923986560 1:239387874-239387896 ACTCGCGAGGCAGCGGCCGCTGG + Intronic
924697161 1:246412610-246412632 ACACTTTGGGCAGCCGAGGCAGG + Intronic
1065625794 10:27627108-27627130 ACTGCCGGGGCTGCCGGGGCTGG + Intergenic
1066121271 10:32289868-32289890 GCTCTCTGGGAAGCCGAGGCAGG - Intronic
1070032614 10:72692192-72692214 CCTCTCGGGGCGGCGGCGGCGGG + Exonic
1075111638 10:119591155-119591177 ACACTCTGGGAAGCCGAGGCAGG + Intronic
1075159123 10:120007820-120007842 ACACTTTGGGCAGCCGAGGCAGG - Intergenic
1076681020 10:132171221-132171243 ACACTCGGAGCAGACGCGGTGGG - Intronic
1076910990 10:133389418-133389440 GCTCTCGGGTCAGAGGCGGCAGG + Intronic
1077614942 11:3667762-3667784 GCTCTGGGGGCAGGCGGGGCAGG + Exonic
1079130739 11:17745513-17745535 TCTCTCAGGGCAGCCAGGGCCGG + Intronic
1080609716 11:33893256-33893278 TCTCCCGGCGCAGCCGCGGCAGG - Intergenic
1081670602 11:44940140-44940162 ACTTTCAGGGCAGCCTCGCCTGG - Intronic
1083209647 11:61175161-61175183 ACAGTGGGGGCAGCCCCGGCTGG - Intergenic
1087249562 11:95882251-95882273 ACTCTCGGGGGGGCCGAGGTGGG + Intronic
1091653394 12:2326034-2326056 ACTCTGGGGGCAGCAGGGGGAGG + Intronic
1092318026 12:7440199-7440221 ACACTCGCGTCGGCCGCGGCCGG + Intronic
1096245214 12:49981045-49981067 CCTCTCTGGGCAGCTGTGGCAGG + Intronic
1096777790 12:53974516-53974538 ACTCTGGGGTCAGCGGCGACAGG + Intronic
1101970453 12:109309130-109309152 CCTCGCGGGGCCGCCGCTGCCGG + Exonic
1111975996 13:94967941-94967963 ACGCACGGGGCAGCCGCGGAGGG + Intergenic
1114385393 14:22249112-22249134 ACACTCTGGGCAGCCAAGGCGGG - Intergenic
1118137453 14:63045405-63045427 ACAGTCTGGGCAGCGGCGGCCGG - Exonic
1122881611 14:104692906-104692928 AGGCTCGGGGCAGCCCAGGCTGG - Intronic
1122904460 14:104795478-104795500 ACTCACCGGGCCGCCGCGTCCGG + Intronic
1123630561 15:22257616-22257638 CCTCTCCGGGCAGCCCGGGCCGG - Intergenic
1126705668 15:51402782-51402804 ACACTGGCGTCAGCCGCGGCAGG + Intronic
1127121517 15:55776143-55776165 ACTCTTTGGGAAGCCGAGGCAGG - Intergenic
1127588341 15:60398214-60398236 GGCCTCGGGGCAGCCTCGGCCGG - Intronic
1129371421 15:75098278-75098300 ACTCGCGGGGCAAGAGCGGCTGG + Intronic
1129737659 15:77975065-77975087 CCTCTGGGGGCAGCAGTGGCTGG - Intergenic
1132326244 15:100973103-100973125 ACTCACGGGGCGGCCACGGCAGG - Intronic
1132815302 16:1823056-1823078 ACTCAGCGGGCAGCCGCGCCAGG + Intronic
1133208298 16:4247431-4247453 ACACTTTGGGCAGCCGAGGCAGG + Intergenic
1134522914 16:14926738-14926760 GCTCCCGGGGCTGCTGCGGCAGG + Intronic
1134549713 16:15133320-15133342 GCTCCCGGGGCTGCTGCGGCAGG - Intronic
1134710582 16:16325389-16325411 GCTCCCGGGGCTGCTGCGGCAGG + Intergenic
