ID: 928189383

View in Genome Browser
Species Human (GRCh38)
Location 2:29148170-29148192
Sequence TGGGGCTCCCAGGGCTGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 348}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928189383_928189393 6 Left 928189383 2:29148170-29148192 CCTTGACAGCCCTGGGAGCCCCA 0: 1
1: 0
2: 2
3: 41
4: 348
Right 928189393 2:29148199-29148221 GGCTAAGCTACTTAAGGTGGAGG 0: 1
1: 0
2: 0
3: 5
4: 56
928189383_928189392 3 Left 928189383 2:29148170-29148192 CCTTGACAGCCCTGGGAGCCCCA 0: 1
1: 0
2: 2
3: 41
4: 348
Right 928189392 2:29148196-29148218 CACGGCTAAGCTACTTAAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 28
928189383_928189395 8 Left 928189383 2:29148170-29148192 CCTTGACAGCCCTGGGAGCCCCA 0: 1
1: 0
2: 2
3: 41
4: 348
Right 928189395 2:29148201-29148223 CTAAGCTACTTAAGGTGGAGGGG 0: 1
1: 0
2: 0
3: 4
4: 113
928189383_928189400 20 Left 928189383 2:29148170-29148192 CCTTGACAGCCCTGGGAGCCCCA 0: 1
1: 0
2: 2
3: 41
4: 348
Right 928189400 2:29148213-29148235 AGGTGGAGGGGAGGGGAGTTGGG 0: 1
1: 0
2: 16
3: 192
4: 1517
928189383_928189399 19 Left 928189383 2:29148170-29148192 CCTTGACAGCCCTGGGAGCCCCA 0: 1
1: 0
2: 2
3: 41
4: 348
Right 928189399 2:29148212-29148234 AAGGTGGAGGGGAGGGGAGTTGG 0: 1
1: 2
2: 37
3: 365
4: 2195
928189383_928189401 21 Left 928189383 2:29148170-29148192 CCTTGACAGCCCTGGGAGCCCCA 0: 1
1: 0
2: 2
3: 41
4: 348
Right 928189401 2:29148214-29148236 GGTGGAGGGGAGGGGAGTTGGGG 0: 1
1: 5
2: 36
3: 494
4: 4933
928189383_928189397 12 Left 928189383 2:29148170-29148192 CCTTGACAGCCCTGGGAGCCCCA 0: 1
1: 0
2: 2
3: 41
4: 348
Right 928189397 2:29148205-29148227 GCTACTTAAGGTGGAGGGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 204
928189383_928189398 13 Left 928189383 2:29148170-29148192 CCTTGACAGCCCTGGGAGCCCCA 0: 1
1: 0
2: 2
3: 41
4: 348
Right 928189398 2:29148206-29148228 CTACTTAAGGTGGAGGGGAGGGG 0: 1
1: 0
2: 2
3: 21
4: 246
928189383_928189396 11 Left 928189383 2:29148170-29148192 CCTTGACAGCCCTGGGAGCCCCA 0: 1
1: 0
2: 2
3: 41
4: 348
Right 928189396 2:29148204-29148226 AGCTACTTAAGGTGGAGGGGAGG 0: 1
1: 0
2: 1
3: 21
4: 270
928189383_928189391 0 Left 928189383 2:29148170-29148192 CCTTGACAGCCCTGGGAGCCCCA 0: 1
1: 0
2: 2
3: 41
4: 348
Right 928189391 2:29148193-29148215 GGTCACGGCTAAGCTACTTAAGG 0: 1
1: 0
2: 0
3: 2
4: 19
928189383_928189394 7 Left 928189383 2:29148170-29148192 CCTTGACAGCCCTGGGAGCCCCA 0: 1
1: 0
2: 2
3: 41
4: 348
Right 928189394 2:29148200-29148222 GCTAAGCTACTTAAGGTGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928189383 Original CRISPR TGGGGCTCCCAGGGCTGTCA AGG (reversed) Intronic
900640394 1:3685588-3685610 TGGCGCTCCCATGGGAGTCAGGG - Intronic
900932233 1:5744445-5744467 AGGAGCTCCCAGTGCTGACACGG + Intergenic
901041576 1:6367425-6367447 TGGAGCTCCCATGCCTGCCAAGG + Intronic
901624218 1:10614534-10614556 TGGGGCCCTCTGGGCTGTCAAGG - Intronic
901703683 1:11058922-11058944 GGGGGCTCCCAGTCCTGCCAGGG - Intronic
902331121 1:15731712-15731734 TGGGGCTCCCAGACCTCTCCTGG + Intronic
902790636 1:18765492-18765514 TGGAGCTCCCAGCTCTGCCATGG - Intergenic
902821742 1:18947652-18947674 GGGGGCTGGCAGGGCTGGCAGGG - Intronic
903315896 1:22506487-22506509 TGGCTTTCCCAGGGCTGTCCAGG + Intronic
903943677 1:26948720-26948742 TGGGGCTCACAGTGAGGTCAAGG - Intergenic
905487663 1:38315369-38315391 TGGCACTCCCAGGGGGGTCATGG + Intergenic
905653560 1:39672010-39672032 TGGGGCTCCCGGGGCTGCCCAGG + Exonic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
906097732 1:43235651-43235673 TGGGCCTCCGATGGCTTTCATGG - Intronic
907824826 1:58005420-58005442 TGAGGCTCTCAGTGCTGTAAAGG - Intronic
910439863 1:87240983-87241005 TGGAGCTCTGAGGGCTGGCAGGG + Intergenic
911666818 1:100562757-100562779 TGGGGCTCCAAGGAATGGCAAGG - Intergenic
