ID: 928190010

View in Genome Browser
Species Human (GRCh38)
Location 2:29155681-29155703
Sequence CAGCAGAAACTGAATGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 6, 3: 39, 4: 400}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928190010_928190015 26 Left 928190010 2:29155681-29155703 CCCTCTTCATTCAGTTTCTGCTG 0: 1
1: 0
2: 6
3: 39
4: 400
Right 928190015 2:29155730-29155752 CTATGCTAATAATGTCTGACTGG 0: 1
1: 0
2: 0
3: 12
4: 74
928190010_928190014 2 Left 928190010 2:29155681-29155703 CCCTCTTCATTCAGTTTCTGCTG 0: 1
1: 0
2: 6
3: 39
4: 400
Right 928190014 2:29155706-29155728 GGAGTTCAGGCTCTCATGCTTGG 0: 1
1: 0
2: 1
3: 10
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928190010 Original CRISPR CAGCAGAAACTGAATGAAGA GGG (reversed) Intronic
900356295 1:2266425-2266447 CAGCAGAAACTGGGTTGAGATGG - Intronic
901257116 1:7839236-7839258 CTTCAGTAACTGAAAGAAGATGG - Intronic
902088620 1:13884053-13884075 CATCAGCAACTGAGTAAAGAAGG - Intergenic
903489246 1:23715384-23715406 AAGGACAAACTGAATGCAGAGGG - Intergenic
904222861 1:28987480-28987502 CAGCACCAACAGAAGGAAGAGGG + Exonic
906127400 1:43435657-43435679 CGGCAGTAACTAAAGGAAGATGG + Intronic
906149357 1:43578511-43578533 TGGCAGAAACTGAATGGAGCTGG + Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906784494 1:48602829-48602851 AAGAAGAAAAGGAATGAAGAGGG - Intronic
907148780 1:52262433-52262455 CAGAAGAAACTGAGTTTAGATGG - Intronic
907279538 1:53337537-53337559 CAGCAGAAACTGGAAGACAATGG - Intergenic
908605123 1:65790448-65790470 GAGCAGAAGCAGAAGGAAGAAGG - Intergenic
909252649 1:73378847-73378869 AAGCAGAAACAGAATAAAAAGGG + Intergenic
909270445 1:73617327-73617349 CACCAGAAGCTGACTAAAGAGGG - Intergenic
910039804 1:82836252-82836274 CAGCACAAAATGAATGTAGTTGG - Intergenic
910318945 1:85921781-85921803 CAGCAGCAACTGAACAAAGCTGG + Intronic
910683115 1:89888166-89888188 CTGAAGAAAGTGAATGAAAAAGG + Intronic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
912669934 1:111616275-111616297 CAGGAGAAACTGAGTGCAGGAGG - Intronic
913691177 1:121281339-121281361 AAGAAGAAAGAGAATGAAGAAGG - Intronic
913962226 1:143349227-143349249 CAGCAGAAACTGGAAGAGGCTGG + Intergenic
914056582 1:144174801-144174823 CAGCAGAAACTGGAAGAGGCTGG + Intergenic
914122564 1:144791561-144791583 CAGCAGAAACTGGAAGAGGCTGG - Intergenic
914146365 1:144998633-144998655 AAGAAGAAAGAGAATGAAGAAGG + Intronic
914396437 1:147273577-147273599 CAGGAGAAACTGAAAGAATCAGG + Intronic
915110455 1:153561572-153561594 CAGGAGAAAGTGGATGAGGAGGG - Exonic
916168144 1:161981445-161981467 GAGCAGAAACGGAAGGCAGAGGG - Intergenic
916584020 1:166134117-166134139 CAGGAGAAACTGAATGTTGTAGG - Intronic
917018143 1:170557841-170557863 CAGAAGATACGAAATGAAGAGGG + Intergenic
917179959 1:172285415-172285437 CTGCAGAGTCTGAATGAAGGTGG + Intronic
918410498 1:184253626-184253648 CAGCAGAAGCTGAATCCACAAGG - Intergenic
919594568 1:199546063-199546085 CAGCTGAAAAAGAAGGAAGAAGG + Intergenic
919754108 1:201056009-201056031 CAGCAAAAACTGAGTGTGGATGG + Intronic
920168968 1:204057920-204057942 CAGCCCAAACTCAATGAAAAGGG + Intergenic
920478501 1:206299815-206299837 AAGAAGAAAGAGAATGAAGAAGG - Intronic
920708218 1:208270805-208270827 CAGCAAGAAAGGAATGAAGATGG + Intergenic
920717727 1:208356610-208356632 CAGTAGAGAATGAATGCAGAAGG - Intergenic
921954727 1:220970318-220970340 CAGAAGAGACTGAAAGAAAAAGG + Intergenic
923670302 1:236034801-236034823 AAACAAAAACTGAAGGAAGAGGG + Intronic
923893821 1:238246295-238246317 CAGCAAAAACAGTTTGAAGAGGG + Intergenic
923976762 1:239272628-239272650 CAGCAGAAATCCACTGAAGATGG - Intergenic
924391839 1:243569196-243569218 CTGCAGAAACTGAATGACCATGG + Intronic
924503402 1:244657777-244657799 CAGCAGTATGTGAAGGAAGATGG + Intronic
1063297286 10:4819641-4819663 CAGCAGGAAATGAAGAAAGAGGG + Intronic
1065330348 10:24590393-24590415 CAGCTGGAACTGTAGGAAGAAGG - Intronic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067277651 10:44849403-44849425 CAGCAGAGAGTGAATGAGCAAGG - Intergenic