1134718752 16:16369677-16369699 GCTCCCGGGGCTGCTGCGGCAGG + Intergenic
1134949020 16:18343256-18343278 GCTCCCGGGGCTGCTGCGGCAGG - Intergenic
1134956004 16:18382482-18382504 GCTCCCGGGGCTGCTGCGGCAGG - Intergenic
1136153093 16:28364963-28364985 ACACCCGGGGCGGCCGCGGCAGG - Intergenic
1136209990 16:28750310-28750332 ACACCCGGGGCGGCCGCGGCAGG + Intergenic
1139570221 16:67806940-67806962 ACTCTCAGGGCACCCGCTGCCGG + Intronic
1140475582 16:75237969-75237991 TCCCCCGGGGCAGGCGCGGCAGG - Intronic
1141079325 16:81036368-81036390 ACCCTCGCGGCAGGCGCCGCAGG + Intronic
1143668890 17:8383072-8383094 ACTCTCGGGGTCCCCGCGGTCGG + Exonic
1143831373 17:9654400-9654422 ACACTTGGGGAAGCCGAGGCGGG + Intronic
1144547943 17:16215274-16215296 GCTCCCGGGGCAGCAGCCGCTGG - Intronic
1144828813 17:18120849-18120871 GCTCTCGGGCCTGCCCCGGCCGG + Exonic
1146658659 17:34650136-34650158 AGTCTCTGGGCAGGCGTGGCAGG + Intergenic
1150259211 17:63774492-63774514 AGCCTCGGGGCACCGGCGGCCGG + Intronic
1151724826 17:75877836-75877858 ACACTCGGGTGAGCCGGGGCTGG - Intronic
1152637550 17:81436305-81436327 CCTCTGGGGGCAGCTGCGGGTGG - Intronic
1152944514 17:83191758-83191780 GCCCTCGGGGCAGCCCCAGCCGG - Intergenic
1153006130 18:500318-500340 GCTCCCGGGTCAGGCGCGGCTGG - Intronic
1155972259 18:32092982-32093004 ACGCTCGGGCAGGCCGCGGCGGG - Intronic
1158649610 18:59273628-59273650 ACACTCCGGGGATCCGCGGCGGG + Intronic
1160720955 19:596726-596748 ACACTCTGTGCAGCCGCGTCCGG - Intronic
1161207198 19:3047264-3047286 AAGCGCGGGGCGGCCGCGGCGGG + Intronic
1161306847 19:3573331-3573353 ACTCACGCGGCGGCCGCGCCGGG - Exonic
1161963362 19:7534917-7534939 ACTGCCGGGGCATCCGCGGAAGG - Intronic
1162038619 19:7955991-7956013 ACGCTCTGGGCAGCAGGGGCAGG - Intergenic
1162711332 19:12597049-12597071 ACCCTCGGGTCAGCTGCGCCAGG + Intronic
1163635025 19:18433690-18433712 ACTCTGGGGGCGGCCGCCGTCGG - Exonic
1167619974 19:50555333-50555355 TCTCCCGGGGCAGCTGCGGTGGG - Intronic
1167645312 19:50702576-50702598 GCTCCCTGGGCAGCCGCGGGAGG - Exonic
1168335933 19:55597804-55597826 ACCCTGGGGGCGGCAGCGGCGGG + Exonic
1168702845 19:58451875-58451897 AGGCGCGGGGCAGCCGCGGGAGG + Intronic
928186656 2:29115992-29116014 ACTCTCGGGGCAGCCGCGGCTGG - Intronic
931517829 2:63059934-63059956 AGTCCCTGGGCAGCGGCGGCGGG + Intergenic
931587012 2:63840621-63840643 TCCCTCGGGGCAGCTGCGGTGGG + Intergenic
933211312 2:79572503-79572525 ACTCTCTGGGAGGCCGAGGCGGG + Intronic
937218865 2:120329983-120330005 ACTCCAGGGGCAGCCCCGACTGG + Intergenic
938875918 2:135531490-135531512 GCTCCAGCGGCAGCCGCGGCTGG - Intronic