911941681 1:104055489-104055511 TAGTGCTCTCAGGGCTCTCAGGG - Intergenic
914430840 1:147619420-147619442 TGGAGCTCCCACGTCTGTCCGGG - Exonic
914805170 1:150986225-150986247 AGGGGCTAGCAGGGCTGGCAGGG + Intronic
915021997 1:152787813-152787835 TGGAGTTCCCAGGGCAGCCATGG - Exonic
915022960 1:152798296-152798318 TGGAGTTCCCAGGGCAGCCATGG - Intronic
915320344 1:155052709-155052731 TGGGGCTCCAAGGGCTCCCTCGG - Exonic
915339096 1:155166715-155166737 GGGGGCGCCCAGGGCAGGCAGGG - Intergenic
915588949 1:156859943-156859965 TGGGGATCCCGGGGCTTTCCAGG + Intronic
915978027 1:160403200-160403222 TAGGGCTCCCAGGGCTAGTAAGG + Intronic
919725898 1:200883398-200883420 TGGGGATCTTAGGGCTGACAGGG - Intergenic
919764239 1:201115789-201115811 TCGGGATCCCCGGGCTGTCCGGG + Exonic
919833936 1:201560876-201560898 TGTGGCACCCAGGGCTGGCCTGG - Intergenic
920164721 1:204027878-204027900 TCTGGCTCCCAGGGAGGTCAGGG - Intergenic
921722103 1:218483962-218483984 TGTGGATTCCAGGCCTGTCACGG + Intergenic
922546043 1:226457606-226457628 GGGCGCTGCCAGGGCTGCCATGG + Intergenic
922796843 1:228343651-228343673 GGGGGCGTCCAGGGCTGCCAGGG + Intronic
923012032 1:230095749-230095771 TGGGGCTACCAGGCCCCTCAAGG - Intronic
923040363 1:230315429-230315451 TGCTGCTCACAGGGCTGTCCTGG - Intergenic
923541408 1:234890890-234890912 TGGGAATCCAAGGGCTGGCAAGG + Intergenic
923800206 1:237201710-237201732 AGGGGCTCCCAGGGCTGCTGAGG + Intronic
924591016 1:245404415-245404437 TGGGGATCCCTGAGGTGTCAGGG + Intronic
1064196419 10:13247450-13247472 CGGAGCTGCCAGGGCTGTGAGGG - Intergenic
1066998354 10:42583927-42583949 TGGGGCTGCCAGGGAATTCACGG - Intronic
1067162899 10:43842348-43842370 GGGGGCTCCCTGGGGGGTCAGGG + Intergenic
1067718846 10:48711357-48711379 TGGGGCTGTCAGGGCAGGCAGGG - Intronic
1067820162 10:49521304-49521326 TGGGCCACACAGGGCTGTCTTGG + Intronic
1067944091 10:50679579-50679601 GGGGGCACCCAGGCCTGTGAGGG + Intergenic
1069438439 10:68407010-68407032 GGGGGCTCCCGGGGTCGTCATGG - Exonic
1069632015 10:69902818-69902840 TGGGGCACCCAGGACTGCCAGGG + Exonic
1070592690 10:77811894-77811916 CGGGCCTCCCAGGGCCGTCTGGG - Intronic
1070865585 10:79706449-79706471 GGGGGCACCCAGGCCTGTGAGGG + Exonic
1070879378 10:79844580-79844602 GGGGGCACCCAGGCCTGTGAGGG + Exonic
1071257093 10:83880561-83880583 AGTCCCTCCCAGGGCTGTCATGG - Intergenic
1071524105 10:86348219-86348241 TGGGACTCCCAGGCCTGTACAGG - Intronic
1071632486 10:87228670-87228692 GGGGGCACCCAGGCCTGTGAGGG + Exonic
1071645935 10:87360888-87360910 GGGGGCACCCAGGCCTGTGAGGG + Exonic
1072861166 10:99006931-99006953 TGGGGCTTCCAGAGCTGGCCTGG + Intronic
1073192487 10:101661619-101661641 TGGAGGGCCCAGGGCTGGCATGG - Intronic
1073497938 10:103911318-103911340 TGATGGTCCCAGGGCTGTCCTGG + Intronic
1076437114 10:130453997-130454019 CGGGGCTGCCCGGGCTGGCAGGG - Intergenic
1076613097 10:131738468-131738490 TGGGGCTCCCAGAGCAGCCCAGG - Intergenic
1076922233 10:133460006-133460028 TGCGGCCCCCAGGGCGCTCAGGG - Intergenic
1077021965 11:420909-420931 TGGGGCTCCCGGGGCTGGGCGGG + Intronic
1077049747 11:561281-561303 CGGGGCTCCCCGGGCTGGCGGGG + Exonic
1077074223 11:692991-693013 GGCTGCTCCCAGGGCTGCCATGG - Intronic
1077333848 11:1994719-1994741 TGGGCCTCCCAGAGCGGCCATGG + Intergenic
1077404050 11:2374908-2374930 TGGGGATCCCATGGCTGACAAGG - Intergenic
1077434879 11:2534175-2534197 AGGGCCGCCCAGGGCCGTCACGG - Intronic
1077475510 11:2788485-2788507 TGGGGCTGCCAGGGCAGTCCAGG - Intronic
1077803609 11:5567545-5567567 TGGGGATCCCAGGGCTGGAGTGG - Intronic
1078529368 11:12125062-12125084 TGGGGCTTCCTGCGCTCTCAGGG + Intronic
1081537880 11:44008411-44008433 GGGACCTCCCAGGGCTCTCAGGG + Intergenic
1081579781 11:44344366-44344388 TGGGGTGCCCAGGGCTGGAAAGG + Intergenic
