ID: 928188500

View in Genome Browser
Species Human (GRCh38)
Location 2:29138238-29138260
Sequence CTCTACTCATAGATGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928188500_928188506 27 Left 928188500 2:29138238-29138260 CCCAGCACCATCTATGAGTAGAG 0: 1
1: 0
2: 1
3: 11
4: 140
Right 928188506 2:29138288-29138310 CAGCTTTGTCAAAGATCAGTTGG 0: 22
1: 463
2: 7673
3: 5473
4: 4753

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928188500 Original CRISPR CTCTACTCATAGATGGTGCT GGG (reversed) Intronic
902318832 1:15645274-15645296 CTCTTCTCATATACTGTGCTAGG + Intronic
906189117 1:43884570-43884592 CACTACTCAGAGAAGGTTCTAGG + Intronic
908637222 1:66181017-66181039 CTCTACTAAGAGATGAAGCTGGG + Intronic
910600759 1:89029755-89029777 CCCTATTAATAAATGGTGCTGGG - Intergenic
910799278 1:91129567-91129589 CTCTACTAATAGAAGCTGCGGGG - Intergenic
912518655 1:110230950-110230972 CTCTACTCTCAGATGGTGGGTGG - Intronic
915478084 1:156165800-156165822 CACTACTCATTTATTGTGCTGGG + Intronic
915690331 1:157682476-157682498 CTTTATTAATAAATGGTGCTGGG - Intronic
918558764 1:185838416-185838438 CCCCACTCAAAGATGGTGCTGGG + Intronic
920944570 1:210516136-210516158 GTCCAGTCATAAATGGTGCTGGG - Intronic
922401516 1:225262578-225262600 CTCTATTCAAAAATGGTGCTGGG - Intronic
1065471085 10:26081746-26081768 CTCTACCCCTATATTGTGCTTGG + Intronic
1070852296 10:79575234-79575256 CCCTATTAATAAATGGTGCTGGG + Intergenic
1074322712 10:112417947-112417969 CTATTCTCAAAGAAGGTGCTTGG - Intronic
1078116667 11:8459685-8459707 CTCTACTCATGGAGACTGCTAGG - Intronic
1080200816 11:29667549-29667571 CCCTATTTATAAATGGTGCTGGG + Intergenic
1085437878 11:76525238-76525260 CTCTTTCCAGAGATGGTGCTGGG + Intronic
1086762462 11:90649683-90649705 CCCTATTAATAAATGGTGCTGGG + Intergenic
1087391606 11:97541964-97541986 CCCTATTAATAAATGGTGCTGGG + Intergenic
1089627846 11:119762752-119762774 CTCATCTCAAAGGTGGTGCTCGG + Intergenic
1090215866 11:124963875-124963897 CCCTATTAATAAATGGTGCTGGG - Intronic
1092751179 12:11720487-11720509 CCTTATTCATAAATGGTGCTGGG + Intronic
1095920193 12:47521788-47521810 CCCTATTAATAAATGGTGCTGGG - Intergenic
1097913466 12:64995241-64995263 CTTTACTCAGAGATGCTGGTCGG + Intergenic
1098520890 12:71434381-71434403 CTCTATTAACAAATGGTGCTGGG + Intronic
1099880587 12:88462415-88462437 CTCTATTAATAAATGGTGTTAGG - Intergenic
1100605783 12:96150822-96150844 CTAAACTCATGGATTGTGCTGGG - Intergenic
1100637810 12:96452242-96452264 CTCTATTCAATAATGGTGCTGGG + Intergenic
1101524419 12:105515095-105515117 CCCTATTAATAAATGGTGCTGGG - Intergenic
1108111409 13:47077543-47077565 GTCTATTTATAAATGGTGCTAGG + Intergenic
1109837880 13:67882536-67882558 ATCTACACATATCTGGTGCTGGG - Intergenic
1111138971 13:84088628-84088650 CTATACTCATAGTTAGTGTTGGG - Intergenic