1067910410 10:50340871-50340893 TAGAAGAAACTGAAATAAGAAGG + Intronic
1067949675 10:50720750-50720772 CAGGAGATGCTGAATAAAGATGG - Intergenic
1068330007 10:55551308-55551330 CAACAGTAACTGAAAGAATAAGG - Intronic
1069290720 10:66776406-66776428 CAGCACGAACTCAATGAAAAAGG + Intronic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1070884983 10:79885790-79885812 CAGGAGATGCTGAATAAAGATGG - Intergenic
1072422039 10:95297333-95297355 CAGCAGGGACAGAATGAACAAGG + Intergenic
1072674335 10:97454271-97454293 CAGCAGAAATACAATCAAGATGG - Intronic
1072902161 10:99418223-99418245 CAGGAGAAACTAGATTAAGAGGG + Intronic
1073017521 10:100413434-100413456 CTGCATAAACTGAATAACGAAGG - Intergenic
1073369440 10:102973955-102973977 CAGCAGCAATTGCATGGAGATGG - Intronic
1074140958 10:110672307-110672329 CAGCAGAAAGCGGATTAAGAAGG - Intronic
1075968098 10:126630297-126630319 CTGCAGATGCTGGATGAAGAGGG + Intronic
1076297746 10:129400323-129400345 CAGCAGAAGGTGAATGACAATGG - Intergenic
1076492192 10:130869443-130869465 AAACAGAAACAGAATGAAGTAGG - Intergenic
1076802774 10:132839038-132839060 AAGGAGACACTGATTGAAGATGG - Intronic
1076850942 10:133092715-133092737 AAGAAGCACCTGAATGAAGAAGG + Intronic
1077575943 11:3383582-3383604 TGACAGAAACTGAATGAGGAGGG + Intergenic
1078006331 11:7535174-7535196 AAGCAGAAACTAAATGGAGGTGG + Intronic
1078209829 11:9261833-9261855 CACCAGAAATGAAATGAAGAGGG + Intronic
1078412732 11:11140789-11140811 CAGCAGAAATAGAATGTAGAGGG - Intergenic
1078724178 11:13913912-13913934 CTACAGCAACAGAATGAAGAGGG - Intergenic
1079845834 11:25466616-25466638 CAGCAAAAACAGAACCAAGAGGG + Intergenic
1080659837 11:34286709-34286731 GAGCAGAAACAGCATGAAAATGG - Intronic
1081515943 11:43829738-43829760 CACCAGAAACAGAATAAGGAAGG - Intronic
1082776735 11:57251052-57251074 CAGCAGAGGCTGAAAGAAGGTGG + Intergenic
1083085586 11:60140835-60140857 CAGCAGACACTGAATCTAAATGG - Intergenic
1083298153 11:61726409-61726431 CAGCAGCAAATTAATCAAGAAGG + Intronic
1083815759 11:65131546-65131568 CAGCACATACTTGATGAAGATGG + Exonic
1083911940 11:65715011-65715033 CAGCAGGAACTCAATAAAAATGG - Intronic
1087081344 11:94173815-94173837 AAGCAGAGACTGAATTAAGAGGG - Intronic
1087371033 11:97284119-97284141 CCTCAGAAACTGGATGTAGAAGG + Intergenic
1088649722 11:111946718-111946740 CAGCAGGAACTCATTGAAGTCGG + Intronic
1088969410 11:114759529-114759551 CAGCAGAAACTGACGCAATAAGG - Intergenic
1089802683 11:121048579-121048601 TAGCAGAAACAGAATAAAGCTGG - Intronic
1089916956 11:122166173-122166195 AAGAAGAAACTGAATTAAGAGGG + Intergenic
1090381843 11:126332849-126332871 CAGCAGAAACTCTAAGAAGGTGG - Intronic
1090861068 11:130652850-130652872 CAGCAGTAAATGAATGAGCATGG + Intergenic
1090998137 11:131885549-131885571 CAGCAGAAACTGCAAGAGCAAGG + Intronic
1092456186 12:8644936-8644958 CAGCTGTAACACAATGAAGAAGG - Intronic
1092668645 12:10836619-10836641 CAGCAGAAACTGAGAGATAAGGG + Intronic
1093099649 12:15012467-15012489 GACCAGAAAGTAAATGAAGAGGG + Intergenic
1093314728 12:17634148-17634170 CAGAACAAACAGAATGAAGGGGG - Intergenic
1093692278 12:22121874-22121896 CAGCAGAGAAAGAAGGAAGATGG - Intronic
1093795127 12:23301978-23302000 CAGGAGGAAAAGAATGAAGAGGG - Intergenic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094452459 12:30597081-30597103 CAGCAGGCATTGAGTGAAGAAGG + Intergenic
1095033339 12:37322901-37322923 CACCAGCAACGGAATGAAGCTGG - Intergenic
1095538712 12:43282990-43283012 CAGAAGAAACTAAATGAACAGGG + Intergenic
1095794741 12:46206012-46206034 AATCAGAAACTGAATAAAAATGG - Intronic
1095849298 12:46783886-46783908 CAACAGAAACAGTATGAAGCTGG + Intronic
1096737285 12:53665600-53665622 CTACAGGAACTGAATGAAGGGGG + Intronic
1096861005 12:54528110-54528132 GAGAAGAAACTCAAAGAAGATGG - Intronic
1096949628 12:55453167-55453189 TGGCATAAAGTGAATGAAGAAGG + Intergenic
1097167481 12:57093496-57093518 CAGCAGACACTGATGGACGAGGG + Exonic
1097508072 12:60501409-60501431 CATGAGAAACAGAATGAATATGG + Intergenic