1083279929 11:61620662-61620684 TGGGGATGCCAGGGATGTCCTGG + Intergenic
1083295884 11:61715473-61715495 TGGGGCTCCAAGAGCTCCCAGGG - Intronic
1083296212 11:61717011-61717033 TGGGGCTTCCAGGGCAGGCACGG - Intronic
1083305548 11:61760395-61760417 AGGGGCTGCCAGGGCAGGCAGGG + Intronic
1083309999 11:61779196-61779218 TGGGGCTCCCGGGGCTGACTGGG + Intronic
1084054651 11:66624670-66624692 AGAGGCTGCCTGGGCTGTCATGG - Exonic
1084164072 11:67366980-67367002 TGGGCCTCCTAGGGGGGTCATGG - Intronic
1084208790 11:67611392-67611414 TGGGGCCCCAGGGGGTGTCACGG + Exonic
1084399770 11:68936846-68936868 TGGGGGTCCCAGGGCTGCTCGGG - Exonic
1084694450 11:70745349-70745371 GTGGGCACCCAGGGCTGGCATGG - Intronic
1084973966 11:72786397-72786419 TGAGGCCCCCAGGGCTGGCTCGG + Intronic
1085857885 11:80196447-80196469 TGGTGCACCCAGGGATGGCATGG + Intergenic
1086401609 11:86465470-86465492 GGTGGCTCCCATGGCTGCCATGG + Intronic
1086924624 11:92626765-92626787 TGGCTGTCACAGGGCTGTCAGGG + Intronic
1088205071 11:107383000-107383022 TGGCACTCCCAGGGATGGCAAGG + Intronic
1088683464 11:112265243-112265265 TGGGGTGCACAGGGCAGTCACGG - Intronic
1089619067 11:119712241-119712263 TGGGTCTCCCTTGGCTGTCCTGG + Intronic
1090854282 11:130598422-130598444 CGGGGCTCCTGGGGCTTTCAGGG - Intergenic
1091143711 11:133258791-133258813 TGGGGCCCCCTGGGCTGTGAGGG - Intronic
1091297088 11:134481615-134481637 TGGGGCTCTGAGGGCTGTTCAGG + Intergenic
1202816831 11_KI270721v1_random:49901-49923 TGGGCCTCCCAGAGCGGCCATGG + Intergenic
1092185805 12:6477713-6477735 TGGGGCCCCGGGGGCTGCCATGG - Intergenic
1092326237 12:7534442-7534464 TTGGGCTTCCAGGCCTGTGATGG - Intergenic
1092731550 12:11539701-11539723 GGGAGGTCCCTGGGCTGTCACGG + Intergenic
1094682652 12:32679599-32679621 TGGGGGCCCCAGGGCTCTCCGGG + Intronic
1094703899 12:32896711-32896733 TGGGGCGCCGGGGGCTGCCATGG + Exonic
1096007274 12:48183622-48183644 TGGGTCTCCCGGGGGTGTCGCGG - Exonic
1097459721 12:59846256-59846278 AAGGCCTCCCAAGGCTGTCATGG - Intergenic
1101605935 12:106247811-106247833 AGGGGCTCCAAGGGCGGCCACGG - Exonic
1101845881 12:108362689-108362711 TAAGGCTCATAGGGCTGTCATGG + Intergenic
1102321836 12:111942658-111942680 TGGGTCTCGCAGGGTTGGCATGG + Intronic
1104488009 12:129168584-129168606 TGTGGTTCCCAGAGCTGTGATGG + Intronic
1104932824 12:132348827-132348849 GGGGGATCCCAGGGCTGTCCCGG - Intergenic
1104949493 12:132432821-132432843 TGGCCCTCCCAGAGCTGTCCTGG + Intergenic
1104975479 12:132550156-132550178 TGGGGCTTCTAGGGCTGTGGTGG + Intronic
1105009621 12:132746937-132746959 TTGGGCTCCCAGGGGTGGGAGGG + Intronic
1105512208 13:21060856-21060878 CGGGGGTCCCGAGGCTGTCAGGG + Intronic
1105638485 13:22239349-22239371 TGGGGCTCACAGGACTGTGGTGG + Intergenic
1106022295 13:25926945-25926967 TGGCCCTCCCAGGGCTCTCTGGG - Intronic
1106233438 13:27840804-27840826 AGGGGTCCCCAGGGATGTCATGG - Intergenic
1106480523 13:30133798-30133820 TGGGGCTCCCAGCTCTGGCCCGG - Intergenic
1107615832 13:42167055-42167077 AGGGACTCTCATGGCTGTCAAGG + Intronic
1108890013 13:55245289-55245311 TGTGGCTCCCAGAGTTGGCACGG - Intergenic
1110289619 13:73789442-73789464 TCTGGCTCCCAGGTCTCTCAGGG - Intronic
1111066970 13:83106951-83106973 CTGGGCTCCCAGGCCTGTAATGG - Intergenic
1112131408 13:96527850-96527872 TGGAGATCCCAAGACTGTCAGGG + Intronic
1113791277 13:113029701-113029723 TTGGTCTCCCAGGGATGTCCCGG - Intronic
1113796614 13:113061910-113061932 TGTGACCCCCAGGGCTGTCTTGG - Intronic
1113893328 13:113748065-113748087 TTGGGCCCCCAGAGCTGTAATGG - Intergenic
1114615439 14:24065558-24065580 GGGGGCTCCCCAGGCTGTGAGGG - Intronic
1115191059 14:30747467-30747489 TGGGGCATCCAGGGAGGTCAAGG + Intergenic
1119438962 14:74615598-74615620 TGGGGCTTCCACAGCTGTGAAGG - Intergenic
1119662894 14:76464278-76464300 TGGGGCTCCCAAGGCTGGGCTGG - Intronic
