ID: 928186657

View in Genome Browser
Species Human (GRCh38)
Location 2:29115996-29116018
Sequence GGGGACTCTCGGGGCAGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928186657_928186661 -10 Left 928186657 2:29115996-29116018 CCGCGGCTGCCCCGAGAGTCCCC 0: 1
1: 0
2: 1
3: 16
4: 206
Right 928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
928186657_928186665 3 Left 928186657 2:29115996-29116018 CCGCGGCTGCCCCGAGAGTCCCC 0: 1
1: 0
2: 1
3: 16
4: 206
Right 928186665 2:29116022-29116044 CGCGCAGTGGCTTTCCAACGCGG 0: 1
1: 0
2: 0
3: 2
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928186657 Original CRISPR GGGGACTCTCGGGGCAGCCG CGG (reversed) Intronic
900121421 1:1050048-1050070 TGGGGCTCTCGGGGCAGGGGGGG + Intronic
900323490 1:2096133-2096155 GGCCAGTCTTGGGGCAGCCGAGG - Intronic
900704660 1:4072870-4072892 TAGGACCCTCGGGGCAGCAGAGG + Intergenic
900935930 1:5766409-5766431 GGGGAGGGTTGGGGCAGCCGGGG - Intergenic
901149950 1:7094718-7094740 GGGGACCCTGGGGGCAGCCGCGG + Intronic
901190415 1:7406790-7406812 GGGGGCTGTGGGGGCAGCAGTGG - Intronic
901407531 1:9059431-9059453 GGGGGCTCTCTGGCCAGGCGTGG - Intronic
903155454 1:21439793-21439815 GGGGACGCTCCGGGCCTCCGAGG + Intergenic
903263351 1:22142913-22142935 GGGGACTCATGGTGCCGCCGCGG + Exonic
903335533 1:22621939-22621961 GTGGACTCTAGGGCCAGCCTGGG - Intergenic
903801558 1:25972522-25972544 TGGGGCTCTTGGGGCAGCTGTGG - Intronic
904026820 1:27509288-27509310 GGGAACTCTTGGGGCAGTGGGGG - Intergenic
904163344 1:28536979-28537001 GTCCACTCTCGGGGGAGCCGAGG + Intronic
906147202 1:43567192-43567214 GGGGACACTCGGGGCTGCTAGGG - Intronic
906676075 1:47694461-47694483 GGGGACTGTGGGGGCTGCAGGGG + Intergenic
907188919 1:52633000-52633022 CGGGAGTCTCGGGGCATTCGGGG - Intergenic
907300247 1:53482479-53482501 GGGTACTCTGGGGGCATCCTGGG + Intergenic
912383305 1:109259093-109259115 GGGGACTCATGGGCCAGCCCTGG + Intronic
915477431 1:156161225-156161247 GGGGACACGCGGGGCTGGCGGGG + Intronic
915916860 1:159945636-159945658 GGAGGCGCTCGGGGCATCCGAGG - Intergenic
922726408 1:227924977-227924999 GAGGGCTGTCGGGGCAGCCCCGG + Intronic
923561672 1:235046416-235046438 GGGGATTCTCTCGACAGCCGCGG + Intergenic
924631786 1:245747687-245747709 GGGGTCTGTCGGGGCAGTGGGGG + Intergenic
1063504053 10:6580281-6580303 GGGGACTGGCGGGGCTGGCGGGG + Exonic
1065383600 10:25113479-25113501 AGGGACTGTCTGGTCAGCCGCGG - Intergenic
1067111997 10:43407754-43407776 GAGGACACGCGGCGCAGCCGAGG + Intronic
1072784102 10:98268501-98268523 AGGGACTCCCGAGGCCGCCGCGG - Intergenic
1075369950 10:121927698-121927720 GGGCACTCTCGGGAGGGCCGCGG - Intronic
1075413862 10:122248571-122248593 TGGGTCTCTGGGGCCAGCCGAGG - Intronic