1097925957 12:65126595-65126617 CAGGAGAAACCGACTGAAGCAGG - Intergenic
1098166550 12:67704497-67704519 CACCAAAAACTAAATCAAGATGG - Intergenic
1098992143 12:77075514-77075536 CAGCAGAAAATGGACAAAGATGG + Intergenic
1099455906 12:82862714-82862736 AAGCAGAAAGTGAATGATGGAGG + Intronic
1100464938 12:94836154-94836176 CCTCAGAAAGTGAATGATGATGG + Intergenic
1100734770 12:97514098-97514120 CAGCAGAAACTGGAAGTACAGGG + Intergenic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1102923542 12:116810239-116810261 CAGCAGAGACTTCCTGAAGAAGG + Intronic
1103283807 12:119783681-119783703 CAGCAGAAAGTGCAGGTAGACGG - Intronic
1105365647 13:19761921-19761943 CTTCAGAAACAGAATTAAGAGGG + Intronic
1105652135 13:22390622-22390644 CAGCATAAAGAGAATGAAAAGGG - Intergenic
1106572047 13:30935475-30935497 CAGCAGCCAGAGAATGAAGAGGG + Intronic
1106632137 13:31485794-31485816 CAGCTTAAACTGAATTAATATGG + Intergenic
1106687437 13:32075872-32075894 CAGCAGAAAATGATTCAAGGTGG - Intronic
1107026445 13:35806641-35806663 AGTTAGAAACTGAATGAAGAAGG - Intronic
1107131331 13:36899545-36899567 CAGGAGGAACTAAATGAAGTCGG + Intronic
1108294138 13:48996227-48996249 CAGTAGCAACTGTATCAAGATGG - Intronic
1109043528 13:57376032-57376054 CCACAAAAACTGAATGAAAACGG - Intergenic
1109237123 13:59837356-59837378 CACAAGAAACTGAATGATGTCGG - Intronic
1109267168 13:60215239-60215261 CAGCAGAATCTGTAGGAGGATGG - Intergenic
1110997608 13:82133039-82133061 CACCAAAAACTCAATGAGGAGGG - Intergenic
1111146124 13:84182859-84182881 CAACATAAACTGGAAGAAGACGG + Intergenic
1111482756 13:88853003-88853025 AAGCAGAAAGTGAAAGAATAGGG + Intergenic
1112717660 13:102205128-102205150 CAGCAGAAACTGAGAGAAGAAGG + Intronic
1113164004 13:107417078-107417100 CATAAGAAACTGAGTGAAGAAGG - Intronic
1113785037 13:112997962-112997984 CAGCAGCAGCTGTATGAAGCCGG + Intronic
1115024764 14:28730348-28730370 TAGCAGAAACAGGATGACGAAGG - Intergenic
1115224878 14:31092202-31092224 GAGGAGAAAATGAATGAAGAAGG - Intronic
1115279379 14:31644301-31644323 CAGGAAAAACAGTATGAAGATGG - Intronic
1115358046 14:32470499-32470521 CATCAGCAACTGAACAAAGAAGG + Intronic
1116560640 14:46374733-46374755 CAGCTAAAACTATATGAAGAGGG - Intergenic
1116747869 14:48844958-48844980 CAGCAGAAGGTGGAAGAAGATGG + Intergenic
1117937904 14:60927699-60927721 GAGCAGAAACAGAAAGAAGGTGG - Intronic
1118492387 14:66273764-66273786 CTGTAGAGACTGCATGAAGAGGG + Intergenic
1118562785 14:67104989-67105011 CAGCAAAAACAGCATTAAGAGGG - Intronic
1118664334 14:68050355-68050377 CAGGAGAAAATGAAAGATGATGG - Intronic
1120407597 14:84108352-84108374 CTGCTGAATATGAATGAAGAAGG + Intergenic
1120441719 14:84549431-84549453 CACCAGAAACTGAAAGAGGAAGG + Intergenic
1120496597 14:85245405-85245427 CATCAGAAAATCAATGGAGATGG - Intergenic
1121220538 14:92281601-92281623 TAGCAGAAAATGGATGAAGAGGG - Intergenic
1121684311 14:95821737-95821759 CAGGAGAAAGAGAATGCAGAGGG - Intergenic
1122256665 14:100483080-100483102 CATCTGAAACTGCATCAAGAAGG - Intronic
1126860701 15:52879974-52879996 GAGCAGAAAGAGAAGGAAGAGGG - Intergenic
1127598638 15:60512594-60512616 CAGCAGAAAGTGTTTAAAGATGG - Intronic
1127714913 15:61640592-61640614 GAGCAGAGACTGAGTGAGGAAGG + Intergenic
1128105819 15:65044003-65044025 CACTAAAAACTGAATGATGAGGG - Intergenic
1129527976 15:76234592-76234614 CAACAGAAACAGAAAGAAGGAGG + Intronic
1129949951 15:79576889-79576911 CAACAGAAAATGAACTAAGACGG - Intergenic
1131307415 15:91257795-91257817 GAGCATAATCTGGATGAAGATGG - Intronic
1131622755 15:94084463-94084485 AAGGAGAAACTGGATAAAGATGG - Intergenic
1131674125 15:94653986-94654008 CAGCACAAACTGAATAAAAAAGG - Intergenic
1131972202 15:97904071-97904093 AAGAAGAAACTGAATAAAGGTGG + Intergenic
1132976535 16:2713893-2713915 CAGCAGACCCAGAAGGAAGAGGG - Intronic
1133855085 16:9542152-9542174 AAGAAGAAACTGAAACAAGAAGG + Intergenic
1133966530 16:10535951-10535973 CAGCAGATGCTGATTCAAGAGGG + Intronic
1134628351 16:15739018-15739040 AAGCAGAAACTTAAAGATGAAGG - Intronic