1121967582 14:98324871-98324893 TGGGGCTGCAAGAGCTGACAAGG - Intergenic
1122120899 14:99552882-99552904 TGGGTCACCCAGTGATGTCACGG - Intronic
1122226407 14:100283103-100283125 CGGAGCTTCCAGGGCTGACATGG - Intergenic
1122789711 14:104179098-104179120 TGGGGCTCCAAGGGCGGGCAGGG - Intronic
1124317578 15:28684289-28684311 TTGGGCTCCCTGGGTGGTCAGGG + Intergenic
1124409471 15:29424251-29424273 TGGGGCTCCCACCGCTGACTGGG + Intronic
1124595562 15:31088960-31088982 TGGGGCTCCCAGCACTTTCTTGG + Intronic
1124658874 15:31529030-31529052 TGGGCCTCCCAGGCCTGCCTGGG - Intronic
1126143237 15:45454574-45454596 CGGGGCTCCCTGGGCCGTGAAGG + Intergenic
1126291170 15:47081280-47081302 TGGCCCTCCCAGGGATGGCATGG + Intergenic
1128519518 15:68366255-68366277 TGGGTCTCCCAGGACCGTGAGGG - Intronic
1128750616 15:70146417-70146439 TGTGGCTCCCAGTGTTGTAAGGG - Intergenic
1129230044 15:74192085-74192107 CCGGGATCCCAGGGTTGTCATGG - Intronic
1130175084 15:81559776-81559798 TGGTGCTCCCAGGACTGTGCAGG + Intergenic
1130548974 15:84877387-84877409 TGGTCCACCCAGGGCTGGCACGG + Intergenic
1131248655 15:90817111-90817133 AGGAGCTCCCAGGGCTGTGGGGG + Intergenic
1131369050 15:91864685-91864707 TGTGGCACCCAAGGCTATCAGGG + Intronic
1131579900 15:93632866-93632888 TGTGGCTCACAGGACTGACATGG + Intergenic
1135207968 16:20499085-20499107 CAGGGCTCCCAGGGCTCCCAGGG - Intergenic
1135210931 16:20524615-20524637 CAGGGCTCCCAGGGCTCCCAGGG + Intergenic
1136081769 16:27856909-27856931 GGGGATTCCCAGGCCTGTCAGGG - Intronic
1136556275 16:31009682-31009704 TGGGGCACCCCGGGCAGTCAAGG - Intronic
1136637924 16:31537553-31537575 TGGGGCACCCGGGGCTGTCCGGG - Intergenic
1136923364 16:34350221-34350243 GCGGGCTCCCGGGGCTGTCAGGG - Intergenic
1136981209 16:35061585-35061607 GCGGGCTCCCGGGGCTGTCAGGG + Intergenic
1138058107 16:53857498-53857520 TGGGGCTTCGAGGGCTGACCTGG + Intronic
1138559061 16:57789167-57789189 TGGGACCCCCAGGACTGCCAAGG + Intronic
1139849300 16:69940985-69941007 TGGAGCTCCAGGGGCTGGCAGGG - Exonic
1139951941 16:70676847-70676869 TGGGGTTCCCAGGGGTGTGGGGG - Intronic
1141034828 16:80618009-80618031 TGGGCCTCTCTGTGCTGTCAGGG + Intronic
1141111634 16:81275299-81275321 TGGGGGTCTCAGGGCTCTCCAGG - Intronic
1141407538 16:83807582-83807604 TGGGGCTCCCGGGGCGGGTAGGG + Intergenic
1142249654 16:88985543-88985565 TGGGGCACCTGGGGCTGTCCTGG + Intergenic
1143118978 17:4595712-4595734 TGGGGCTCCCAGCTCTGGCCAGG - Intronic
1143484194 17:7244044-7244066 TAGGGCTCCCAGGGCAGAGAGGG + Exonic
1145237842 17:21221615-21221637 TGGAGCTCCCTGTGCTGTGATGG + Intergenic
1145240499 17:21238303-21238325 TGGGGATCACAGGGCTGCTAGGG - Intergenic
1145280717 17:21464924-21464946 TGGGTCTCCAAGGGCTGCCGGGG + Intergenic
1145921267 17:28611925-28611947 TGGGGCCCCCATGGGTGCCAAGG - Intronic
1147573118 17:41583506-41583528 TGGTGCACCCAGGACTGGCAGGG - Intronic
1148119262 17:45198008-45198030 CGGGGCTCCCAGGGCGGTGGAGG - Intergenic
1148335213 17:46836269-46836291 TGGGGCTCCCAGGGAAATCCAGG + Intronic
1148737497 17:49873086-49873108 TGGGGCCTCCAGGGGTGTCAGGG + Intergenic
1148863927 17:50618918-50618940 TGGGGCTGTCGGGGCTGTCGGGG - Exonic
1149982886 17:61325384-61325406 TAGGGCTCACAGGGCTTGCAGGG + Intronic
1150133664 17:62682392-62682414 TGGGGCACCCAAGGGAGTCAGGG + Intronic
1150644193 17:66968057-66968079 GCGTCCTCCCAGGGCTGTCATGG - Intronic
1151398894 17:73842912-73842934 AGGGGCACCCAGGGCTGTGAGGG - Intergenic
1151598390 17:75091525-75091547 TGGGGCTCCCAGGGTCCTCTGGG + Intronic
1151726976 17:75890989-75891011 AGCGCCTCCCAGGGGTGTCAGGG - Exonic
1151940045 17:77286639-77286661 TGGGGCTGTCAGGGCTGCCTGGG - Intronic
1152019224 17:77771761-77771783 TGGGGCTGACAGGGCTGACACGG + Intergenic
1152363403 17:79842541-79842563 TTGGGCCCCCAGGGCCCTCAGGG + Intergenic
1152695459 17:81741685-81741707 TGGGGCGCCCAGGGCTCTGGAGG - Intergenic