1076129347 10:128002110-128002132 GGGGACCTCCGGGGCAGCCACGG + Intronic
1077162980 11:1122006-1122028 GGGGGCTCCCAGGGCAGCAGGGG - Intergenic
1077529955 11:3090412-3090434 GGGGCCCCTCAGGGCAGCAGAGG + Intronic
1078348628 11:10573949-10573971 AGGGACTCTGGGGGCAGAAGTGG - Exonic
1078594558 11:12674869-12674891 GGGGGCGCACGGGGCAGCGGGGG + Intronic
1079143307 11:17828824-17828846 AGGGACTCTCGGGGAAGCAGGGG - Intronic
1083052139 11:59786880-59786902 GGGTACTCACTGGGCAGCTGAGG + Intronic
1083267880 11:61555314-61555336 TGGGACTTTGGGGGCAGCAGGGG - Intronic
1084325182 11:68396117-68396139 GGGGACTCTGGGGACAGCTGAGG + Intronic
1084892513 11:72243651-72243673 GGGGTCTCTCGGGGCATTGGAGG + Intronic
1089129300 11:116199541-116199563 GGAGACACTGGGGGCAGCCGTGG + Intergenic
1089796612 11:120986146-120986168 GGCGGCACTCGGGGCAGACGCGG - Exonic
1091305159 11:134531865-134531887 GTGGACTCTCACAGCAGCCGAGG - Intergenic
1091387665 12:105092-105114 GGGGCCTGTGGGGGAAGCCGAGG - Intronic
1091969392 12:4772994-4773016 GGGGACTCCCCAGGCTGCCGGGG + Intronic
1092471322 12:8784572-8784594 GGAGACTCTCAGAGCAGCTGAGG - Intergenic
1092905996 12:13101202-13101224 GGGGCCTCTCGGGGGTGCCTGGG + Intronic
1096560700 12:52433953-52433975 GGGGACACACGGGGAAGCTGGGG + Exonic
1099632134 12:85163918-85163940 GGTGACTCTGGGGACAGGCGTGG - Intronic
1101371766 12:104137695-104137717 GGGGACTCGCGCCGCCGCCGGGG + Intronic
1103584571 12:121942471-121942493 TGGGACTCTCTGGGAAGCCAGGG + Intronic
1103836234 12:123823338-123823360 AGGGACTCCGGAGGCAGCCGGGG + Intronic
1104990921 12:132623434-132623456 GGGGTCGCCCGGTGCAGCCGTGG - Intergenic
1110630323 13:77698622-77698644 GGGTCCCCTCGCGGCAGCCGGGG + Intronic
1111975994 13:94967937-94967959 TGGGACGCACGGGGCAGCCGCGG + Intergenic
1112599347 13:100839997-100840019 GGGGACTGTGGGGGCAGTCATGG + Intergenic
1113799075 13:113077244-113077266 TGGGACCCTCGGGGGAGCCCCGG + Intronic
1113945364 13:114040976-114040998 TGAGACTCTCGGCGCAGCCCCGG - Intronic
1113961150 13:114126928-114126950 GGGGGCCCTCGGGGGAGACGTGG - Intronic
1115107188 14:29775502-29775524 GGGGACCCTCGAGCCAGGCGTGG - Intronic
1119656607 14:76421753-76421775 GGGGACTGGAGGGGCAGCTGTGG - Intronic
1121315731 14:92960092-92960114 GCGGACTCTCTGTGCAGACGGGG - Intronic
1121595143 14:95156951-95156973 GGAGACTTTCCGGGCCGCCGTGG - Intronic
1122361659 14:101170766-101170788 GGGGACCCCAGGGGCAGCCAAGG - Intergenic
1122415432 14:101547417-101547439 GGGGTATCTCGAGGCAGCGGTGG - Intergenic
1122780414 14:104141084-104141106 TGGGACTCTGGGGACAGCCCAGG - Intronic
1123037636 14:105477984-105478006 GGGGACTAACAGGGCAGCCCCGG + Intronic
1123141227 14:106081127-106081149 GGGGGCACTCGGGGCAGCATGGG - Intergenic
1125533199 15:40427438-40427460 GGGGACTCTCAAGGCAGGCCAGG - Intronic