1115065162 14:29250900-29250922 CCCTATTAATAAATGGTGCTGGG + Intergenic
1115122402 14:29953142-29953164 GTATACTCATTGATTGTGCTAGG - Intronic
1115708641 14:36025808-36025830 CTCTTCAAATAAATGGTGCTAGG - Intergenic
1115851006 14:37590549-37590571 CTCTACCCACAGATGGCCCTGGG - Exonic
1115926723 14:38444017-38444039 CTCTATTCAATAATGGTGCTGGG - Intergenic
1116720117 14:48485243-48485265 CCCTATTAATAAATGGTGCTGGG + Intergenic
1117751466 14:58928582-58928604 CCCTATTAATAAATGGTGCTGGG + Intergenic
1118926525 14:70195221-70195243 CTCATTTAATAGATGGTGCTGGG - Intergenic
1119788981 14:77332267-77332289 ATCCAGTCACAGATGGTGCTGGG + Intergenic
1121299333 14:92857721-92857743 CCCTATTAATAAATGGTGCTGGG + Intergenic
1122405876 14:101500770-101500792 CCCTCTTCATAGATGATGCTGGG - Intergenic
1125286649 15:38100329-38100351 CCCTATTAATAAATGGTGCTGGG + Intergenic
1126675786 15:51158427-51158449 CACTTCTCATGGATGGTGTTAGG - Intergenic
1130364183 15:83218732-83218754 CCCTATTCATAAATGGTACTGGG + Intergenic
1132073626 15:98801111-98801133 CTCTTCTCTTAAGTGGTGCTGGG - Intronic
1134769607 16:16795896-16795918 AACTTCTCTTAGATGGTGCTTGG + Intergenic
1138547003 16:57725861-57725883 CTCCACTCCCATATGGTGCTGGG - Intronic
1145890865 17:28414723-28414745 CTCCACTCATAGAGGATGCCTGG + Intergenic
1150628594 17:66859742-66859764 CTCTAATCATGGAGGGGGCTGGG + Intronic
1154318366 18:13324496-13324518 CTCTGCGCATAGAAGGTCCTCGG - Intronic
1157466698 18:47953536-47953558 CTCAATGCACAGATGGTGCTGGG - Intergenic
1161708229 19:5832311-5832333 CGCTGCTCAGAGATGGTGCCTGG - Exonic
1161714452 19:5867427-5867449 CGCTGCTCAGAGATGGTGCCCGG - Exonic
1164263187 19:23586958-23586980 CTCTTGTGATAGATGTTGCTAGG + Intronic
1166560191 19:43727684-43727706 CTCTCCTCAGAGAAGGTGCTGGG - Intergenic
925299045 2:2796877-2796899 CTCCACTCATTAATGGTGCCAGG + Intergenic
926319263 2:11737142-11737164 CCCTATTAATAAATGGTGCTGGG + Intronic
927330786 2:21861035-21861057 CACTACTCAGAGAAGGTACTTGG + Intergenic
928188500 2:29138238-29138260 CTCTACTCATAGATGGTGCTGGG - Intronic
929291740 2:40200064-40200086 CTCTTCTTATAGTTTGTGCTTGG - Intronic
929762575 2:44818200-44818222 CACTACTCACAAATGGTGCTAGG - Intergenic
930950209 2:57132403-57132425 CCCTATTCATACATGGTGCTAGG - Intergenic
931350613 2:61484909-61484931 CTCTACTCAAAGATTAGGCTGGG - Intronic
933501139 2:83113004-83113026 CCCTACTCATGGATGCTGCCAGG + Intergenic
942866381 2:180680464-180680486 CTGAACTCATAGATGGTGTTAGG - Intergenic
944330829 2:198464564-198464586 CCCTATTCAAAAATGGTGCTGGG + Intronic
945415392 2:209564630-209564652 CCTTCCCCATAGATGGTGCTGGG + Intronic
1168920692 20:1533258-1533280 GTCTACTGATAGATGGCGCTGGG + Intergenic
1170155181 20:13262754-13262776 CTCTCCTCATTGAAGGTTCTTGG - Intronic
1170162458 20:13327714-13327736 CCCTATTTATAAATGGTGCTGGG + Intergenic
1170320602 20:15093494-15093516 CTCTACTCATAGGTAAAGCTTGG + Intronic