1153643228 18:7173287-7173309 TGTGCTTCACAGGGCTGTCATGG - Intergenic
1156521332 18:37724507-37724529 TGGGGCTCCCAGGGCTCTATGGG + Intergenic
1157494005 18:48142531-48142553 TGAGGGCCCCAGGGCTGCCAGGG + Intronic
1157596841 18:48869417-48869439 CGGGGCTCCCACAGCTGCCAGGG + Intergenic
1157614804 18:48979961-48979983 GGGGGCTCCCACAGCTGCCAGGG - Intergenic
1158061528 18:53348879-53348901 TGAGGCATCCAGGCCTGTCATGG + Intronic
1158405245 18:57154482-57154504 TGTGGCTCCCAGGGCCGGCCAGG + Intergenic
1158882964 18:61798733-61798755 GGTGGCTCCTAGGGCTCTCAGGG + Intergenic
1158963507 18:62605135-62605157 TGGGGCTCCCAGGGGTCTGTGGG - Intergenic
1160009055 18:75089911-75089933 AGGGCGTCCCAGGGCCGTCACGG - Intergenic
1160318773 18:77871059-77871081 GGGGGCTCCCAGTGCTCCCATGG - Intergenic
1160849210 19:1182008-1182030 TGGGGCACCCAGGGCAGGCTGGG + Intronic
1161027643 19:2044033-2044055 TGTGTCTCTGAGGGCTGTCAGGG - Intronic
1161064213 19:2229588-2229610 TCAGGCTCCCTGGTCTGTCACGG + Intronic
1162016749 19:7850366-7850388 GGGGGCTCCCAGGGCTGCTGAGG + Intronic
1162332579 19:10039224-10039246 TCGGGCTCCCAGACCTGACAAGG - Intergenic
1162417476 19:10546866-10546888 TGGGCCCCCCTGAGCTGTCAGGG + Exonic
1162456631 19:10788887-10788909 GGGGGATGCCAGGGCTGTGATGG - Intronic
1162500780 19:11052436-11052458 TGGGGCTCCAGGGGGTGTGAAGG + Intronic
1162890919 19:13732457-13732479 TTGGGCCACCAGGCCTGTCAAGG - Intronic
1162966878 19:14160321-14160343 GGGGAATCCCAGGACTGTCAGGG + Intronic
1163700593 19:18784809-18784831 GGGGGCTCTAAGGGCTGTAAAGG + Intronic
1163705077 19:18807796-18807818 TGGGGTTCCCAGGTCTGGGAGGG - Intergenic
1163797891 19:19347859-19347881 TGGGGATCCCAGGGCTAAAAGGG - Intronic
1163820970 19:19496378-19496400 TGGGGGCCACAGGGCTGTCTGGG + Intronic
1164638382 19:29807728-29807750 TGGGTCTCCAAAGGCTGTCCAGG + Intergenic
1164689670 19:30201236-30201258 TTGGGCTCCCAGTGCTGTATGGG + Intergenic
1164719243 19:30420085-30420107 TGACACTCCCAGGGATGTCACGG + Intronic
1165111040 19:33502356-33502378 TGGTGTTTCCTGGGCTGTCAAGG + Intronic
1165472480 19:36011291-36011313 TGGGGCCCCTTGAGCTGTCAGGG + Intronic
1165860591 19:38907297-38907319 TGGGGCTCACCGGTTTGTCAAGG - Exonic
1166299238 19:41904834-41904856 TGGCGCTCTCAGGGCTCCCATGG - Intronic
1166676106 19:44742072-44742094 AGGAGCTCCCAGAGCTGCCAAGG + Intergenic
1167043692 19:47037969-47037991 TGGGGCTCCCAGTCCAGTGAGGG + Intronic
1167078749 19:47264972-47264994 CGGGGCTCTCAGGGCTTTGATGG + Intronic
1167117838 19:47498337-47498359 TGGGGAGCCCAGGGCAGGCAGGG + Intronic
1167514375 19:49914543-49914565 CCGGGTTCCCAGGGCTGTGAAGG - Intronic
1167650069 19:50724209-50724231 TGGGGCTCCTAGGGGTGTGGGGG - Intronic
1167713191 19:51124785-51124807 TGGATCTCCCAGGGCTGACCCGG + Intergenic
925919365 2:8628463-8628485 AGGGCCTCCCAGGGCTGACTGGG + Intergenic
927077253 2:19591119-19591141 AGGGGCTCTCAGAGTTGTCAAGG - Intergenic
927199320 2:20568595-20568617 GGAGGCTCCCAGGCCTGCCATGG + Intronic
927811373 2:26182390-26182412 TGGTTCTCCCAGGGCCTTCAAGG + Intronic
928097409 2:28413087-28413109 CGGGGCTCCCTGAGCTCTCAAGG + Exonic
928189383 2:29148170-29148192 TGGGGCTCCCAGGGCTGTCAAGG - Intronic
928201603 2:29251001-29251023 TGGGGTGCCCAGGCATGTCAAGG - Intronic
929029242 2:37635533-37635555 TGGGGCTCCCAGGCCTTTCTGGG + Intergenic
929757431 2:44779075-44779097 TGGGCCTCCCGGAGCTCTCAAGG - Intergenic
930259271 2:49126225-49126247 TGAGGGTCCCATGTCTGTCAAGG + Intronic
931318208 2:61152076-61152098 TGAGGCTCCCAGGTCTCCCAGGG + Intronic
932574258 2:72954243-72954265 GGGAGTTCCCAGGGCTGACATGG + Intronic
932703802 2:74008341-74008363 AGGGGCTCCAAGGGCTCTGACGG - Intronic
936462570 2:112723666-112723688 TGGGACTCCCAGAGCTGCCCTGG - Intronic
937083653 2:119157368-119157390 TGGGGGTCTCTGGGCTCTCAAGG + Intronic