1135012140 16:18891400-18891422 CAGGAGAAAATTAATGAAAATGG - Intronic
1135318996 16:21478624-21478646 CAGGAGAAAATTAATGAAAATGG - Intergenic
1135371894 16:21910417-21910439 CAGGAGAAAATTAATGAAAATGG - Intergenic
1135439894 16:22460287-22460309 CAGGAGAAAATTAATGAAAATGG + Intergenic
1135492486 16:22921986-22922008 CAGCAAGAACTTCATGAAGAAGG + Intergenic
1135495451 16:22947880-22947902 CAGCAGAAACGGGATAATGAGGG + Intergenic
1135507987 16:23055613-23055635 CAGCAGGAACAGACTAAAGATGG + Intergenic
1136329301 16:29560694-29560716 CAGGAGAAAATTAATGAAAATGG - Intergenic
1136369161 16:29825256-29825278 AAGCAGAGACTGAAGGAAGTTGG + Intronic
1136407807 16:30058903-30058925 CAGCAGAAACAAGATGGAGAAGG + Intronic
1136443930 16:30300405-30300427 CAGGAGAAAATTAATGAAAATGG - Intergenic
1136995095 16:35183580-35183602 CAGCAGACCCTGAGAGAAGAAGG + Intergenic
1137342232 16:47619801-47619823 CAGCAGAAACTGCAAGCAGCTGG + Intronic
1137887832 16:52125968-52125990 CAGCAGAGTCTGGAGGAAGAAGG + Intergenic
1139357996 16:66378840-66378862 CAGCAGACAGTGAAGGATGAAGG + Intronic
1140140930 16:72256783-72256805 AAACACAAACTGAAAGAAGAGGG + Intergenic
1141216118 16:82025346-82025368 CACCAGAAGCTGAAAGAAGCAGG - Intergenic
1141337992 16:83175490-83175512 CAGGAGAAACTGTATGGGGATGG + Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1143132270 17:4686442-4686464 AAGCAGAAACTCTATGTAGATGG - Intronic
1143606136 17:7987390-7987412 CAGGAGAAACTGAATTAAACAGG - Intergenic
1145128110 17:20318374-20318396 AAACAAAAACTGAATGAAAAAGG - Intronic
1145978776 17:28999343-28999365 GAGCAGGGACTGAATGAAGGGGG - Intronic
1146525364 17:33562897-33562919 GTGCAGAAAATGAATCAAGAGGG - Intronic
1148616251 17:49002463-49002485 GGGCTGAAAATGAATGAAGAGGG + Intronic
1148661016 17:49332852-49332874 CTGGAGAAACTGAAAGAAAAGGG - Intronic
1149351767 17:55796044-55796066 AAACAGAAAGTGAATGAGGATGG + Intronic
1150236844 17:63600305-63600327 CAGCAGAGAGAAAATGAAGAGGG + Intergenic
1152027334 17:77819605-77819627 TTTCAGACACTGAATGAAGATGG + Intergenic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1152494604 17:80662187-80662209 CAGGAGAAACTGACTGGAAAGGG - Intronic
1153101254 18:1472118-1472140 CAGCAGAGACTTAATAAACATGG - Intergenic
1153748621 18:8206969-8206991 CACCAGAAGCTGAAAGAACAAGG + Intronic
1153749043 18:8210443-8210465 CACCAGAAGCTGAAAGAACAAGG + Intronic
1153933383 18:9898957-9898979 CAGCAGAAACGTAATGTACAGGG - Intergenic
1154143843 18:11849840-11849862 CAGCAGCCACTGAATCCAGATGG - Intronic
1155317379 18:24586086-24586108 GAACAGAAACTGAATGGAGGAGG + Intergenic
1155347404 18:24872170-24872192 CAGCAGAAAATGAGACAAGAGGG - Intergenic
1156409067 18:36810534-36810556 CGGCAGAAAGTGAATGGAGGAGG + Intronic
1156829796 18:41478187-41478209 AAGCAGAAAATCATTGAAGATGG + Intergenic
1157523664 18:48362572-48362594 CAGCAGAAACTGATTGTTCATGG - Intronic
1158679841 18:59557347-59557369 AAGCAGAAACTGAGTGATGAGGG - Intronic
1159231027 18:65606815-65606837 CAGGAGGAAGAGAATGAAGAGGG - Intergenic
1159508269 18:69363044-69363066 TAGCAGAAACTGAAGGAAAGGGG + Intergenic
1160072872 18:75643583-75643605 GAGCAGAGACTGAAGGAGGAGGG - Intergenic
1160471866 18:79142924-79142946 CAACATAAACTGAATGTAAAAGG + Intronic
1162581554 19:11534273-11534295 GAGCAGAGACTGAATGAAGTTGG + Intergenic
1164249279 19:23462930-23462952 AGGGAGAAAGTGAATGAAGAAGG + Intergenic
1164411721 19:28011835-28011857 CACCAGAATCTGAAAGAAGAAGG + Intergenic
1165364702 19:35358413-35358435 CAGCTGAGACTGCATGAGGAGGG + Intergenic
1166757505 19:45202488-45202510 CACCACAAGCTGACTGAAGAGGG - Exonic
1167152213 19:47716827-47716849 CAGCAGGTACTGGATGAAGCTGG - Exonic
1167429299 19:49445336-49445358 CAGCAGAAACTAAGAGATGAGGG + Intergenic
1202696063 1_KI270712v1_random:127486-127508 CAGCAGAAACTGGAAGAGGCTGG + Intergenic
925109076 2:1318472-1318494 AAGCAAAACCTGAATGCAGATGG + Intronic
925214834 2:2085451-2085473 CAGCATAGACTTAATGTAGAAGG - Intronic
925396890 2:3540376-3540398 CAGCAGAAAGTGCATGAAGCCGG - Intronic