1170347356 20:15401540-15401562 CTTTGCTGCTAGATGGTGCTGGG + Intronic
1177564548 21:22802080-22802102 GTCTTCCAATAGATGGTGCTTGG + Intergenic
1178964859 21:37106932-37106954 CTCTTTTAATAAATGGTGCTGGG - Intronic
1179777867 21:43678987-43679009 CCCTATTCAAAAATGGTGCTGGG - Intronic
1180007601 21:45030147-45030169 CTCTAATCACAGATGGTTCCCGG + Intergenic
1182075275 22:27491146-27491168 CTCTCCTGCTAGATGGGGCTGGG + Intergenic
949427632 3:3936439-3936461 CTCTATTAATAAATGGTCCTGGG - Intronic
955622797 3:60883621-60883643 GTCTATTCATAAATGATGCTGGG + Intronic
957631402 3:82720714-82720736 CCCTATTAATAAATGGTGCTGGG - Intergenic
959938365 3:112054226-112054248 CTCTAGTCAGTGATGGTGATAGG - Intronic
964287534 3:155135368-155135390 CCCTATTCAAAAATGGTGCTAGG - Intronic
964450900 3:156812015-156812037 CTTTACTCATAGAAGATACTTGG - Intergenic
966226702 3:177605541-177605563 CATTCCTCATAGATGGTGCCTGG - Intergenic
968438839 4:611223-611245 CTCTCCCCTTAGATGGTCCTAGG - Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970155686 4:13139756-13139778 CTCTATTCACTGATGGAGCTGGG - Intergenic
971524255 4:27596250-27596272 GTTTACTCATAGATGCTTCTTGG + Intergenic
976372504 4:84305355-84305377 CTCTCTTAATAAATGGTGCTAGG + Intergenic
980473914 4:133285504-133285526 CCCTATTCATGAATGGTGCTGGG - Intergenic
980561384 4:134481058-134481080 CTCTATTAATAAATGGTGCCGGG - Intergenic
981255200 4:142653131-142653153 CCCTATTAATAAATGGTGCTGGG + Intronic
983010895 4:162545664-162545686 CCCTATTCAAAAATGGTGCTGGG - Intergenic
983967114 4:173825379-173825401 CTCTACTCTGGGATGGTGCAGGG - Intergenic
985613824 5:907490-907512 CTCAACTCACAGACAGTGCTAGG - Intronic
989244575 5:39240082-39240104 CCATATTCATAAATGGTGCTGGG + Intronic
992026561 5:72675547-72675569 CCCTATTAATAAATGGTGCTTGG - Intergenic
994026502 5:95090605-95090627 CTCTACTCATCGCTGCTACTTGG + Intronic
996305710 5:122045091-122045113 CTCTGTTCATAAATGGTGCTAGG - Intronic
998910815 5:146958184-146958206 TTCTCTTCATAGATGGTGCCTGG - Intronic
998956770 5:147446711-147446733 CTGTACTCATACATGCTCCTGGG + Intronic
1000130692 5:158295177-158295199 CTCTTTTCATAGAAGATGCTCGG - Intergenic
1000480619 5:161769005-161769027 CCCTATTAATAAATGGTGCTGGG + Intergenic
1001526245 5:172430680-172430702 CACTGCTCATGGATGGTGTTAGG + Intronic
1003266765 6:4572622-4572644 CCCTATTAATAAATGGTGCTGGG - Intergenic
1005459815 6:26057126-26057148 CTCTTTTCATAGATGGGGGTGGG + Intergenic
1006049122 6:31326925-31326947 CCCTATTCATAAATAGTGCTGGG + Intronic
1007859646 6:44894455-44894477 CCCTATTTATAAATGGTGCTGGG - Intronic
1008637841 6:53429628-53429650 ACCTACTCACAGATGGTGGTTGG + Intergenic
1009191728 6:60637557-60637579 CTCTTCCAATAAATGGTGCTGGG + Intergenic
1009226229 6:61022615-61022637 TACTATTCATAAATGGTGCTGGG - Intergenic