1127995694 15:64152100-64152122 GGAGAGTCCCCGGGCAGCCGCGG + Intronic
1129523683 15:76201056-76201078 TCGGACTCTAGGGGCAGCCCTGG + Intronic
1129737662 15:77975069-77975091 GGGCCCTCTGGGGGCAGCAGTGG - Intergenic
1132578194 16:673534-673556 GGGGGTTGTCGGGGCCGCCGTGG + Exonic
1135404729 16:22190112-22190134 GGGGACAGGCGGGGCATCCGAGG - Intronic
1135771515 16:25221556-25221578 GGGGATGCTCGGGGCTGCCTTGG + Exonic
1138448346 16:57078428-57078450 TGGGACTCTGGGGGCTGCCATGG - Intronic
1138651499 16:58463849-58463871 GGGGACGCGCGCAGCAGCCGCGG - Intronic
1139595840 16:67957836-67957858 GGGCTCTGTGGGGGCAGCCGTGG + Intronic
1141556219 16:84838451-84838473 TGGGACTCACGGGGCAGCCTGGG - Exonic
1141848337 16:86626563-86626585 GGGGCTTCTGGGGGCAGCCTGGG - Intergenic
1142130531 16:88429797-88429819 AGGGACTCTGGGGGCAGCGGGGG - Exonic
1142859049 17:2749787-2749809 CGGGGCTCTCGGGGCTCCCGGGG - Intergenic
1143115050 17:4577364-4577386 GGGGTCTCTGGGGGCAGGCCAGG - Intergenic
1145257353 17:21333776-21333798 GGGGACACTCGGGGCCTCCACGG + Intergenic
1145319287 17:21754259-21754281 GGGGACACTCGGGGCCTCCACGG - Intergenic
1146888290 17:36486890-36486912 GGGGACCCTCGGGGCTGACGCGG + Intronic
1147845024 17:43399028-43399050 GGGGTCTCGCGGGGCGGCTGCGG + Exonic
1147934685 17:44004919-44004941 GGGGACTCGTGGGGCACCGGGGG - Exonic
1148674820 17:49439072-49439094 GGGGGCTCTGGGGGCTGCAGCGG - Intronic
1149866506 17:60154050-60154072 TGGGACTGTGGGGGCAGCCCAGG + Intronic
1151004438 17:70417412-70417434 GGGGACTCACGGGGAAGGGGTGG + Intergenic
1151724827 17:75877840-75877862 GGGCACACTCGGGTGAGCCGGGG - Intronic
1151985631 17:77541490-77541512 TGGCTCACTCGGGGCAGCCGGGG - Intergenic
1152012551 17:77727269-77727291 GGGGACTCTCGGGGTGGGAGGGG + Intergenic
1152703862 17:81833093-81833115 GGGGAGTGGCCGGGCAGCCGGGG - Intronic
1152744266 17:82031849-82031871 GGGGGCTCGGGGCGCAGCCGGGG + Intronic
1152759896 17:82102255-82102277 AGGGACACCCGGGGCAGCCTGGG - Intronic
1152924142 17:83079841-83079863 GGGGGCGCGCGGGGCAGCCGTGG + Exonic
1155425570 18:25703167-25703189 GGAGACTCTCAGAGCAGCCTTGG + Intergenic
1157766068 18:50298512-50298534 GGGGACTCTAATGGCAGCTGAGG - Intergenic
1157766643 18:50302498-50302520 GGGGACTCTAATGGCAGCTGAGG - Intergenic
1160053399 18:75456989-75457011 AGGGACTCTCAGGGCTGCTGTGG + Intergenic
1160897517 19:1409545-1409567 GTGGACACTCCTGGCAGCCGGGG - Intronic
1161115279 19:2493239-2493261 GGGGATTCTAGGGGCTGCTGGGG + Intergenic
1161346450 19:3770873-3770895 GGGGAGTCTCGGAGCTGCCACGG + Exonic
1162104878 19:8364270-8364292 GGGGACTCTCGGGGACGTTGGGG - Exonic
1162937158 19:13986965-13986987 GAGGACACTGGGGGCAGCAGGGG - Intronic
1163104053 19:15113562-15113584 GGAGATTGTCGGGGCAGGCGGGG - Exonic