926001115 2:9333561-9333583 GAGAAGAAACAGAATGCAGAGGG + Intronic
926172115 2:10558996-10559018 CAGCAGCAACTGAATGAATGGGG - Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
927904239 2:26846180-26846202 CGGCAGAAACTGAAGGAGCAAGG + Intergenic
928190010 2:29155681-29155703 CAGCAGAAACTGAATGAAGAGGG - Intronic
929084509 2:38155191-38155213 CAGCAGGAAATGTATGAAGTAGG - Intergenic
929094212 2:38248271-38248293 CAGTAGAAAATTAATGCAGATGG - Intergenic
929726480 2:44434152-44434174 CAGCATACACATAATGAAGACGG - Intronic
929969618 2:46562920-46562942 CTGCTGAAACTGAATGGAAAAGG + Intronic
930733937 2:54756040-54756062 CAGCCTAAACTTAAGGAAGAGGG - Intronic
931427693 2:62185907-62185929 CAGCATGAATTGCATGAAGAAGG - Intergenic
932601042 2:73125827-73125849 TTCCAGAAAATGAATGAAGAAGG + Intronic
932697462 2:73968672-73968694 CAGCAGAAGCTTCCTGAAGATGG - Intergenic
932747265 2:74344302-74344324 CAGAAGAGACTGGAAGAAGAGGG - Intronic
933288454 2:80409508-80409530 CAGCAGAAAGTGAGAGGAGATGG + Intronic
934764524 2:96873225-96873247 CAGCAGGAAGTGCATGAAGGTGG - Intergenic
935794724 2:106630100-106630122 CAGCAGAAACAGCATGAAGAAGG - Intergenic
935948119 2:108304407-108304429 AAGCAGAGACAGAAAGAAGAGGG + Intronic
936684739 2:114814835-114814857 CAGCAGCAACTGAAGGAAAGAGG - Intronic
936984912 2:118300010-118300032 CAGGAAAAACTGAAAGGAGAGGG + Intergenic
939450638 2:142369119-142369141 CAGCAGAATCTAAATTAAAATGG + Intergenic
939462924 2:142519834-142519856 CAGTAGAAATTGACTGAACATGG - Intergenic
939732980 2:145808359-145808381 CAGCAGAAACAGCAGGGAGAGGG - Intergenic
940173668 2:150855029-150855051 GAACAGAGACTGAATGAAGATGG - Intergenic
940552940 2:155184596-155184618 CAGCAGAATCTGAACTAAGCAGG + Intergenic
941695590 2:168547848-168547870 TAGTAGAAGCGGAATGAAGATGG + Intronic
941717830 2:168782278-168782300 CAGCATGAGTTGAATGAAGAAGG + Intergenic
941845945 2:170133251-170133273 CAGCAAAAGCAGTATGAAGAGGG + Intergenic
942248621 2:174029174-174029196 CTGCAGAAGGTGATTGAAGAGGG + Intergenic
942539496 2:177001062-177001084 GAGGAGAAAATGAATGAGGACGG - Intergenic
942657958 2:178234234-178234256 CAGTTGAATCTGAATGAATATGG + Intronic
943964466 2:194315035-194315057 CAAAAGAAACAGAATGAAAAGGG - Intergenic
944018627 2:195074167-195074189 CTGCAGAAAGTCAATGAAGTAGG - Intergenic
944610150 2:201395309-201395331 CAGCACAAACTTAAAGAAGTAGG - Exonic
944646628 2:201786795-201786817 CAGCAGTAACTGAAACAAGTGGG + Intergenic
945511317 2:210706501-210706523 CAGCAGCAGTTGAATGAAGAAGG + Intergenic
948787747 2:240361764-240361786 CAGCAGAGACTGAAGGACAATGG + Intergenic
1169425927 20:5497402-5497424 CAGCAGGAACTGAGAGAAGAAGG + Intergenic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170099287 20:12680977-12680999 CCTCAGAGACAGAATGAAGATGG + Intergenic
1170696121 20:18660545-18660567 AAGCAGAAACTGAAAGAAAAAGG + Intronic
1172017448 20:31886247-31886269 CAATAGAAAATGAATGCAGATGG + Intronic
1172367364 20:34360331-34360353 CTAGAGAAACTGAATGAGGATGG + Intergenic
1172451772 20:35030452-35030474 CAGCACAAAAAGAATGAAGATGG - Intronic
1173159855 20:40644362-40644384 CAGCAGAGCCTGGATGCAGACGG - Intergenic
1174378152 20:50139771-50139793 CAGGAGAAATTGATTGAACACGG - Intronic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174959779 20:55142613-55142635 CAATAGAAACTGGAAGAAGAAGG + Intergenic
1175047253 20:56118774-56118796 CACCAGAAACTCAAAGAAAAAGG - Intergenic
1177897598 21:26872853-26872875 CCCCAAAAAATGAATGAAGAAGG + Intergenic
1178597081 21:33963863-33963885 CAGCATAAAATGAAAGAGGAGGG - Intergenic
1178709005 21:34897751-34897773 AAGCAGAAACTGGTTGTAGAAGG + Intronic
1182385385 22:29935522-29935544 CAGCAGAAACTGAAATGATACGG + Intronic
1184187296 22:42873333-42873355 TATCAGAAACTGGATGAAGATGG + Intronic
1184384541 22:44166817-44166839 CAGCTGATTTTGAATGAAGAAGG - Intronic
1184522678 22:45004701-45004723 AAGCAGCCACTGAATGAAGCTGG - Intronic
1184809758 22:46823383-46823405 GAACAGAAACTGAATGGAGCTGG - Intronic
1184821064 22:46909636-46909658 CAGCAGCAACAGAAGGAAGAAGG - Intronic