937084011 2:119158705-119158727 TGGGGCTCCTAGCGCAGTGAGGG + Exonic
937323376 2:120974185-120974207 AGGGCCTACAAGGGCTGTCAAGG - Intronic
937863592 2:126731905-126731927 TGGGGCTATCAGGGTTTTCATGG - Intergenic
939153899 2:138502035-138502057 TCGGGCTCCCAGGGCGGACACGG + Exonic
940975324 2:159936735-159936757 TGGGGCTTCCAGTGCTGCTATGG - Intronic
943972330 2:194426865-194426887 TGGGTTTCCCAGGACAGTCAGGG - Intergenic
945127277 2:206526539-206526561 TGTGGCTTCCAGGGTTGCCATGG + Intronic
945581153 2:211596592-211596614 GGAGGCTCCCAGGGGTCTCAGGG - Intronic
946404837 2:219486743-219486765 TGGGGCTGGCGGGGCTGGCAGGG + Intronic
947750900 2:232531499-232531521 TGGAGCTCCCAGGGCTGGGCTGG - Intronic
947877841 2:233479801-233479823 TGGGGCTCCCGGGGCCCTTAGGG + Intronic
948155224 2:235776240-235776262 TGGGGCTCCAAGGCCTCGCAGGG + Intronic
1168955661 20:1832597-1832619 TGGGGCTCGGAGGGCAGACAGGG + Intergenic
1171320796 20:24242349-24242371 CAGGGCTCCCAGGGCTCTCAGGG - Intergenic
1171465544 20:25325317-25325339 CGGGCCTCCCAGGCCTCTCAGGG - Intronic
1171991548 20:31700415-31700437 TTGGGATACCAGGGCTGCCAAGG + Intronic
1174102120 20:48135773-48135795 TGGAGATCCCAGGGCTGATATGG + Intergenic
1174570341 20:51496945-51496967 GGGGCCTTCCAGGGCTGTCGCGG - Intronic
1175219560 20:57409090-57409112 TGGGGCATCCAGGGCTGTGGGGG + Exonic
1175381618 20:58567897-58567919 TGGGGCTTCCAGTGATGTGAGGG - Intergenic
1175641769 20:60636133-60636155 TGGGGTACCCTGGGCTGTCTGGG - Intergenic
1175700117 20:61130827-61130849 GGGGGCTCTCATGGCGGTCATGG - Intergenic
1175729764 20:61346339-61346361 TGGGGCTCCCATGGCTGGCCTGG - Intronic
1179939810 21:44629959-44629981 TGGGGGCCACAGGGCTGTCGCGG + Intronic
1180118379 21:45726726-45726748 TGTGGCTCCCATGGCTGGCCTGG + Intronic
1180834513 22:18923202-18923224 TGCACCTCTCAGGGCTGTCATGG - Intronic
1180935580 22:19622977-19622999 TGGGGCTGCCAGAGCTGTCTCGG - Intergenic
1181510614 22:23387156-23387178 TGGGGCTCCAAGGGTGGTCTTGG - Intergenic
1181761383 22:25061049-25061071 TGGGGCAGCCAGGGCTGTGAAGG - Intronic
1181816207 22:25438468-25438490 TGGGGCTCTCTGGCCTGGCACGG + Intergenic
1182501155 22:30748570-30748592 TGGTGCTGCCAAGGGTGTCATGG - Intronic
1183294928 22:37023943-37023965 TGGGGCTCTCCGGGAGGTCATGG + Intronic
1183723084 22:39573565-39573587 CTGGGCTCCCAGGGCTGGAAGGG - Intronic
1184021619 22:41825360-41825382 TGGGGCTCCCGGGTCTGTGGTGG + Intronic
1184178969 22:42806402-42806424 TGGTCCTCCCAGGGCTGGGATGG - Intronic
1184488755 22:44796973-44796995 TGTGGCTGCCAGGGCTCCCACGG + Intronic
1184545616 22:45164762-45164784 GGGGGCTGGCAGGGCTGTCCTGG + Intronic
1185394109 22:50578148-50578170 TGGGGCTCCTGGAGCTTTCAAGG - Intronic
1203284602 22_KI270734v1_random:148501-148523 TGCACCTCTCAGGGCTGTCATGG - Intergenic
952504221 3:33993339-33993361 TGAGGCACCCAAGGCTGTAATGG - Intergenic
953250543 3:41242767-41242789 TGGGGCTGCAGGGGCTGTCAGGG + Intronic
953605829 3:44412622-44412644 TGTGGCCCCCAGAGCTGTGAGGG - Intergenic
953956584 3:47236288-47236310 TGTGGTTCCCAGGACTGTGAGGG - Intronic
957646574 3:82938970-82938992 TGGGCATCCCAGCGCTCTCAGGG + Intergenic
960115252 3:113886158-113886180 TAGGGCTCCCAGGGCAGAGAGGG - Intronic
961969933 3:130952070-130952092 TGGAGCTCTCAGGTCTGTCAGGG + Intronic
962314538 3:134350919-134350941 GAGGGAGCCCAGGGCTGTCAGGG + Intergenic
963903158 3:150751926-150751948 AGAGACTCCCAGGGCTGGCAGGG + Intronic
967259274 3:187626020-187626042 TGGTGCACCCAGGAATGTCATGG + Intergenic
967594610 3:191314858-191314880 TGGGGCTCCCAGGGAGGGCATGG + Intronic
968285380 3:197505551-197505573 TGGGACTTCCGGGGCTGTGATGG - Intergenic
968593552 4:1471439-1471461 TGGGGCTGGCTGAGCTGTCAGGG + Intergenic
968703530 4:2067579-2067601 TGGGGCACCCAGGGCTGTGCTGG + Exonic
