ID: 928186661

View in Genome Browser
Species Human (GRCh38)
Location 2:29116009-29116031
Sequence GAGAGTCCCCGCACGCGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 42}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928186654_928186661 3 Left 928186654 2:29115983-29116005 CCACGACCGCCAGCCGCGGCTGC 0: 1
1: 0
2: 0
3: 10
4: 214
Right 928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
928186657_928186661 -10 Left 928186657 2:29115996-29116018 CCGCGGCTGCCCCGAGAGTCCCC 0: 1
1: 0
2: 1
3: 16
4: 206
Right 928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
928186656_928186661 -6 Left 928186656 2:29115992-29116014 CCAGCCGCGGCTGCCCCGAGAGT 0: 1
1: 0
2: 0
3: 16
4: 148
Right 928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
928186650_928186661 27 Left 928186650 2:29115959-29115981 CCGGCGGCGGAGCTGGGCTCTGG 0: 1
1: 0
2: 1
3: 31
4: 313
Right 928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
928186649_928186661 28 Left 928186649 2:29115958-29115980 CCCGGCGGCGGAGCTGGGCTCTG 0: 1
1: 0
2: 1
3: 39
4: 449
Right 928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
928186655_928186661 -3 Left 928186655 2:29115989-29116011 CCGCCAGCCGCGGCTGCCCCGAG 0: 1
1: 0
2: 0
3: 31
4: 576
Right 928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928186661 Original CRISPR GAGAGTCCCCGCACGCGCAG TGG Intronic