940140626 2:150487235-150487257 CCCCTCGTGGAAGCCGCGGCCGG + Intronic
942061870 2:172234875-172234897 ACACTGGGGGGAGCAGCGGCGGG + Intergenic
946358789 2:219206729-219206751 AGTCTCCGGGCAGCCGGGGAGGG - Intronic
948754080 2:240149185-240149207 AGTCTCAGGGCAGCCCCAGCAGG + Intergenic
1175309189 20:57999580-57999602 ACTGTCAGGGCGGCCTCGGCAGG + Intergenic
1176201265 20:63861691-63861713 ACCTGCGCGGCAGCCGCGGCGGG + Exonic
1176457973 21:6929340-6929362 ACTCTCCAGGCAGCCTTGGCAGG - Intergenic
1176836145 21:13794424-13794446 ACTCTCCAGGCAGCCTTGGCAGG - Intergenic
1178476113 21:32938719-32938741 CCTCTGGGGGCAGACGGGGCAGG + Intergenic
1181085556 22:20437892-20437914 GATCCCGGGCCAGCCGCGGCCGG + Intronic
1181478237 22:23181357-23181379 AGGCCCGGGGCAGCCGCGTCGGG + Exonic
1181932962 22:26417569-26417591 ACTCTACAGGCAGCCCCGGCAGG + Intergenic
1183657027 22:39192220-39192242 ACTCTCTGGGAGGCCGAGGCGGG - Intergenic
1184240794 22:43210401-43210423 GCTCTGGGGGCAGCCCAGGCAGG - Intronic
1185043566 22:48517835-48517857 CCTCTCTGGGCAGGCACGGCCGG + Intronic
1185340564 22:50289077-50289099 ACCCGCTGGGCAGCCGCGACGGG - Exonic
953027422 3:39153196-39153218 TCTCTCGGGGTTACCGCGGCGGG + Intronic
953635715 3:44662228-44662250 ACACTCTGGGAAGCCGAGGCAGG - Intergenic
954618979 3:51985133-51985155 ACTCTCCGGGCTGCCTGGGCTGG + Intronic
954737476 3:52718224-52718246 ACTCTCTGGGAGGCCGAGGCAGG + Intronic
958126097 3:89356856-89356878 ACACTTTGGGCAGCCGAGGCGGG + Intronic
961359356 3:126357318-126357340 ACTCTCGGTCCGGCGGCGGCCGG + Exonic
962460022 3:135602779-135602801 ACACTTTGGGCAGCCGAGGCGGG + Intergenic
964251545 3:154723770-154723792 AATCTTGGGGCAGCAGCTGCTGG - Intergenic
966860843 3:184230226-184230248 ACCCCCGGGGGAGCCGCGGCGGG + Intronic
968593333 4:1470560-1470582 ACCCTCGGGGCAGCAGTGCCAGG - Intergenic
969318479 4:6396076-6396098 ACCCTCGCGGCAGCCCTGGCAGG + Intronic
969352932 4:6608622-6608644 ACTCCCGAGGCATCCGAGGCTGG - Intronic
974026196 4:56735455-56735477 ACTCTTGGGGAAGCCGAGGAGGG + Intergenic
980730124 4:136812789-136812811 ACTCTCCCTGCAGCAGCGGCGGG + Intergenic
984710528 4:182880512-182880534 ACTCTCGGAGGAGCAGCAGCAGG - Intergenic
995841567 5:116447375-116447397 CCACTCGCGGCTGCCGCGGCTGG + Exonic
998149065 5:139746784-139746806 GCTCCCGGGGAAGCCGAGGCGGG + Intergenic
1000671823 5:164072687-164072709 GCACTTGGGGCAGCCGAGGCAGG - Intergenic
1002784484 6:391563-391585 AGGCTGGGGGCTGCCGCGGCCGG - Intergenic
1002951860 6:1821347-1821369 ACTGCCAGGGGAGCCGCGGCTGG + Intronic
1004562127 6:16760991-16761013 ACTCTGGGCGCAGGGGCGGCCGG - Intronic
1006366935 6:33621461-33621483 ACGCTCGGTGCGGCCGGGGCGGG - Exonic