1163366432 19:16878404-16878426 GGGGCATGTCGGGGCAGCCCAGG - Intronic
1163442793 19:17330029-17330051 GGGGAGTGAGGGGGCAGCCGCGG + Intronic
1163547752 19:17949690-17949712 GGAGACGCTGGGGGCAGCCCAGG - Intergenic
1163678919 19:18669506-18669528 GGGGACTCGGGGGCCAGGCGAGG - Exonic
1167071886 19:47226648-47226670 GCGGACTCCCGGGGCCGCCTGGG + Exonic
1167125315 19:47545062-47545084 GGGGTCGCTCGGGGCCTCCGCGG + Exonic
1167314875 19:48757360-48757382 AGGGACACTCGGGGAAGCCATGG + Intronic
1167331602 19:48859620-48859642 GGGGACCACCGGGGCCGCCGGGG + Exonic
1167561553 19:50228994-50229016 GGGGACTCTCGAGGTGGCGGTGG - Intronic
1167645314 19:50702580-50702602 GGGGGCTCCCTGGGCAGCCGCGG - Exonic
1168712639 19:58510814-58510836 GGGGGCTCTGGGGGCTGCCCTGG - Exonic
925169634 2:1743367-1743389 CGGTAGTCTCGGGGCAGCCCGGG - Intronic
925386304 2:3464064-3464086 GGGGGCACTCGGGGCGGCTGAGG - Intronic
927149367 2:20186877-20186899 GGGGAGTCTCTTGCCAGCCGTGG - Intergenic
927980299 2:27370656-27370678 GGGGACTCGCTGAGCAGCGGAGG + Exonic
928186657 2:29115996-29116018 GGGGACTCTCGGGGCAGCCGCGG - Intronic
931516627 2:63054020-63054042 GGGGACACGCGGGGGCGCCGCGG - Intronic
931587010 2:63840617-63840639 GGGCTCCCTCGGGGCAGCTGCGG + Intergenic
933974483 2:87497295-87497317 GGGGAGCCTGGGGGCAGCCTGGG - Intergenic
934704040 2:96463867-96463889 GGGGGCTCTGGGGGAAGCAGAGG + Intergenic
936159326 2:110071890-110071912 GGCGGCTCCCGGGGCAGCTGAGG - Intergenic
936185335 2:110299442-110299464 GGCGGCTCCCGGGGCAGCTGAGG + Intergenic
936319341 2:111453524-111453546 GGGGAGCCTGGGGGCAGCCTGGG + Intergenic
937342724 2:121101502-121101524 GTGGACTCTCTGGGCATCCCAGG + Intergenic
937449136 2:121986518-121986540 GGGGAATCTCATGGCAGCAGAGG - Intergenic
938077019 2:128345587-128345609 GGGGACTCGCCGCTCAGCCGCGG - Intergenic
941184477 2:162304467-162304489 GGGGGTTCTGGGGGCAGGCGGGG - Intronic
942061868 2:172234871-172234893 GGGGACACTGGGGGGAGCAGCGG + Intergenic
946358791 2:219206733-219206755 GCGCAGTCTCCGGGCAGCCGGGG - Intronic
946386152 2:219385700-219385722 GGGGACTCTGTGGGGAGACGTGG + Exonic
947542923 2:230991022-230991044 GGGTGCCCTCGGGGCGGCCGGGG - Intergenic
1169074347 20:2752046-2752068 GGGCACGGCCGGGGCAGCCGCGG - Intronic
1172245560 20:33443258-33443280 GTGGTGTCTGGGGGCAGCCGAGG - Intronic
1173492425 20:43493925-43493947 GGTGAATCTCGTGGCAGCCAGGG - Intergenic
1174177828 20:48656307-48656329 GGTGGCTCTCGGGGGAGCTGAGG - Intronic
1175780605 20:61679942-61679964 GGGGACTCTCAGGCTACCCGAGG - Intronic
1175893931 20:62327779-62327801 CGGGCCTTTCGGGGCAGCTGGGG - Intronic
1178735217 21:35142868-35142890 GGGGATTCTAAGGGCAGCCAAGG + Intronic
1179108987 21:38429039-38429061 GGGGACTCTGGGGGAAGCATGGG - Intronic