950680423 3:14581388-14581410 CAGGAGAGACTGACTGCAGAGGG + Intergenic
950844802 3:16004538-16004560 AAGCAGAGTCTGAATGCAGAAGG - Intergenic
951074496 3:18373150-18373172 CTTTAGAAAGTGAATGAAGAAGG + Intronic
951164145 3:19464566-19464588 CAGCAGTAACAGAATAAAAAGGG + Intronic
951534864 3:23731293-23731315 CACCAGAAACTGGAAGAAGCAGG - Intergenic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953215183 3:40911441-40911463 CAGCAGAAAGAGAATAAAGCTGG - Intergenic
953371496 3:42392365-42392387 CAGCTAAAGGTGAATGAAGAAGG + Intergenic
953772675 3:45790935-45790957 CAGAAGAAACTGTATGCAAAAGG - Intronic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
954988897 3:54821072-54821094 CAGCAGAAAATGAAGGGAAAGGG - Intronic
955466507 3:59242901-59242923 CAGCAGAGAGTGAGTGTAGACGG - Intergenic
956219890 3:66891249-66891271 TAGCAGAAACTGAGGGAAAATGG - Intergenic
956525552 3:70155659-70155681 CAGCAGAATCTGAAAGAAAGGGG - Intergenic
957255837 3:77836799-77836821 TAGTAGAAACTGATTGAAGAAGG + Intergenic
958170621 3:89935059-89935081 CATCTGAAACTGAAAGAAAAAGG + Intergenic
958822576 3:98992464-98992486 CAGAGGAAACTGAAGGGAGAGGG - Intergenic
959095122 3:101947346-101947368 CAGCACAATCTGAATGAGGCTGG + Intergenic
959514388 3:107249128-107249150 TAACAATAACTGAATGAAGAAGG - Intergenic
960088538 3:113615872-113615894 CAGCAGAAAGGCAAGGAAGATGG - Intronic
962378419 3:134877475-134877497 CAGCAGCAACTGGTTGAATATGG - Intronic
962542001 3:136391729-136391751 CAGAAGGAGCTGAAGGAAGAAGG + Intronic
963033216 3:140999812-140999834 CAGGTGACACTGAATCAAGATGG - Intergenic
963422531 3:145078324-145078346 CACCAGAAGCTGAAGGAACAAGG - Intergenic
965421063 3:168458598-168458620 AAGCAAAAACTGAAAGAAAAGGG - Intergenic
965850867 3:173021211-173021233 CAGCAGAAAGTAGAGGAAGACGG + Intronic
967467314 3:189822880-189822902 CAGCAGAAAATGAATGGTCAGGG + Intronic
968819402 4:2838107-2838129 CTGCAGGAAATGAATGAAAAAGG - Exonic
970290161 4:14563280-14563302 TAGCAGAAACTAAATGTAAATGG - Intergenic
970337236 4:15061030-15061052 CAGCAGAAACTCATTGGAGCAGG + Intronic
970420349 4:15900118-15900140 AGGAAGAAAATGAATGAAGAAGG - Intergenic
970905056 4:21205956-21205978 AGGCAGAACCTGAATGCAGATGG - Intronic
972822028 4:42713004-42713026 CAGCACACACTGACTGAAGGTGG + Intergenic
973911515 4:55586112-55586134 CAGCAGAAGCAGATTTAAGAGGG - Intronic
974744929 4:66059843-66059865 GAGAAGAAACTGAGTGAAGCAGG + Intergenic
975543244 4:75535768-75535790 CAGCATAAACTGGGTAAAGATGG + Intronic
975608167 4:76176993-76177015 CCAGAGAAACTGAATCAAGAGGG - Intronic
976744398 4:88389081-88389103 GAGCAGAAACCAAATGAAAAGGG + Intronic
978456366 4:108896984-108897006 GAGCAGAGACAGAATTAAGAAGG - Intronic
979622939 4:122815943-122815965 CAGCACCAACTCAATGAAGTCGG + Intergenic
980663034 4:135891981-135892003 CAGCAGAAAATTAATGAAGATGG - Intergenic
981515050 4:145598691-145598713 CAACACAAAATGAACGAAGATGG - Intergenic
981792107 4:148549860-148549882 CAGCACGTACAGAATGAAGAAGG - Intergenic
981972537 4:150682184-150682206 CATCAGATACTGAATGAATTAGG - Intronic
982872137 4:160593764-160593786 TAGCTGAAACAGAAAGAAGACGG + Intergenic
982934760 4:161458641-161458663 AAGCAGAAACAGAAAGAAAATGG - Intronic
983380413 4:166984628-166984650 CAGCAGAAACTGAATAAACAGGG + Intronic
984535741 4:180973157-180973179 AAGCAGAAGCTAAGTGAAGAGGG + Intergenic
986940628 5:12945021-12945043 GAACATAAACTGAATGCAGATGG + Intergenic
987274024 5:16343160-16343182 CACCAAAAACTGAATGCTGATGG + Intergenic
988998686 5:36739047-36739069 TAGCACAAACTTAATGAATATGG + Intergenic
989689531 5:44124124-44124146 CAACAGAAAATGAATTCAGAAGG - Intergenic
991496718 5:67234059-67234081 AAACAGAAACTGATGGAAGAAGG - Intergenic
992136636 5:73752702-73752724 CAGGAGTAACTGAAAGAAGATGG + Intronic
992423444 5:76630186-76630208 CAGCTGACAGTGAAGGAAGAAGG + Intronic
992480377 5:77145622-77145644 CAGCAGGAACTCAAGGTAGAAGG + Intergenic
993155405 5:84215836-84215858 CAGTAGAAACTGAAGCCAGAAGG + Intronic
993196555 5:84755605-84755627 AAGCAGAAACTGCAAGAAAAGGG - Intergenic