969180649 4:5438058-5438080 TGGGGCTGCCAGGCATGACAAGG + Intronic
969442192 4:7224049-7224071 TGGGGGTCCCAGGGCTGGTGGGG + Intronic
969486407 4:7474801-7474823 TCGGGCTCCCAGAGCTGTAGAGG - Intronic
969564754 4:7971215-7971237 TGGGTCTGCCAGGGCAGGCAGGG + Intronic
969643479 4:8412886-8412908 TGGGGCTCTCAGTGCTGTGGAGG - Intronic
969973334 4:11070939-11070961 TGGTGCTCCCAGGGAGGGCATGG - Intergenic
970333226 4:15004492-15004514 TGGGGTTCCGAGTCCTGTCACGG - Intronic
970723108 4:19010727-19010749 TGGAGCTGCCATGGCTGACAGGG + Intergenic
971283226 4:25259858-25259880 TGTGGGTCCCTGGACTGTCAGGG + Intronic
973535399 4:51876727-51876749 TGGGTCTTCCAGGGCTGACTGGG + Intronic
974754598 4:66187111-66187133 TGGGGCTACAAGGGCTGCCCTGG + Intergenic
975947249 4:79722294-79722316 TGAGACTCCCAGGGCTCTCAAGG + Intergenic
983254194 4:165379543-165379565 GGATGCCCCCAGGGCTGTCAGGG - Intronic
984870196 4:184318416-184318438 TGGGGGTCCCATGGGGGTCATGG + Intergenic
985368634 4:189261009-189261031 TTAGGCTTCCAGGCCTGTCATGG + Intergenic
985638905 5:1054058-1054080 TGAAGCTCCCAGGCCTGACAAGG + Intronic
985670091 5:1202513-1202535 AGTGGCTCCCAGGCCTGGCAGGG + Intronic
985815319 5:2124121-2124143 TGGGGGTCCCAGGGCTCACAGGG + Intergenic
986150860 5:5129518-5129540 TGGGGCTCACAGTGCATTCAAGG + Intergenic
986376469 5:7137008-7137030 CTGGGCTTCCAGGGCTGTCACGG - Intergenic
988737254 5:34035029-34035051 TGGGGCTCCCAAGCCTATCTTGG - Intronic
989600006 5:43192263-43192285 TGAGGCTCCCGGAGCTGTCAGGG - Intronic
991400271 5:66244469-66244491 GGGGGCTCCAAAGGCTGCCAGGG - Intergenic
994711746 5:103273856-103273878 TGGGACTCCAAGAGTTGTCATGG + Intronic
995130411 5:108624168-108624190 TGGTGCTCCCAGGGAGGGCATGG + Intergenic
995379614 5:111517648-111517670 TGGTGCACCCAGGGATGGCATGG + Intergenic
996757282 5:126948125-126948147 TGGCCCACCCAGGGTTGTCATGG - Intronic
998510948 5:142713491-142713513 AGGAGCTCCCAGGGCTTTCTAGG + Intergenic
998932905 5:147200938-147200960 TGGGGCTCCATGGGGTGACAAGG + Intergenic
1000398015 5:160796542-160796564 TGGGGGTCCTAGGGATGTGATGG - Intronic
1002176662 5:177404676-177404698 GGGGGCTCCCTGGGCAGCCAAGG + Intronic
1002774276 6:315406-315428 TGGGATTCCCATGGCTGTCTGGG + Intronic
1006294425 6:33163726-33163748 TGGGGCTCCCAGGTCTGAGAAGG + Exonic
1006466098 6:34195897-34195919 TGGGGCTCCCATGGCTTTGGTGG - Intergenic
1006499421 6:34448458-34448480 AGGCTCTCCCAGGGCTGGCAGGG + Intergenic
1006922051 6:37633624-37633646 TGTGGCACCCAGGCCTGTCATGG + Exonic
1007322426 6:41037375-41037397 GGGGCCTCCCAGGGCTCTGAAGG - Intronic
1011617305 6:89208891-89208913 AAGGGCTGCCAGGGCTGTCTAGG + Intronic
1014219629 6:118786930-118786952 TGGGGCTCCCAGGGAACCCATGG + Intergenic
1017626026 6:156349694-156349716 TGGGGCCACCAGGTCTGTTATGG - Intergenic
1018445488 6:163854397-163854419 TGAGGGTCCCAGGGGTGTTAAGG - Intergenic
1019503476 7:1377531-1377553 AGGGGCCTCCAGGGCTGGCAAGG - Intergenic
1019752801 7:2743060-2743082 TGGGGCAACCAGGACTGCCAAGG + Intronic
1020128000 7:5543850-5543872 CGGGGCTTCCAGGCCTTTCAGGG + Intronic
1021185635 7:17561199-17561221 TAGGGTTGCCAGAGCTGTCATGG + Intergenic
1022431643 7:30328808-30328830 TGGGACGCCCAAGGCTGTCAGGG + Intronic
1023017743 7:35983819-35983841 TGGTGTTCCCAGGGATGTGAGGG - Intergenic
1023927590 7:44681282-44681304 TGGGGACCCAAGGTCTGTCAAGG + Intronic
1024064204 7:45719097-45719119 CAGGGCTCCCAGGGCTGTGAAGG + Exonic
1024328853 7:48136324-48136346 CAGGGCTGCCAGGGCTGCCAGGG - Intergenic
1024678783 7:51661841-51661863 TGAGGCACCCAGAGCTGGCACGG + Intergenic
1028511016 7:91626435-91626457 TGGAGCTCCCAGGCCTATCAAGG - Intergenic
1032415213 7:131730234-131730256 TGGGGCTCTCAGCTCTGTGAGGG + Intergenic
1032489065 7:132310395-132310417 TGGTGTTCCCAGAGCTGCCAGGG - Intronic
1034380782 7:150690393-150690415 TCGGGCTCACAGGACTGCCATGG - Intronic