1179798349 21:43798696-43798718 GAGGCCTCTGTGGGCAGCCGTGG + Intronic
1182108045 22:27703356-27703378 GGGCTCTCTTGGGGCAGCTGGGG + Intergenic
1183928881 22:41224924-41224946 GGGGACTCCCTGGGCAGGCCAGG - Intronic
1184148138 22:42623453-42623475 GGCAAGTCTCGGGGCAGCGGTGG - Intronic
1184851526 22:47124123-47124145 GGGGACTCTTGGGTCAGCGGGGG + Intronic
1184943327 22:47784159-47784181 GCGGCCTCTCTGGGCAGGCGTGG - Intergenic
1185232747 22:49692892-49692914 GGGGACTCACGGTCCAGCCCAGG + Intergenic
1185249595 22:49793500-49793522 GGGGACCCTCGGGGCAGACAAGG + Intronic
952382294 3:32815231-32815253 GGGAGCTCTGGGGGCAGCTGAGG + Intergenic
953353032 3:42230296-42230318 GTGGATTCTCGGGGCTGCTGTGG + Intergenic
954328545 3:49877006-49877028 GGAGAGTCTCGGGGCATCCTGGG + Intergenic
955438455 3:58930236-58930258 GAGGACTGTGGGGGCAGTCGGGG - Intronic
955818865 3:62875085-62875107 GGGGGCGCTGGAGGCAGCCGGGG + Exonic
959883005 3:111468044-111468066 GGGGCCTGTCGGGGCAGCAGAGG - Intronic
962929227 3:140022082-140022104 GAGGACTCACTGGGCAGCAGTGG + Intronic
968547756 4:1207328-1207350 GGGGACGCCGGGGCCAGCCGGGG - Intronic
968570575 4:1338373-1338395 GGGGCCACTCAGGGCAGCCGGGG - Intronic
969580954 4:8064759-8064781 GGGGACTCACGGGGGAGTCTGGG + Intronic
972410212 4:38786188-38786210 GGGGACTCCCAGAGCAGCCGTGG + Intergenic
975167029 4:71187841-71187863 GGGGACTCTTGGTGCTACCGAGG + Intronic
983649828 4:170026648-170026670 TGGGGCTCTGGGGGCCGCCGAGG - Intronic
984698106 4:182799505-182799527 CGGGACTCTGGGGGCAGCGCCGG - Intronic
985494669 5:197906-197928 GGGGAGACACGGGGCAGCAGGGG - Exonic
985670582 5:1204600-1204622 GGGGACACACGGGGCAACTGAGG - Intronic
987132319 5:14871491-14871513 GGGGACTCTGCGGGGAGGCGAGG + Exonic
992228575 5:74641436-74641458 GGCGACTGCAGGGGCAGCCGGGG + Intronic
996442919 5:123512307-123512329 GGCGACTCTCCGGCCAGCGGCGG + Intronic
997857348 5:137384054-137384076 GGGGACTCAGAGGGCAGCCTTGG - Intronic
998133198 5:139661279-139661301 AGGGCCTCTCGGGGCTGCTGGGG - Intronic
999297412 5:150468426-150468448 GGGGCATCTGGGGGCAGCAGTGG - Intergenic
1002176662 5:177404676-177404698 GGGGGCTCCCTGGGCAGCCAAGG + Intronic
1002712699 5:181204763-181204785 GTGCTCTCCCGGGGCAGCCGCGG + Exonic
1003568547 6:7240835-7240857 GGTGACTCTCGGGGCTGCTAGGG + Intronic
1004234196 6:13860055-13860077 GGGCACTCACGGTGCAGCGGCGG - Intergenic
1005255845 6:24002142-24002164 GGGGCCTTTGGTGGCAGCCGTGG + Intergenic
1006136032 6:31897126-31897148 GCGGCCCCTCCGGGCAGCCGAGG - Intronic
1007482359 6:42158448-42158470 CAGGACTCTGGGGGCAGCAGGGG - Intronic
1008004023 6:46390957-46390979 AGGGAGTCTTGGGGCAGCCTGGG + Intronic
1018172821 6:161155129-161155151 GGGGAGTCTCAGGGCAGTCCTGG + Intronic