993807371 5:92428036-92428058 AAGGAGAAACTAAATGAAGAAGG - Intergenic
994456160 5:100010787-100010809 CATCAGAAACAGAATAGAGAAGG + Intergenic
994681874 5:102898172-102898194 CAGCCGAATCTGAATCGAGAGGG - Intronic
995306688 5:110659304-110659326 CAGCAGAAAAAGAATGAGAATGG + Intronic
996284466 5:121771924-121771946 CACCAGAAACTGAAGGAAGAGGG - Intergenic
997866843 5:137471426-137471448 TTGCAGCAACTGAATGAAGTAGG - Intronic
997926713 5:138036870-138036892 CAGCAGATCCTGAATTCAGAAGG - Intronic
998659445 5:144219867-144219889 CAGGAGAAACTGAGAGCAGATGG + Intronic
1000060780 5:157653105-157653127 CAGTAGAAAGAGAATGATGATGG - Intronic
1000065786 5:157691934-157691956 CAGTAGAAAGAGAATGATGATGG - Intergenic
1001902116 5:175441007-175441029 CAGCAGAAACTGATAGATAAGGG - Exonic
1003559217 6:7167196-7167218 CAGCAGCAACTGAAGTCAGAGGG + Intronic
1004076726 6:12350689-12350711 CAGGAGGAAGAGAATGAAGAGGG + Intergenic
1004922878 6:20393673-20393695 CAGTTGAATGTGAATGAAGAGGG + Intergenic
1005364889 6:25066931-25066953 CAGCAGATACAGGATGGAGAGGG + Intergenic
1006152756 6:31998079-31998101 CAAGAGACACAGAATGAAGAAGG - Intronic
1006159064 6:32030816-32030838 CAAGAGACACAGAATGAAGAAGG - Intronic
1007769498 6:44181211-44181233 CAGCAGAGAAGGAGTGAAGAAGG - Intronic
1007814601 6:44512443-44512465 CAGAAAAGACAGAATGAAGAAGG + Intergenic
1007869038 6:45011378-45011400 CCACTGAAACTGAATCAAGAAGG - Intronic
1008164241 6:48116069-48116091 AAGCAACAACTAAATGAAGAGGG - Intergenic
1008798589 6:55338719-55338741 CAGAAGAAACAGAATGAAGTGGG + Intronic
1009758981 6:67979229-67979251 CTGCAGAAACTGGATGAACCTGG - Intergenic
1009875707 6:69502313-69502335 CAGCAAAAACTGTACTAAGAGGG + Intergenic
1010472722 6:76248918-76248940 AAGCAGAAACTGATTCAAGAAGG + Intergenic
1011940243 6:92833992-92834014 CATAAATAACTGAATGAAGAAGG + Intergenic
1013840712 6:114389790-114389812 AAGCAGAAACTAAAAGAACAAGG + Intergenic
1014220514 6:118794479-118794501 TAGCAGACACTGAATGAGCAAGG - Intergenic
1015710141 6:136130327-136130349 CAGTAGAAAAGGAATGAGGAAGG - Intronic
1016154870 6:140793018-140793040 CAGCAGAAAATGAGTGACAAGGG - Intergenic
1016878180 6:148884456-148884478 GAATAGAGACTGAATGAAGAGGG + Intronic
1017707402 6:157136390-157136412 CAGCAGAAACTGACTTACGAGGG + Intronic
1018000713 6:159576258-159576280 CACCAGAAACTGGAAGAGGAAGG + Intergenic
1018345441 6:162894044-162894066 CAGCAAAACCAGAATGAAAAAGG - Intronic
1018496984 6:164358927-164358949 GAATAGAGACTGAATGAAGAAGG - Intergenic
1018550768 6:164996138-164996160 CAGCAAAAACATAAGGAAGAGGG + Intergenic
1019693855 7:2433541-2433563 CAGCAGGTACTGGATGAAGTTGG - Exonic
1019754033 7:2755038-2755060 CAGAAGCAACTCAGTGAAGAAGG - Intronic
1020507514 7:9011394-9011416 CAGCAAAAACAGAACTAAGAGGG - Intergenic
1020641516 7:10759800-10759822 TAGCAGAAACAGTATGAACATGG - Intergenic
1020940833 7:14535025-14535047 CAGCAAAAGCAGTATGAAGAGGG + Intronic
1021666516 7:22986953-22986975 TAGCAGAGAATTAATGAAGATGG + Intronic
1022657529 7:32333654-32333676 GAGCAGAAACTGAGTCAAGGAGG - Intergenic
1023930955 7:44706285-44706307 CAGCAGAAACAGAGTAAACATGG + Intronic
1024059124 7:45685353-45685375 CAGCAGTAACAGGATGAAGCTGG + Intronic
1024431624 7:49294945-49294967 AAGGAGAATCTGAAAGAAGAAGG + Intergenic
1024881871 7:54096117-54096139 CAGCAGCAAGAGAATTAAGAAGG - Intergenic
1026113226 7:67474999-67475021 GAGCAGAGACTGGATGATGATGG + Intergenic
1027388456 7:77681522-77681544 CAGCCCAAACTGACTGAAGATGG - Intergenic
1027766882 7:82355089-82355111 CTGCAGAGACTAAATGAGGAGGG + Intronic
1030829236 7:114200462-114200484 CAGGAAACACTGAAAGAAGAAGG + Intronic
1032300467 7:130681736-130681758 CAGCAGAAAGGGAATGGAAAAGG - Intronic
1032346160 7:131118738-131118760 CAGAAGAAAGAGAATGAAGGGGG + Intronic
1033458735 7:141526500-141526522 GATCTGAAACTGCATGAAGATGG + Intergenic
1033962945 7:146936244-146936266 CAGAAGAAACTGTATAAAAATGG + Intronic
1034061317 7:148093659-148093681 CATCAGCAACTGAATGTAGGTGG + Intronic