1006475273 6:34248981-34249003 CCTGTCGGGGCTGCAGCGGCGGG - Exonic
1006793294 6:36717291-36717313 ACTGTGGGGGCAGCTGCGGCAGG + Exonic
1007482358 6:42158444-42158466 ACTCTGGGGGCAGCAGGGGTAGG - Intronic
1015737001 6:136411647-136411669 GCTCCCGGGCCAGCCGCTGCCGG + Exonic
1017727464 6:157285496-157285518 CCTCTCGGGACAGCTGGGGCTGG + Intergenic
1018767750 6:166947039-166947061 ACTCTGGGGTCAGCCCCGGCTGG + Intronic
1019577360 7:1743930-1743952 ACTCTCGGCGCAACCCCGGTCGG - Intronic
1019708668 7:2508395-2508417 CATCTCGGGGCAGCCGGGTCGGG + Intergenic
1021245941 7:18261054-18261076 ACTCTCTGGGAGGCCGAGGCAGG + Intronic
1023741345 7:43283916-43283938 ACACTCAAGGCAGCCGCAGCTGG - Intronic
1026153849 7:67810682-67810704 ACTCTCTGGGAGGCCGAGGCAGG - Intergenic
1026891249 7:73984052-73984074 ACTCTCGGGGGAGCAGCCTCAGG + Intergenic
1027673620 7:81132388-81132410 ACACTTGGGGAAGCCGAGGCAGG - Intergenic
1032387770 7:131536506-131536528 ACCCTCGGGCCAGCAGCAGCTGG + Intronic
1034344721 7:150379294-150379316 ATTCCCGGGGCAGGCGGGGCGGG - Intronic
1034531090 7:151696953-151696975 GCTCTCGGGGAATCTGCGGCAGG - Intronic
1038492603 8:27981520-27981542 ACTCACGGGGGAGCCCCGGCAGG - Intronic
1039602375 8:38850988-38851010 ACTATCTGGGCAGCCACGGGGGG - Exonic
1043372691 8:79612194-79612216 TCTCTCTTGGAAGCCGCGGCGGG - Intronic
1046030390 8:108776244-108776266 ACACTTCGGGCAGCCGAGGCAGG + Intronic
1048593303 8:135841583-135841605 AGTCTCAGGGCAGCCGCAGGCGG - Intergenic
1049355970 8:142188235-142188257 ACCCTCAGGGCAGCTGCGTCCGG + Intergenic
1049561166 8:143311213-143311235 ACACTCTGGGCAGCCGAGGCAGG - Intronic
1049713508 8:144078415-144078437 GCTATCGGGGAAGCAGCGGCTGG - Intergenic
1052919896 9:33956869-33956891 ACACTCTGGGCAGCCGAGGCAGG + Intronic
1053032112 9:34789231-34789253 ACTCTCGGGGCTGCTGCTGCTGG + Intergenic
1053074025 9:35117369-35117391 ACACTTTGGGCAGCCGAGGCGGG - Intergenic
1053349806 9:37405929-37405951 ACACTTTGGGAAGCCGCGGCGGG + Intergenic
1060516899 9:124271635-124271657 ACTCTGGGGCCAGCCGGGCCTGG - Intronic
1061450202 9:130663574-130663596 GCTCACGGGGCTGCCGAGGCGGG - Intergenic
1061899211 9:133664398-133664420 TCCCTCGGGGCAGGGGCGGCTGG + Intronic
1062452945 9:136623156-136623178 GCTCTCAGGGCAGCCCCGGCCGG + Intergenic
1187166182 X:16806272-16806294 ACTCTCGGGGCATCAGCTACTGG - Intronic
1189988458 X:46573940-46573962 ACTCTCGGCGTCGCCGCCGCCGG - Exonic
1190522950 X:51298746-51298768 ACTCTATTGGCAGCCGCAGCTGG - Intergenic
1194350247 X:92818170-92818192 TCTCTCGGGGCAGATGAGGCAGG - Intergenic
1200658567 Y:5934812-5934834 TCTCTCGGGGCAGATGAGGCAGG - Intergenic