1018767749 6:166947035-166947057 GGGGACTCTGGGGTCAGCCCCGG + Intronic
1018872176 6:167791496-167791518 GTGGGGTCTGGGGGCAGCCGGGG + Intronic
1018945785 6:168346004-168346026 GGGGGCAGCCGGGGCAGCCGGGG + Intergenic
1019194414 6:170272806-170272828 AGGGACCCTCGGGGCTGCGGGGG + Intergenic
1019267058 7:123556-123578 GGGCACCCTCAGGGCAGCTGCGG - Intergenic
1019437776 7:1030790-1030812 TGGGACTCTCTGGGCAGGTGGGG + Intronic
1019624815 7:2010795-2010817 GGCGCCTCTCGGGGCAGGTGAGG - Intronic
1019778691 7:2927302-2927324 GGGCACCCTCTGGCCAGCCGGGG - Intronic
1020204733 7:6105399-6105421 CGGGAGGCTCGGGGCGGCCGGGG + Intronic
1021301964 7:18984305-18984327 AAGGACTCTCGGGGCAGTTGGGG + Intronic
1022102636 7:27177650-27177672 GGGGAATCTCAGGAAAGCCGAGG - Intronic
1023810393 7:43906727-43906749 GGGTCCTCTCGGAGCAGCCCGGG + Exonic
1026900214 7:74032806-74032828 GGGGACTCCCAGGGCAGATGGGG + Intronic
1027151850 7:75738948-75738970 TGGGGATCCCGGGGCAGCCGAGG - Intronic
1028490112 7:91401705-91401727 GGGGACTCTGGGGGAAGGCTTGG - Intergenic
1029694526 7:102204167-102204189 GGGGACTTTCGGGTGAGCCATGG - Intronic
1038739700 8:30206511-30206533 GGAGACTCTGGGGGCAGCTCTGG - Intergenic
1039922654 8:41904158-41904180 GGGGGCTCTCTGGGAAGCCCAGG - Intergenic
1042696028 8:71556399-71556421 CGGGACGCTCGTGGCTGCCGCGG - Intronic
1042902918 8:73746600-73746622 TCGGGCTCTCGGGGCAGCAGCGG - Intronic
1043014307 8:74919521-74919543 GGGCACTCTCAGGGCAGTAGTGG + Intergenic
1047202737 8:122780682-122780704 GGGGAACCTGGGGGCTGCCGCGG + Intergenic
1047846992 8:128817066-128817088 GTGGACTTTCAGGGCAGCCAGGG + Intergenic
1049150117 8:141029667-141029689 GGGGACACCTGGGGCAGCAGCGG - Intergenic
1049210984 8:141386295-141386317 GGGGACTCTCAGAGCAGGCCTGG - Intergenic
1049236333 8:141514234-141514256 GAGTGCTCTCAGGGCAGCCGAGG - Intergenic
1049411196 8:142474720-142474742 GGGGACTGTCGGGGCAGGGATGG + Intronic
1049687009 8:143943063-143943085 GGGGACGCCCGGAGCTGCCGGGG - Intronic
1054812578 9:69446695-69446717 GGGGACTCACTGGCCAGCTGGGG + Intronic
1055454347 9:76459151-76459173 GGGGCCTCTGGGGGCGGCCCCGG + Intronic
1060213013 9:121721979-121722001 GGAGGCTCTCAGGGCAGCCTGGG - Intronic
1060856149 9:126915576-126915598 GAGGATTCTGGGGGCATCCGGGG + Intronic
1060971841 9:127742806-127742828 GGGGACTCGCGGGGAACCCCCGG - Intronic
1061450204 9:130663578-130663600 GCGGGCTCACGGGGCTGCCGAGG - Intergenic
1062544253 9:137054490-137054512 GGGGACTCAGGAGGAAGCCGAGG + Intergenic
1190320325 X:49176160-49176182 GGGGACTCTGGGGGCGGCTCGGG + Exonic
1195747841 X:108136533-108136555 AGGCACTCTCAGGGCAGCTGGGG + Intronic
1200065854 X:153503780-153503802 GGGGCCTCTCTGGGCTGCCGAGG + Intronic
1200163279 X:154019841-154019863 GGGGCCTCTCAGGGCCGCGGCGG + Exonic