1035038163 7:155908710-155908732 CAGCAGAGGCCGAATGCAGAGGG + Intergenic
1036582690 8:10090132-10090154 AAGCAGAGACTTAATGCAGAGGG + Intronic
1036735448 8:11310897-11310919 CAGCTCAAACTAAATGAAGGTGG - Intronic
1037003194 8:13746615-13746637 CAGCAGATTCTGAATGAGGTAGG - Intergenic
1038359035 8:26859327-26859349 GAGCAGAGACTTAAAGAAGATGG - Intronic
1038987826 8:32832738-32832760 CAGCAGGAACTGAAAGGAAATGG - Intergenic
1039274226 8:35917697-35917719 TAGAAGAGACTTAATGAAGAGGG - Intergenic
1039550997 8:38442705-38442727 CAGCAGAAATTGTATGGGGAAGG + Intronic
1039861028 8:41457823-41457845 CAGCATACACTGAAGGATGAAGG - Intergenic
1040021633 8:42746063-42746085 CAGCAGATGCTGAGTGCAGAGGG - Intergenic
1040629083 8:49188667-49188689 CAGCCCATACTTAATGAAGAGGG - Intergenic
1041482255 8:58334597-58334619 CAGCTGAAACTGTGTTAAGAGGG + Intergenic
1041863101 8:62536501-62536523 CTGTAGAAACTGAATAAGGAAGG + Intronic
1044140794 8:88649082-88649104 AAACAGAAACAGAATGAATAGGG - Intergenic
1044698548 8:94947237-94947259 CAGCTGAAACTAACTGAAAAGGG - Intronic
1045431861 8:102122525-102122547 CAGCAGGAACTGAGAGAAGAGGG + Intronic
1045480088 8:102584831-102584853 CTGCAGAGTCTGAAAGAAGAGGG - Intergenic
1046373237 8:113339749-113339771 CAGCAAAAACTGAAATAACAAGG - Intronic
1047975405 8:130125117-130125139 GAGCAGAACCTGAATGAACCTGG - Intronic
1048130549 8:131692853-131692875 CATCAGAAACTGAGTGATGTTGG - Intergenic
1050010281 9:1179107-1179129 CAGAAGAAAATGAATGAAATGGG + Intergenic
1050958780 9:11700301-11700323 CAGAATAATCTGAATAAAGAGGG - Intergenic
1051804147 9:20972900-20972922 CAGCAGATGCTGAAAGAAGAGGG - Intronic
1051804156 9:20973002-20973024 CAGCAGATGCTGAAAGAAGAGGG - Intronic
1051804174 9:20973211-20973233 CAGCAGATGCTGAAAGAAGAGGG - Intronic
1051804182 9:20973316-20973338 CAGCAGATGCTGAAAGAAGACGG - Intronic
1052025943 9:23573136-23573158 CAGGAGAAAGAGAATGAAGGGGG + Intergenic
1052757528 9:32556207-32556229 TAGCAGAAACTCCATGAACAGGG + Intronic
1052968107 9:34357372-34357394 TTACAGAAACTGACTGAAGAAGG - Intergenic
1056801355 9:89694276-89694298 ATGCAGAAACTGGATGAACAGGG + Intergenic
1058505438 9:105661511-105661533 GAGCAGGAACAGAATGATGAAGG - Intergenic
1059636077 9:116171883-116171905 AAGCAGAAGCTGATTGAAGAAGG + Intronic
1185611949 X:1398340-1398362 TAGCAGACACTGAAGGGAGAGGG + Intergenic
1185967945 X:4628738-4628760 CAGCAGACACTGATTGATCATGG - Intergenic
1187383388 X:18825576-18825598 GATCACAGACTGAATGAAGAGGG + Intronic
1187399801 X:18949488-18949510 CAGAAGGAAGTAAATGAAGATGG + Intronic
1187411233 X:19052211-19052233 CAGCATAGAGTGAATGGAGATGG - Intronic
1187412351 X:19062346-19062368 CAGGGGAAACTGAAAGCAGAGGG - Intronic
1188068273 X:25687902-25687924 TAGCAAAAACAGAATGGAGAAGG + Intergenic
1188984949 X:36760888-36760910 CAGCAGAGCGTGAGTGAAGAGGG - Intergenic
1191050912 X:56190808-56190830 CAGCAAAACCAGTATGAAGAAGG + Intergenic
1191146810 X:57175118-57175140 AAGCAGAAAGTCAATGAAGAAGG - Intergenic
1192635930 X:72817572-72817594 CTGCAGAAACTGAGTATAGAAGG - Intronic
1192645784 X:72903231-72903253 CTGCAGAAACTGAGTATAGAAGG + Intronic
1192945086 X:75957676-75957698 GAGCAGAATCTGAAAGTAGAGGG - Intergenic
1193656678 X:84206748-84206770 CAGGAGAAAATAAAGGAAGAGGG - Intergenic
1194724281 X:97376146-97376168 TAGCAAAAACTGAGTGATGAAGG - Intronic
1194858158 X:98959977-98959999 CAGAAGAAACAGAAACAAGATGG + Intergenic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1195845172 X:109219795-109219817 CAGCAGGGACTGAGAGAAGAGGG + Intergenic
1197129684 X:122990748-122990770 CAGCAGAAGCTCAATGAAAATGG - Intergenic
1197213112 X:123844489-123844511 TAGCATAACCTCAATGAAGAGGG + Intergenic
1197266925 X:124384263-124384285 CAGTATAAAATGGATGAAGATGG - Exonic
1198978011 X:142359021-142359043 CAGAAGAAGATGAAAGAAGAAGG - Intergenic
1199464417 X:148119988-148120010 CAGCAAAAACTGTTTTAAGAGGG + Intergenic
1200235184 X:154464662-154464684 CATCGGGAACTGAAGGAAGAAGG - Intronic
1200571062 Y:4830038-4830060 CAGCTGAAGCAGAATTAAGAGGG + Intergenic