1034449922 7:151131821-151131843 TGGGCATCCCAGGGCTGTCGTGG + Intronic
1034496695 7:151427483-151427505 TGGGGGTCCCAGGGCAGGCATGG + Intergenic
1036042967 8:5106802-5106824 TGGTGCTTCCTGGGCTGTCAAGG - Intergenic
1036686206 8:10913426-10913448 TGTGTCTCCCAGGGCACTCACGG - Intronic
1037163559 8:15799996-15800018 TGGGGTTCCCAAAGCTCTCAGGG - Intergenic
1037947201 8:22996952-22996974 TGGGGGTCCCGGGGCAGTCCTGG + Intronic
1040294945 8:46144300-46144322 AGAAGCTCCCAGGGCTGTCCTGG - Intergenic
1040299848 8:46182267-46182289 GGAAGCTCCCAGGTCTGTCACGG - Intergenic
1040301087 8:46188349-46188371 AGAAGCTCCCAGGGCTGTCCTGG - Intergenic
1040315219 8:46257419-46257441 AGAGGCCCCCAGGGCTGTCCTGG + Intergenic
1040316403 8:46263202-46263224 AGGAGCCCCCAGGGCTGTCCTGG + Intergenic
1040325374 8:46338905-46338927 AGGAGATCCCAGGGCTGTCCTGG + Intergenic
1040340052 8:46435899-46435921 TGAAGCTCCCAGGGTTGTCCTGG - Intergenic
1040342023 8:46445918-46445940 AGGAGCTTCCAGGGCTGTCCCGG - Intergenic
1044214708 8:89595490-89595512 TGGGAGTCACAGGGATGTCATGG + Intergenic
1045252238 8:100491753-100491775 AAGGGCTCCCAGGGCATTCAGGG - Intergenic
1047389402 8:124437976-124437998 TGGGACTCCCTGAGCTGTTAAGG + Intergenic
1047492469 8:125386238-125386260 TCAGACTCCCAGGGCTGACAGGG - Intergenic
1049021879 8:139962744-139962766 TGGGCCTCCCTGAGCTGACAGGG - Intronic
1049200952 8:141340286-141340308 AGGGTCTCCTGGGGCTGTCATGG - Intergenic
1049238610 8:141525297-141525319 TGGGGCTGCTGGGGCTGTCTGGG + Intergenic
1049250485 8:141586070-141586092 AGGGGCTTCCAGGTCTGTTATGG + Intergenic
1049282460 8:141757057-141757079 TGGGGCTCCTAGGAGTGGCAGGG + Intergenic
1052395950 9:27938297-27938319 TGGGGCTCCCAGGGAAAGCAGGG + Intergenic
1052666086 9:31496967-31496989 TGAGGCTTCCAGGCCTGTGATGG + Intergenic
1053121189 9:35548370-35548392 TGGTCCACCCAGGTCTGTCAGGG + Exonic
1056266978 9:84906747-84906769 TGGGACTGGCAGGGCTGTAAAGG + Intronic
1057355031 9:94325505-94325527 GGGGGCACCCAGGCCTGTGAGGG - Exonic
1057652720 9:96932129-96932151 GGGGGCACCCAGGCCTGTGAGGG + Exonic
1058911237 9:109521771-109521793 TGGTACTCCCAGTGCTTTCAAGG + Intergenic
1059659437 9:116386841-116386863 CTGGGCTGCCAGGGATGTCAGGG - Intronic
1060594525 9:124840293-124840315 TGAGCCTCTCAGGGCTGGCAAGG - Intergenic
1061019689 9:128006112-128006134 AGCGGCTCCCAGGGCAGTGATGG - Intergenic
1061838352 9:133343570-133343592 TGGAGCTCCAATGGCTTTCAAGG + Intronic
1061908379 9:133710393-133710415 TGAGGGTCCCAGGGCTGACCGGG - Intronic
1062453044 9:136623471-136623493 TGGGAACCCCAGGGCTGCCAAGG + Intergenic
1062688807 9:137830358-137830380 TGGGGTGCCCACTGCTGTCAGGG + Intronic
1185471961 X:389344-389366 TCGGGCCCCCAAGGCTGGCAGGG + Intergenic
1186737965 X:12486095-12486117 TGGGGCTCCCTGGCCTGGCAGGG - Intronic
1186837027 X:13448451-13448473 TGGTTCTCACAGGGCAGTCAGGG - Intergenic
1187766923 X:22652890-22652912 TGGGGCTCTCAGGCCTGTATTGG - Intergenic
1189072945 X:37884077-37884099 TGGGCCTCCTGGGCCTGTCAGGG + Intronic
1190115758 X:47625504-47625526 TGGGCCTCCCAGGGCAGGTAGGG - Intronic
1190375146 X:49782021-49782043 TGGGGGTCACATGGCTGCCATGG + Intergenic
1196483901 X:116181890-116181912 TGGGGCTCCCTGCCCTGTCCTGG - Intergenic
1200059182 X:153476720-153476742 TTGGGCTCCCAGTTCTGCCATGG - Intronic
1200064280 X:153497238-153497260 TGGGGCTCCCAGGCCTGTCGGGG - Intronic
1200126214 X:153816183-153816205 TGGGGCTCCCAGGCCTGTCGGGG + Intronic
1200919577 Y:8601371-8601393 TGGACCTCTCAGGGCTGTCTTGG - Intergenic
1200938162 Y:8756437-8756459 TGGGCCTCACAGGGCTCTCTGGG + Intergenic
1200960393 Y:8991188-8991210 TGGGCCTCACAGGGCTCTCTGGG - Intergenic
1200964837 Y:9026398-9026420 TGGGACTCGCAGGGCTATCCAGG + Intergenic
1200985957 Y:9303787-9303809 TGGGGCTCCCATGTGTGTAATGG - Intergenic