ID: 928186661

View in Genome Browser
Species Human (GRCh38)
Location 2:29116009-29116031
Sequence GAGAGTCCCCGCACGCGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 42}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928186657_928186661 -10 Left 928186657 2:29115996-29116018 CCGCGGCTGCCCCGAGAGTCCCC 0: 1
1: 0
2: 1
3: 16
4: 206
Right 928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
928186650_928186661 27 Left 928186650 2:29115959-29115981 CCGGCGGCGGAGCTGGGCTCTGG 0: 1
1: 0
2: 1
3: 31
4: 313
Right 928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
928186656_928186661 -6 Left 928186656 2:29115992-29116014 CCAGCCGCGGCTGCCCCGAGAGT 0: 1
1: 0
2: 0
3: 16
4: 148
Right 928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
928186654_928186661 3 Left 928186654 2:29115983-29116005 CCACGACCGCCAGCCGCGGCTGC 0: 1
1: 0
2: 0
3: 10
4: 214
Right 928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
928186655_928186661 -3 Left 928186655 2:29115989-29116011 CCGCCAGCCGCGGCTGCCCCGAG 0: 1
1: 0
2: 0
3: 31
4: 576
Right 928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
928186649_928186661 28 Left 928186649 2:29115958-29115980 CCCGGCGGCGGAGCTGGGCTCTG 0: 1
1: 0
2: 1
3: 39
4: 449
Right 928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928186661 Original CRISPR GAGAGTCCCCGCACGCGCAG TGG Intronic
905363011 1:37433362-37433384 ATGTGCCCCCGCACGCGCAGCGG + Intergenic
1062834539 10:627116-627138 GGTGGTCCCCGCACACGCAGTGG + Intronic
1062843081 10:686307-686329 GAGAGGCCCCGCAGGTGGAGAGG - Intronic
1067142351 10:43667992-43668014 GAGGGGCCCCGCTTGCGCAGGGG + Intergenic
1069691473 10:70355850-70355872 GAGAGCAGCCGCACGCTCAGAGG + Intronic
1080006517 11:27413623-27413645 GAAAGTCCCAGCATGCGCTGGGG + Intronic
1106102994 13:26710288-26710310 AACACTCCCCGCACACGCAGTGG - Intergenic
1110670389 13:78170001-78170023 GAGAGCACCTGCACGCACAGTGG - Intergenic
1122480598 14:102044739-102044761 GAGGGTCCCCTCACGCGGGGTGG + Intronic
1122942055 14:104985874-104985896 GAGAGTCCCCGCACCCACCTTGG - Exonic
1129336311 15:74854208-74854230 GGGAGTCCCCTCACAGGCAGGGG - Intronic
1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG + Intronic
1132622318 16:873646-873668 GAGGGTCCCCGCGAGCGCAGGGG - Intronic
1137753276 16:50882168-50882190 GAGAGGCCACACACGCACAGCGG - Intergenic
1138229076 16:55324624-55324646 GAGAGTGCGCGCGCGCGCACGGG + Exonic
1141587450 16:85044270-85044292 TAGAGTCCCTGCACACACAGCGG - Intronic
1161851465 19:6739942-6739964 GGGAGTCTCAGCACGCTCAGGGG + Intronic
1162105732 19:8368569-8368591 GAGAGTCCCGCCGGGCGCAGTGG + Intronic
1167494166 19:49808369-49808391 CAGTGTCCCCGCCTGCGCAGTGG + Intronic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
938370064 2:130763125-130763147 GAGGGTCCCTGCAGGGGCAGAGG - Exonic
938537522 2:132257823-132257845 GGGATTGCGCGCACGCGCAGCGG - Intronic
942890633 2:180982073-180982095 GAGAGCCCCAGCACCAGCAGTGG + Exonic
944069989 2:195657564-195657586 GCGAGGCTCCGCACGCGAAGTGG - Intronic
1174898682 20:54476093-54476115 GAGAGTCCCCGGCCGCGCGCCGG + Intronic
1175976241 20:62711731-62711753 GAGAGCCCACGCACGCGGGGAGG - Intronic
1180226796 21:46398305-46398327 GACAGTCCCAGCGAGCGCAGGGG - Intronic
985487216 5:158441-158463 GAGACTCCCAGGACGGGCAGAGG - Intronic
985487261 5:158560-158582 GAGACTCCCAGGACGGGCAGAGG - Intronic
1001704000 5:173728831-173728853 GAGAGACCCCGCACGCTGATTGG - Intergenic
1002778947 6:352032-352054 GAGTGTCCCCTCACGCTCATCGG - Intergenic
1014109283 6:117602370-117602392 GAGTGTGCCCGCGCGCGCGGGGG - Intronic
1017964944 6:159256060-159256082 GAGAGACCCCACACGCCCAGGGG - Intronic
1018846097 6:167557457-167557479 GAGAGTCCCCACCCACGCAATGG + Intergenic
1020552293 7:9621730-9621752 GACAGGCCCCGCACTCGGAGCGG - Intergenic
1023821246 7:43981790-43981812 GAGGGGCCCCGCAGGAGCAGGGG - Intergenic
1024370894 7:48582596-48582618 GAGCCTCCCCGCAAGCACAGAGG - Intronic
1024824915 7:53379986-53380008 CAGAGTCCCCAGACCCGCAGAGG - Intergenic
1029749515 7:102535214-102535236 GAGGGGCCCCGCAGGAGCAGGGG - Intergenic
1029767463 7:102634317-102634339 GAGGGGCCCCGCAGGAGCAGGGG - Intronic
1032027566 7:128455805-128455827 GAGGGTACGCGCACGCGCACTGG - Intergenic
1036621564 8:10427581-10427603 GAGTGTCCCCTCACTCGCTGTGG - Intronic
1037957006 8:23068147-23068169 GAGCGGCCCCGCACGCGTAGGGG + Intronic
1056708747 9:88973003-88973025 GAGACTCCCCCCACCGGCAGGGG - Intergenic
1186917991 X:14244298-14244320 GAGAGCCCCAGCACCAGCAGTGG + Intergenic
1201076823 Y:10195632-10195654 GGGATTGCGCGCACGCGCAGTGG + Intergenic