1009328433 6:62383674-62383696 CCCTATTAATAAATGGTGCTGGG - Intergenic
1012770597 6:103428626-103428648 CTCTATTCAAAAATGGGGCTGGG + Intergenic
1014575712 6:123069496-123069518 GTCTACTTGTAGATGGTTCTAGG - Exonic
1014873351 6:126624468-126624490 CTCTACTCTTAGAGAGTGCCTGG + Intergenic
1015328295 6:131950113-131950135 CTCTAATCATAGTTGGGTCTGGG + Exonic
1015944175 6:138483179-138483201 CTCTACTCAGAGGAGGTGTTCGG + Intronic
1020886548 7:13825091-13825113 CTCTGTTCATAGATGGTGCATGG + Intergenic
1021692553 7:23244722-23244744 CTCTTCTCTTTGATGGTGCAGGG + Intronic
1022513818 7:30962960-30962982 CTCCACTCACAGAAGCTGCTGGG - Intronic
1022580442 7:31548080-31548102 TTCTACTCATAGATTTTGCTTGG - Intronic
1023035133 7:36124860-36124882 CCCTACTTATAAATAGTGCTGGG + Intergenic
1031820293 7:126492412-126492434 CTGTACTCATTGATTGTGTTGGG - Intronic
1033522769 7:142178586-142178608 CTTTATTAATAAATGGTGCTGGG - Intronic
1035331802 7:158101279-158101301 CTCTAGTCAAAAATGGTGCTGGG + Intronic
1035403400 7:158583413-158583435 CTTTACTCCGAGATGGTGTTGGG - Intronic
1042811894 8:72834814-72834836 TTATACTCAAAGATGGTGATTGG - Intronic
1046060782 8:109136975-109136997 CCCTATTCAAAAATGGTGCTGGG - Intergenic
1046745905 8:117875694-117875716 CTCTCCCCAAAGATGGTACTTGG - Intronic
1047939135 8:129810979-129811001 CTCTATTCATAAATGGTGCTAGG - Intergenic
1048601534 8:135923699-135923721 CTCTTCTCTAAGGTGGTGCTGGG + Intergenic
1048879880 8:138863465-138863487 CTCTGCTCAGGGATGGTGTTGGG + Intronic
1050656342 9:7832720-7832742 CTCCACCCAGAGATGCTGCTTGG - Intronic
1051327950 9:15993352-15993374 CCCTATTAATAAATGGTGCTGGG + Intronic
1051329367 9:16007665-16007687 CCCTATTAATAAATGGTGCTGGG - Intronic
1051723296 9:20062399-20062421 CCCTATTAATAAATGGTGCTGGG + Intergenic
1058354114 9:104062512-104062534 CCCTATTAATAAATGGTGCTGGG + Intergenic
1058916626 9:109573078-109573100 CCTTATTCATAAATGGTGCTGGG + Intergenic
1059171964 9:112133475-112133497 CCCTATACATAAATGGTGCTGGG + Intronic
1059786415 9:117591151-117591173 CTCTAATTATAGCTGGAGCTAGG - Intergenic
1188370853 X:29367872-29367894 CTCTATTAATAAGTGGTGCTGGG - Intronic
1193384950 X:80858749-80858771 CCCTATTAATAAATGGTGCTGGG - Intergenic
1194145572 X:90257621-90257643 CCCTATTAATAAATGGTGCTGGG + Intergenic
1196745438 X:119067723-119067745 CTATACTTACAGATGGTGATAGG + Intergenic
1197124623 X:122929884-122929906 CTCACCTCACAGATGGTTCTAGG - Intergenic
1197364211 X:125544425-125544447 CTCTACTCCTATATTTTGCTTGG - Intergenic
1199676834 X:150196351-150196373 CTCTACTCCCAGATGGCACTGGG - Intergenic
1200491325 Y:3826920-3826942 CCCTATTAATAAATGGTGCTGGG + Intergenic
1200889386 Y:8306926-8306948 CCCTATTAATAAATGGTGCTGGG - Intergenic
1201780265 Y:17713249-17713271 CCCTAGTAATAAATGGTGCTGGG + Intergenic
1201821289 Y:18192743-18192765 CCCTAGTAATAAATGGTGCTGGG - Intergenic